Skin secretions of frogs contain many different types of antibacterial peptides (Barra, D. & Simmaco, M. (1995) Amphi- bian skin: a promising resource for antimicrobial peptides, Trends Biotechnol. 13, 205-209 for a recent review). In par- ticular, a variety of such peptides has been isolated from several Rana species. They all contain two cysteine residues close to the COOH-terminus which form an intramolecular di- sulfide bridge. Four different groups of these peptides can be discerned. One is the brevinin 1 family, which includes brevinin 1 from Rana brevipoda porsa (Morikawa, N., Hagiwara, K. & Nakajima, T. (1992) Brevinin-1 and Brevinin-2, unique antimicrobial peptides from the skin of the frog, Rana bre- vipoda porsa, Biochem. Biophys. Res. Commun. 189, 184-190), brevinin 1E from Rana esculenta (Simmaco, M., Mignogna, G., Barra, D. & Bossa, F. (1994) Antimicrobial peptides from skin secretion of Rana esculenta. Molecular cloning of cDNA enco- ding esculentin and isolation of new active peptides, J.Biol.Chem. 269, 11956-11961), ranalexin from Rana catesbei- ana (Clark, D.P., Durell, S., Maloy, W.L. & Zasloff, M.

(1994) Ranalexin, a novel antimicrobial peptide from bullfrog (Rana catesbeiana) skin, structurally related to the bacteri- al antibiotic, polymixin, J.Biol. Chem. 269, 10849-10855) and gaegurin 5 and 6 from Rana rugosa (Park, J.M., Jung, J.-E. & Lee, B.J. (1994) Antimicrobial peptides from the skin of a korean frog, Rana rugosa, Biochem. Biophys. Res. Commun. 205, 948-954). These peptides are composed of 20-24 amino acid re- sidues. In addition to their antibacterial action, brevinin 1E and ranalexin also have high hemolytic activity. A second group are the brevinin 2 peptides, which contain 29-34 amino acids. Besides brevinin 2 from R. brevipoda porsa (Morikawa,

N., Hagiwara, K. & Nakajima, T. (1992) Brevinin-1 and Brevi- nin-2, unique antimicrobial peptides from the skin of the frog, Rana brevipoda porsa, Biochem. Biophys. Res. Commun.

189, 184-190), several peptides from R. esculenta (Simmaco, M., Mignogna, G., Barra! D. & Bossa, F. (1994) Antimicrobial peptides from skin secretion of Rana esculenta. Molecular cloning of cDNA encoding esculentin and isolation of new ac- tive peptides, J.Biol.Chem. 269, 11956-11961), the gaegurins 1-3 (Park, J.M., Jung, J.-E. & Lee, B.J. (1994) Antimicrobial peptides from the skin of a korean frog, Rana rugosa, Bi- ochem. Biophys. Res. Commun. 205, 948-954) and rugosins A and B from R. rugosa (Suzuki, S., Ohe, Y., Okubo, T., Kakegawa, T. & Tatemoto, K. (1995) Isolation and characterization of novel antimicrobial peptides, rugosin A, B and C, from the skin of the frog, Rana rugosa, Biochem. Biophys. Res. Commun.

212, 249-254) belong to this family. A third group are the 37 residue peptides esculentin 2 from R. esculenta (Simmaco, M., Mignogna, G., Barra, D. & Bossa, F. (1994) Antimicrobial pep- tides from skin secretion of Rana esculenta. Molecular clo- ning of cDNA encoding esculentin and isolation of new active peptides, J.Biol.Chem. 269, 11956-11961) and gaegurin 4 (Park, J.M., Jung, J.-E. & Lee, B.J. (1994) Antimicrobial peptides from the skin of a korean frog, Rana rugosa, Bi- ochem. Biophys. Res. Commun. 205, 948-954) and rugosin C from R. rugosa (Suzuki, S., Ohe, Y., Okubo, T., Kakegawa, T. & Ta- temoto, K. (1995) Isolation and characterization of novel an- timicrobial peptides, rugosin A, B and C, from the skin of the frog, Rana rugosa, Biochem. Biophys. Res. Commun. 212, 249-254). Lastly, esculentin 1 from skin secretion of R. esculenta (Simmaco, M., Mignogna, G., Barra, D. & Bossa, F.

(1994) Antimicrobial peptides from skin secretion of Rana esculenta. Molecular cloning of cDNA encoding esculentin and isolation of new active peptides, J.Biol.Chem. 269, 11956- 11961), a 46 amino acid peptide that has the highest antibac- terial activity of all the Rana peptides characterized so far. In addition, it is also active against Candida albicans,

Saccharomyces cerevisiae and Pseudomonas aeruginosa.

The present invention has for an object to provide rela- tively small polypeptides of antimicrobial activity.

Another object of the invention is to provide such new polypeptides having antibacterial or fungal use.

Yet another object of the invention is to provide phar- maceutical compositions containing one or more such polypep- tides contained in a pharmaceutically acceptable matrix.

Still another object of the invention is to provide a method for inhibiting microbial growth in animals, such as mammals including man.

For these and other objects which will be clear from the following disclosure the invention provides for the following new peptides: F L P L I G R V L S G I L - amide L L P I V G N L L K S L L - amide L L P I L G N L L N G L L - amide L L P I V G N L L N S L L - amide V L P I I G N L L N S L L - amide F L P L I G K V L S G I L - amide F F P V I G R I L N G I L - amide L S P N L L K S L L - amide L L P N L L K S L L - amide F V Q W F S K F L G R I L - amide G L L S G L K K V G K H V A K N V A V S L M D S L K C K I S G D C Particularly preferred polypeptides are the following: F L P L I G R V L S G I L - amide L L P I V G N L L K S L L - amide F L P L I G K V L S G I L - amide F F P V I G R I L N G I L - amide F V Q W F S K F L G R I L - amide Within the scope of the invention there are also inclu-

ded functional derivatives and pharmaceutically acceptable salts of the polypeptides mentioned above.

The polypeptides according to the present invention can be used each per se or can be used in combinations of two or more polypeptides.

The polypeptides are therapeutically useful, such as for antimicrobial use, including antibacterial or fungal use.

The invention also provides for the use of one or more of the polypeptides disclosed above for the manufacture of a medicament having antimicrobial activity.

Furthermore, the invention provides for a pharmaceutical composition containing as an active ingredient one or more polypeptides as described above in an effective amount toget- her with a pharmaceutically acceptable carrier or diluent.

Said carrier or diluent is suitably adapted for oral, intra- veneous, intramuscular or subcutaneous administration.

According to the invention there is also provided a cDNA clone having the sequence selected from the sequences shown as clone Rt-5, Rt-6 and Rt-17 as disclosed in the following.

Finally, the invention provides for a method for inhibi- ting microbial growth in animals, such as mammals including man, comprising the step of administering to an animal sub- ject to a disorder caused by antimicrobial attack one or more polypeptides as described above or a composition thereof, an inhibitory amount being administered.

Such method can be directed to intestinal use constitu- ted by oral administration of a composition as defined above in a slow release form. The method can also be directed to administration by injection of such a composition in an in- jectable dose form.

With regard to the expression "functional derivatives thercof" it is well known in regard to the technical area to which the present invention pertains that minor amino acid substitutions can be made to the polypeptide which do not af- fect or do not substantially affect the function of the poly- peptide. Determination of conceivable substitutions is ac-

complished according to.procedures well known to those skil- led in the art. Thus, all polypeptides having substantially the same amino acid sequence, substantially the same helical structure and substantially the same biological activity, such as antimicrobial and lytic activity, are within the scope of this invention.

Also within the scope of the present invention are phar- maceutically acceptable salts of the polypeptides of this in- vention. Such salts are formed by methods well known to skil- led artisans. Thus, for example base salts of the polypepti- des can be prepared according to conventional methods. When in the instant disclosure including the claims the term poly- peptide is used said term is intended to include both functional derivatives and pharmaceutically acceptable salts of the polypeptides.

The active polypeptide according to the present inven- tion can be formulated for use in human or veterinary medici- ne for therapeutic or prophylactic use. The active prepara- tions are normally administered orally, rectally or parente- rally, such as by injection in the form of a pharmaceutical preparation or composition comprising the active constituents in combination with a pharmaceutically acceptable carrier which may be solid, semi-solid or liquid, or contained in a capsule, such as when orally administered. The administration may also take the form of topical application. As examples of pharmaceutical preparations there may be mentioned tablets, drops, solutions and suppositories. Usually, the active constituent constitutes the minor part of the preparation, such as from about 0.1 to about 50% thereof based on weight.

In order to prepare pharmaceutical compositions in the form of dose units for oral application the polypeptide of the invention can be mixed with a solid, pulverulent or other carrier, for example lactose, saccharose, sorbitol, mannitol, starch, such as potatoe starch, corn starch, millopectine, cellulose derivative or gelatine, and may also include lubri- cants, such as magnesium or calcium stearate, or polyethylene

glycol waxes compressed to the formation of tablets or bodies for drags. The dose units may also be presented in a coated form of enteric type.

By using several layers of the carrier or diluent tab- lets operating with slow release can be prepared.

Liquid preparations for oral application or for injec- tion can be made in the form of elexirs, syrups or suspen- sions, for example solutions containing from 0.1 to 20% by weight of active substance, sugar and a mixture of ethanol, water, glycerol, propyleneglycol and possibly other additives of a conventional nature.

The dose by which the active constituent is administered may vary within wide limits and is dependent on different factors, such as the seriousness of the disorder, the age and the weight of the patient and can be adjusted individually.

In finding the new polypeptides according to the present invention the skin of Rana temporaria, a red frog found in many parts of Central Europe, was used. A cDNA library prepa- red from the skin of this frog was screened with a DNA frag- ment encoding the signal peptide of the precursor of esulen- tin 1 from R. esculenta. Using this approach several clones could be isolated with inserts that potentially coded for the precursors of new peptides. The new peptides which could be isolated from skin secretion of R. temporaria were termed temporins and were found to have biological activities, such as antibacterial activity, both each per se and in syner- gistic combinations.

The present invention will now be described by non- limiting examples through the following disclosure. This disclosure is made with reference to the appended drawings, wherein: Fig. 1 shows the nucleotide sequences of 3 clones and inserts present therein and also deduced amino acid sequen- ces; and Fig. 2 shows a diagram on reverse-phase HPLC of skin se- cretion of R. temporaria.

MATERIALS AND METHODS Enzymes and Reagents. Analytical grade chemicals were from Merck, HPLC-grade solvents from Carlo Erba, sequenal- grade chemicals from Perkin Elmer. Media for antimicrobial assays were from Difco, agarose (A6013) from Sigma. Restric- tion enzymes and DNA modifying enzymes were from Boehringer Mannheim, deoxyribonucleotides from Pharmacia. DNA sequences were determined with a "Sequenase kit" (version2.0, U.S. Bi- ochemicals) using [a-35S]dATP. Synthetic peptides were pur- chased from TANA laboratories (Huston, USA).

Isolation of RNA and cloning procedure. For these studi- es the skin of two specimens of R.temporaria was used. The isolation of poly(A)-rich RNA by affinity chromatography over oligo(dT)-cellulose and the preparation of the cDNA library were performed according to Richter et al., (1990b).

(Richter, K., Egger, R. & Kreil, G. (1990b) Molecular cloning of a cDNA encoding the bombesin precursor in skin of Bombina variegata, FEBS Lett. 262, 353-355.) A cDNA library comprising about 10,000 clones was scre- ened with a 240 bp fragment obtained by digestion of the esculentin 1 cDNA with HindIII (Simmaco, M., Mignogna, G., Barra, D. & Bossa, F. (1994) Antimicrobial peptides from skin secretion of Rana esculenta. Molecular cloning of cDNA enco- ding esculentin and isolation of new active peptides.

J.Biol.Chem. 269, 11956-11961). This fragments encodes the prepro-region of the esculentin 1 precursor. The probe was labelled by random priming (Boehringer Mannheim). Hybridiza- tion was performed at 55"C for 16 h in 100 mM sodium phospha- te buffer, pH 7,2, containing 850 mM NaCl, 1 mM EDTA, 10x Denhardt's solution, 0,1% SDS and 100 mg/ml yeast tRNA. Fil- ter papers (Whatman 541, 11 cm x 11 cm) were washed twice for 15 min at 500C with SSPE (0.3 M NaCl, 20 mM sodium phospha- te, pH 7,4, 2 mM EDTA), 0.2% SDS. Positive clones were selec- ted and analysed by cleavage with restriction enzymes and nucleotide sequencing.

Northern blot analysis. Poly(A)-rich RNA (5 mg) was fractionated by electrophoresis in 1.2% agarose gels contai- ning 0.8 M formaldehyde (Arrand, J.E. (1985) Preparation of nucleic acid probes, in Nucleic acid hybridization: a practi- cal approach (Hames, B.D. & Higgins, S.J., eds) pp 17-45, IRL Press, Oxford) and blotted directly onto Nytran sheets (Schleicher & Schuell). The insert of clone Rt-17 was labeled by random priming and used for probing the Northern blot.

Filters were washed at 550C in 0.1 x SSPE, 0.1% SDS, and then used for autoradiography.

Collection and purification of skin secretions. Three specimens of R.temporaria (30-35 g each) were captured near Salzburg (Austria). They were maintained in a terrarium in our laboratory for 1 year and feed larvae of Tenebrio moli- tor. Skin secretions were collected at intervals of three weeks hy a mild electrical shock (12 V, feet to head). The secretion was collected from the surface of a single frog by washing its dorsal region with 10 ml 0.05% (by vol.) acetic acid. The secretions of the three frogs were combined and ly- ophilized. Suitable aliquots were fractionated by HPLC on a Beckman model 332 system using a reverse-phase column (Aquapore RP-300, 7 mm x 250 mm. Applied Biosystems) eluted with a gradient of 10-70% acetonitrile/isopropanol (4:1) in 0.2% (by vol.) trifluoroacetic acid, at a flow rate of 1.8 ml/min. Elution of the peptides was monitored on a Beckman 165 spectrophotometer at 220 nm. Peak fractions were collec- ted and lyophilized. A small aliquot of each peak was subjec- ted to N-terminal analysis following derivatization with dan- syl chloride and reverse phase HPLC separation (Simmaco, M., De Biase, D., Barra, D. & Bossa, F. (1990b) Automated amino acid analysis and determination of amidated residues using pre-column derivatization with dansyl-chloride and reverse- phase high performance liquid chromatography, J. Chromatogr.

504, 129-138). Further purification of peptides was achieved using a macroporous C18 column (4.6 mm x 150 mm, Supelco) de- veloped with an appropriately modified gradient of tne same

solvent system as described above.

Structural analysis. Amino acid analyses were performed with a Beckman System Gold analyzer, equipped with an ion- exchange column and ninhydrin derivatization, after vapor phase hydrolysis of the peptides (1-2 nmol) in 6 N HCl for 24 h. Peptide sequences were determined by automated Edman de- gradation with a Perkin-Elmer model AB476A sequencer. In some cases, information on the amidation state of the C-terminus was confirmed by mass spectral analysis and/or carboxypepti- dase Y digestion (Simmaco, M., De Biase, D., Barra, D. & Bos- sa, F. (1990b) Automated amino acid analysis and determina- tion of amidated residues using pre-column derivatization with dansyl-chloride and reverse-phase high performance liquid chromatography, J. Chromatogr. 504, 129-138).

Antimicrobial assay. The antibacterial activity was tes- ted against Bacillus megaterium BMll, Staphylococcus aureus Cowahl, Streptococcus pyogenes b hemolytic group A, Pseudomo- nas aeruginosa ATCC 15692, Escherichia coli D21, E.coli D21e7, E.coli D21fl, E.coli D21f2 and E.coli D22, using an inhibition zone assay on LB broth/1% agarose plates seeded with 2x105 viable bacteria (Hultmark, D., Engstrdm, Å., An- dersson, K., Steiner, H., Bennich, H. & Boman, H.G. (1983) Insect immunity. Attacin, a family of antibacterial proteins from Hyulophora cecropin, EMBO J. 2, 571-576). Fresh cultures of Candida albicans ATCC 10261 were inoculated in WB broth, pH 6.5, and grown at 370C to approximately 0.6 OD600. Before plating, cultures were diluted 300 fold and then incubated overnight at 370C in the presence of the test peptide, the concentration of which was established by amino acid analy- sis. Inhibition zones were measured and the lethal concentra- tion (LC, the lowest concentration that inhibits the growth) was calculated from the diameter of the zones obtained in se- rial dilutions of the test substance by using the formula gi- ven in Hultmark, D., Engstrom, Å., Andersson, K., Steiner, H., Bennich, H. & Boman, H.G. (1983) Insect immunity. Atta- cin, a family of antibacterial proteins from Hyulophora ce-

cropin, EMBO J. 2, 571-576). Values are expressed as the mean of at least 5 experiments with a divergence of not more than one dilution step.

Circular dichroism measurements. CD measurements were carried out on a Jasco J710 spectropolarimeter, equipped with a DP 520 processor, at 200C, using a quartz cell of 2 mm pat- hlength. CD spectra were the average of a series of 3 scans.

Ellipticity is reported as the mean molar residue ellipticity (q), expressed in deg cm2dmol1. Peptide concentrations were determined by amino acid analysis.

RESULTS Analysis of cDNA clones encoding the precursors. A 240 bp HindIII fragment encoding the signal peptide and the pro- part of the esculentin 1 precursor was used as a probe to screen the cDNA library prepared from skin of R.temporaria.

Six positive clones were detected. The sequences of the in- serts present in clones Rt-5, Rt-6 and Rt-17 are shown in Fig. 1. Excluding the poly(A) tail, these cDNAs comprise 323, 356 and 329 nucleotides, respectively. After the first met- hionine codon, they contain open reading frames which can be translated into polypeptides containing 58 (Rt-6) or 61 amino acids (Rt-5 and Rt-17). The deduced sequences all have the typical features of peptide precursors. They start with a signal peptide containing a cluster of hydrophobic residues.

The cleavage site for signal peptidase is most likely located after the cysteine residue at position 22 (von Heine, G.

(1983) Patterns of amino acids near signal-sequence cleavage sites, Eur. J. Biochem. 133, 17-21). The sequences of the pu- tative mature peptides are preceded by a Lys-Arg, a typical processing site for prohormone convertases. All these precur- sors polyptpeides terminate with the sequence Gly-Lys. Hyd- rolysis by carboxypeptidase E would expose a C-terminal glycine which is required for the formation of COOH-terminal amides. The predicted end products would be amidated peptides containing 13 amino acids for clones Rt-5 and Rt-17, while

Rt-6 has a 9 bp deletion in this region, thus codes only for a decapeptide.

Northern blot analysis. In poly(A)-rich RNA from skin of R.temporaria, the probe derived from clone Rt-17 recognized an abundant message, detected as a single, rather broad band in the range of 400-500 nucleotides. Under the same condi- tions, no signal could be obtained from the skin of other amphibian species such as R.esculenta, Xenopus laevis and Bu- fo viridis.

Isolation and analysis of peptides from skin secretion.

After electrical stimulation of 3 specimens of R.temporaria, about 20 mg of lyophilized material could be obtained. After a preliminary HPLC purification (Fig. 2), each fraction was subjected to N-terminal analysis, in order to identify those with amino-terminal Leu or Phe as predicted from the cDNA sequences. The relevant fractions were further purified by HPLC and subjected to amino acid and sequence analysis. Fol- lowing this approach, the three predicted peptides were found to be indeed present in the secretion. Other molecules, structurally related to these peptides, were also isolated.

The sequences of these peptides, which are termed temporins, are shown in Table 1. In this Table the amount of each pepti- de recovered from the secretion is also included. Along the HPLC profile reported in Fig. 2, the elution position of the various peptides is indicated. The structure of temporin E, with Val at its N-terminus, and which coeluted in part with temporin D, is also shown in the Table. Temporins are all amidated at their C-terminus, as predicted from the structure of the precursors (see above), and contain a prevalence of hydrophobic amino acids. Each of these peptides contains 13 residues, with the exception of temporins H and K, which are 10 residue long. Except for temporins C, D, and E, all of these peptides have at least one basic residue (either Lys or Arg). In the course of this analysis, a 22-residue peptide was also found in the skin secretion (see Table 1). Its sequence shows some similarity with that of melittin, a hemo-

lytic peptide from bee venom (Habermann, E. (1972) Bee and wasp venoms, Science 251, 1481-1485). It was thus named me- littin-like peptide (MLP).

Assays for biological activity. The antimicrobial acti- vity of the purified temporins was first tested against B.megaterium and E.coli D21. Temporins A, B, F, G and L were active on both bacterial strains, whereas temporins C, D, E, H and K only showed some activity against B.megaterium, the most sensitive bacterium.

The recovery of some of the temporins was too low to al- low a detailed characterization of their biological properti- es. To confirm the structure and in order to obtain more ma- terial temporins A, B, D and H were chemically synthesized.

The antimicrobial activity of synthetic temporins A and B, expressed as lethal concentration values, is reported in Tab- le 2, together with the results obtained on red blood cell lysis. As references are included esulentin 1 from R. escu- lenta (Simmaco, M., Mignogna, G., Barra, D. & Bossa, F.

(1994) Antimicrobial peptides from skin secretion of Rana esculenta. Molecular cloning of cDNA encoding esculentin and isolation of new active peptides, J.Biol.Chem. 269, 11956- 11961), cecropin from insect hemolymph (Steiner, H., Hult- mark, D., Engström, A, Bennich, H. & Boman, H.G. (1981) Sequence and specificity of two antibacterial proteins invol- ved in insect immunity, Nature 292, 246-248) and melittin from honeybee venom (Habermann, E. (1972) Bee and wasp ve- noms, Science 251, 1481-1485).

Synthetic temporins A and B showed the same activities as their natural counterparts while temporins D and H were found to be without any biological activity of their own or as enhancers of other Rana peptides. Temporin A is about three times more active than temporin B against S. aureus and S. pyrogenes. On the other hand, these two temporins were po- orly active against E. coli D21 and completely inactive against P. aeruginosa. This indicates that temporins A and B act specifically against gram-positive bacteria.

Linear sulfur free antibacterial peptides like cecropins are inactive against fungi while the defensins (with three S- S bridges) show antifungal activity. Temporins A and B are active against C. albicans. and their potency is of the same order as reported for dermaseptin from the South American frog Phyllomedusa Sauvagei (Mor, A., Hani, K. & Nicolas, P.

(1994) The vertebrate peptide antibiotics dermaseptins have overlapping structural features but target specific microor- ganisms, J.Biol.Chem. 269, 31635-61641) The antibacterial activity of temporins A and B was also tested against three strains of E.coli D21, D21e7, D21fl and D21f2, with consecutive mutations deleting increasing amounts of the side chain in LPS (Boman, H.G. & Monner, D.A. (1975) Characterization of lipopolysaccharides from Escherichia coli K12 mutants, J. Bacteriol. 121, 455-464). Strain D22 has a permeable outer membrane due to a mutation in the envA gene (Normark, S., Boman, H.G. & Matsson E. (1969), Mutant of Escherichia coli with anomalous cell division and ability to decrease episomally and chromosomally mediated resistance to ampicillin and several antibiotics. J.Bacteriol. 97, 1334- 1342). The activities of the temporins were tested in the ab- sence or in the presence of the basal medium E (Vogel, H.J. & Bonner, D.M. (1956) Acetylornithinase of Escherichia coli: partial purification and some properties, J.Biol.Chem. 218, 97-106).

The results in Table 3 show medium E was found to incre- ase the activity of tempors in all strains tested. However no similar effects were seen with gram positive bacteria. CD spectra showed that the increase in activity was correlated to an increased helix formation as found before for FALL-39 (Ageberth, G., Gunne, H., Odeberg, J., Kogner, P., Boman, H.G. & Gudmundsson, G.H. (1995) FALL-39, a putative human peptide antibiotic, is cysteine-free and expressed in bone marrow and testis, Proc. Natl. Acad. Sci. USA 92, 195-199).

Within the term "functional derivatives" used herein are included the peptides with free carboxyl groups and also acid addition salts. Therefore the invention is not restricted to the specific peptides disclosed.

TABLE 1 Sequences of Rana temporaria skin peptides and relative amo- unt in the secretion. Peptides for which the structure of the corresponding precursor has been predicted from cDNAs are marked with the asterisk. a indicates an amidated COOH- terminus. MLP, melittin-like peptide. Identical residues are boldfaced. Gaps (-) were inserted to maximize identities.

Peptide Sequence Yield nmol/mg Temporin A FLPLIGRVLSGILa 14.5 Temporin B* LLPIVGNLLKSLLa 19.4 Temporin C LLPILGNLLNGLLa 37.5 Temporin D LLPIVGNLLNSLLa 1.1 Temporin E VLPIIGNLLNSLLa 1.2 Temporin F FLPLIGKVLSGILa 13.5 Temporin G* FFPVIGRILNGILa 16.8 Temporin H* LSP --NLLKSLLa 8.7 Temporin K LLP---NLLKSLLa 9.8 Temporin L FVQWFSKFLGRILa 3.6 MLP FIGSALKVLAGVLPSVISWVK---Qa 5. 1 Melittin GIGAVLKVLTTGLPALISWIKRKRQQa

TABLE 2 Antimicrobial and lytic activity of Rana temporaria peptides. Lethal concentrations<BR> were calculated from inhibition zones on agarose plates seeded with the respective organisms.<BR> <P>The data for cecropin are from Hultmark et al. (1983). S. Pyogenes hem. group A and<BR> Ps.aeruginosa ATCC15692 are clinical isolates kindly provided by Dr. Paolo Visca, Institute of<BR> Microbiology, University of Rome La Sapienza. NT, not tested.<BR> <P>Organism and strain Lethal concentration of<BR> Temporin A Temporin B Esculentin 1 Cecropin A MLP Melittin<BR> µM<BR> B.megaterium BmII 1.2 2.8 0.1 0.5 NT 0.6<BR> S.aureus Cowanl 2.3 6.0 0.4 >200 NT 0.2<BR> Y.pseudotubercolosis 7.0 7.0 NT 0.5 NT NT<BR> S.pyrogenes 2.0 7.0 NT NT NT NT<BR> hem.group A<BR> E.coli D21 11.9 21.0 0.2 0.3 NT 0.8<BR> Ps. aeruginosa >360 >360 0.7 NT NT NT<BR> ATCC15692<BR> C.albicans 3.4 4.0 0.5 NT NT NT<BR> Human red cells >120 >120 >200 >400 0.5 0.9 TABLE 3. Antibacterial activity of temeporins A and B against E.coli D21 and related LPS modified strains. Assays were per- formed in LB broth/1% agarose, in the absence or in the presen- ce of medium E (Vogel & Bonner 1956). Bacterial strains were kindly provided by Prof.H.G.Boman, University of Stockholm Lethal concentration for Compound D21 D21e7 D21f1 D21f2 D22 µM Temporin A 11.9 1.4 0.9 4.8 3.4 Temporin A + medium E 5.3 1.4 3.0 2.0 0.4 Temporin B 21.0 13.2 10.0 3.3 11.2 Temporin B + medium E 3.4 4.2 3.5 9.3 12.2

SEQUENCE LIST Clone Rt-5 1 ACAATTCTGAGCCAACTGAACCACCCGAGCCCAAAGATGTTCACCTTGAAGAAATCCCTG M F T L K KS L 61 TTACTCCTCTTTTTCCTTGGGACCATCAACTTATCTCTCTGTGAGGAAGAGAGAAATGCA L L L F F L G T I N L S L C E E E R N A 121 GAAGAAGAAAGAAGAGATGAACCAGATGAAAGGGATGTTCAAGTGGAAAAACGACTTTTA E E E R R D E P D E R D V Q V E K R L L 181 CCAATTGTTGGAAACCTGCTCAAGAGCTTGTTGGGAAAATAACCAAAAATGTTAAGAATG P IV ON L L KS L L OK + 241 GAATTGGAAATCATCTGATGTGGAATATCATTTAGCTAAATGAGCAACAGATGTCTTATT 301 TAAAAAAATAAATATGTTCCATC Clone Rt-6 1 GCTTTGTAGGATAGACCTGCACTGAAGTCTTCCAGCCGTCTACATTCTGAGCACCAACTG 61 AACTACCCGAGCCCAAAGATGTTCACCTTGAAGAAATCCCTGTTACTCCTCTTTTTCCTT M F T L K K S L L L L F F L 121 GGGACCATCAACTTATCTCTCTGTGAGGAAGAGAGAAATGCAGAAGAAGAAAGAAGAGAT G T I N L S L C E E E R N A E E E R R D 181 GAACCAGATGAAAGGGATGTTCAAGTGGAAAAACGACTTTCACCAAACCTGCTCAAGAGC E P D E R D V Q V E K R L S P N L L K S 241 TTGTTGGGAAAATAACCAAAAATGTTAAGAATGGAATTGGAAATCATCTGATGTGGAATA L L G K + 301 TCATTTAGCTAAATGCGCAACAGATGTCTTATTTAAAAAATAAATATGTTGCATAC Clone Rt-17 1 CCCCTCCAGCTGTCTACATTCTCATAACCAACTGAACCACCCGAGCCCAAAGATGTTCAC M F T 61 CTTCAAGAAATCCCTCTTACTCCTTTTCTTCCTTGGGACCATCAACTTATCTCTCTGTGA L K K S L L L L F F L G T I N L S L C E 121 GGAAGAGAGAGATGCCGATGAAGAAAGAAGAGATGATCTCGAAGAAAGGGATGTTGAAGT ES RD AD S ERR D DL ES RD VS V 181 GGAAAAGCGATTTTTTCCAGTGATTGGAAGGATACTCAATGGTATTTTGGGAAAATAACC E K R F F P V I G R I L N G I L G K + 241 AAAAAAAGTTAAAACTTTGGAAATGGAATTGGAAATCATCTAATGTGGAATGTCATTTAG 301 CTAAATGCACATCAAATGTCTTATAAAAA