To remarkably enhance the sensitivity of the Marker Rescue method testing RCR(replication competent retrovirus) pollution of a vector for gene therapy by designing and preparing a specific retrovirus vectors.

This method is capable of detecting RCR pollution which is insensitive to PG-4 cell without requiring any skill, by using a cell obtained by transducing the sequence including two or more sequence including at least 15 sequential sub-units corresponding the whole length or a part of the nucleotide sequence of the 90 mer of the core region of the packaging signal of a murine sarcoma virus, AGGGCCTG TATCTGGCGGACCCGTGGTGGAACTGACGAGTTCGGAACACCCGGC CGCAACCCTGGGAGACGTCCCAGGGACTTAGGGCCT, forwardly to a DNA of the retrovirus vector originating from murine leulkemia virus having original packaging signal .