SAME AND METHODS UTILIZING THE SAME

FIELD OF THE INVENTION

[0001] The present invention relates generally to stem-loop probes, and more particularly to bioluminescent stem-loop probes, and compositions and method utilizing bioluminescent stem-loop probes.

BACKGROUND

[0002] Stem-loop probes (SLPs) are a class of nucleic acid biosensors. SLPs have become widely used tools in chemical, biological, and medical fields. Specifically, SLPs have been employed in real-time/quantitative polymerase chain reaction (qPCR), single-nucleotide polymorphism (SNP) and genetic variation screening, in vitro and in vivo detection of DNA and RNA, and small molecule and protein detection. A SLP is typically assembled as a single-stranded, self-complementary oligonucleotide that includes a 15-30 nt region complementary to the target sequence (loop) flanked by two short, self-complementary 5-7 nt stem regions. Exemplary SLPs are disclosed in U.S. Patent Nos. 5,925,517 and 6,103,476, and U.S. Patent Publication No. 2010/0248385. The two stem regions are conjugated to a fluorescent reporter molecule and a quencher, respectively. The SLP switches from a closed (intramolecular hybridization) conformation to an open (intermolecular hybridization) conformation upon formation of a duplex between the target and the corresponding sequence in the loop region. When in the closed conformation, the reporter signal is quenched by direct or resonance energy transfer. During analysis, stimulating radiation is applied such that, when the SLP is in the open conformation a signal emitted from the fluorescent reporter may be detected. [0003] The SLP design offers superior specificity over linear probes and eliminates the need to remove excess/unhybridized probes prior to measurement.

SLPs afford broad utility because of their adaptability for a wide variety of structural modifications. However, the functionality of fluorescent SLPs is still limited by a number of deficiencies. Thus, there is significant room for improvement to make SLPs an even more versatile and valuable tool in clinical and biomedical investigations.

SUMMARY OF THE INVENTION

[0004] A bioluminescent stem-loop probe (BSLP) that includes a hairpin-loop sequence comprising a sequence complementary to a biological target sequence; a bioluminescent marker coupled to the hairpin-loop sequence; and a quencher coupled to the hairpin-loop sequence is disclosed. The hairpin-loop sequence can be between the bioluminescent marker and the quencher and the bioluminescent stem-loop probe can be capable of switching between a closed configuration and an open configuration. The quencher can reduce a bioluminescent output of said bioluminescent marker when said probe is in the closed configuration. Any of the BSLPs disclosed herein, can also include an affinity handle between the quencher and the hairpin-loop sequence.

[0005] In any of the BSLPs disclosed herein, the hairpin-loop sequence can comprise an aptamer. In any of the BSLPs disclosed herein, the hairpin-loop sequence can comprise an aptamer selected from the group consisting of a DNA aptamer, an RNA aptamer, a peptide aptamer and a combination thereof.

[0006] Any of the BSLPs disclosed herein can also include a first stem sequence and a complementary second stem sequence, wherein the first stem sequence is between the hairpin-loop sequence and the bioluminescent marker, and the second stem sequence is between the hairpin-loop sequence and the quencher. In any of the BSLPs disclosed herein, the first and second stem sequences can form a double- stranded stem that will open when the hairpin-loop sequence hybridizes with a complementary target sequence.

[0007] In any of the BSLPs disclosed herein, the bioluminescent marker can include a bioluminescent protein, a truncated bioluminescent protein, a bioluminescent enzyme, a truncated bioluminescent enzyme, or a combination thereof. In any of the BSLPs disclosed herein, the bioluminescent marker can include a luciferase, a truncated luciferase, a bioluminescent protein, a truncated bioluminescent protein, or combinations thereof. In any of the BSLPs disclosed herein, the bioluminescent marker can include a luciferase selected from the group consisting of Renilla luciferase (RLuc), Gaussia luciferase (GLuc), Photonus pyralis luciferase (FLuc), Vargula luciferase (VLuc), truncated variants thereof, and combinations thereof.

[0008] As used herein, "truncated" has its standard meaning in the art. For example, a truncated variants of a bioluminescent proteins or luciferases can include 50-90% of the native bioluminescent protein or luciferase, respectively. Truncated bioluminescent markers can be made using any technique known to those skilled in the art, so long as the truncated variant can still participate in the relevant bioluminescent reaction.

[0009] Any of the BSLPs disclosed herein, can also include a linker coupled to the hairpin-loop sequence and the quencher, where the linker is between the hairpin- loop sequence and the quencher. In any of the BSLPs disclosed herein, the quencher can reduce a bioluminescent output of the bioluminescent marker by energy transfer, active-site inhibition, or both. In any of the BSLPs disclosed herein, the quencher can include an active-site inhibitor formed from a compound selected from the following:

[0010] Bioluminescent stem-loop probes that include a bioluminescent marker, and at least two hairpin-loop constructs coupled to the bioluminescent marker are also described. The bioluminescent stem-loop probe can include at least three of the hairpin-loop constructs.

[0011] Like all the BSLPs described herein, each of the hairpin-loop constructs can include a hairpin-loop sequence comprising a sequence complementary to a biological target sequence, and a quencher coupled to the hairpin-loop sequence. The hairpin-loop sequence can be between the bioluminescent marker and the quencher, and the hairpin-loop construct can be being capable of switching between a closed position and an open position.

[0012] The BSLPs that include multiple-hairpin-loop constructs can have all of the same features of other BSLPs described herein. For example, the BSLPs that include multiple-hairpin-loop constructs can include any specific bioluminescent markers, stems, hairpin-loops, linkers, affinity tags, quenchers, and combinations thereof that are described herein. Each of the hairpin-loop constructs coupled to the bioluminescent marker can be the same or different.

[0013] Also described is a bioluminescent composition that includes a carrier liquid, and a bioluminescent stem-loop probe selected from any of the bioluminescent stem-loop probes described herein.

[0014] Any of the bioluminescent compositions described herein can also include a bioluminescent facilitator complementary to the bioluminescent marker. Any of the bioluminescent compositions described herein can include a bioluminescent facilitator selected from the group consisting of a bioluminescent substrate, a molecular oxygen source, adenosine triphosphate (ATP), a cation, and combinations thereof. In any of the bioluminescent compositions described herein, the bioluminescent marker can be a luciferase and the bioluminescent facilitator comprises a luciferin.

[0015] An analytical method that includes mixing any of the bioluminescent compositions described herein with a target composition, and detecting

bioluminescence from the mixture is also described. Any of the analytical methods described herein can be performed with no stimulating radiation introduced during the detecting phase. In any of the analytical methods described herein, a bioluminescent facilitator can be introduced to the mixture prior to detecting phase.

[0016] In any of the analytical methods described herein, the target composition can include biological material. In any of the analytical methods described herein, the target composition can include biological material selected from the group consisting of DNA, DNA fragments, RNA, RNA fragments, proteins, protein fragments, naturally- occurring molecules, and mixtures thereof.

[0017] As used herein, "fragment" has its standard meaning n the art. For example, a fragments of DNA, RNA or proteins can include 5-100 base pairs in their native arrangement.

[0018] These and other features, objects and advantages of the present invention will become more apparent to one skilled in the art from the following description and claims when read in light of the accompanying drawings.

BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Fig. 1 is a schematic of a bioluminescent probe as described herein in a closed configuration.

[0020] Fig. 2 is a schematic of the bioluminescent probe from Fig. 1 (without the affinity handle) in an open configuration.

[0021] Fig. 3 is a schematic of a bioluminescent probe as described herein employing a linker between the stem sequence and the quencher. [0022] Fig. 4 is a schematic showing a bioluminescent probe as described herein that includes multiple hairpin-loop constructs in both the closed configuration (left) and the open configuration (right).

[0023] Fig. 5 is a synthetic scheme for the conjugation of Rluc to a stem-loop probe.

[0024] Fig. 6 is a picture of SDS-PAGE results of BSLP conjugation.

[0025] Fig. 7(A) is a graph of baseline-subtracted fluorescent emission of various amounts of SLP in the presence of 10 pmol of a target, while 7(B) in the background normalized signal-to-noise (S/N) response of varying amounts of SLP in the presence of 10 pmol of a target.

[0026] Fig. 8 is a graph showing a S/N comparison between a bioluminescent SLP and a fluorescent SLP.

[0027] Fig. 9 is a graph showing a calibration performed to determine optimal conditions for a bioluminescent SLP and a fluorescent SLP.

[0028] Fig. 10 is a graph showing the relative bioluminescence for a

bioluminescent stem-loop probe exposed to serum samples from patients with varying stages of breast cancer.

[0029] Fig. 11 is a graph showing specificity of a bioluminescent probe to distinguish between perfectly matched target sequences and targets that were mismatched to varying degrees.

[0030] Fig. 12 is a graph showing an emission scan comparison for Rluc and Glue using a spectrofluorometer.

[0031] Fig. 13 is a picture of Glue purified by IMAC. [0032] Fig. 14 is a graph showing the decay kinetics, i.e., relative luminescence versus time, for Glue and Rluc.

[0033] Fig. 15 is a graph showing the relative bioluminescence of Glue during PCR cycling.

[0034] Fig. 16 is a schematic showing a synthetic scheme for the chemical conjugation of a linker-active-site inhibitor complex attached to a SLP.

DETAILED DESCRIPTION

[0035] Bioluminescent SLPs, compositions containing bioluminescent SLPs and methods employing bioluminescent SLPs are described. It has been discovered that employing a bioluminescent marker in a SLP design provides for low background noise, signal amplification by enzymatic light generation, and highly efficient quenching, which provides a sensing tool with superior sensitivity, selectivity, and applicability. This can be further enhanced through the use of active-site inhibitor as quenchers, rather than the conventional energy transfer-based molecules.

[0036] As shown in Figs. 1 and 2, the bioluminescent SLPs can include a hairpin- loop sequence comprising a sequence complementary to a biological target sequence. A bioluminescent marker can be coupled to the hairpin-loop sequence and a quencher can be coupled to the hairpin-loop sequence. The bioluminescent marker and the quencher can be coupled to opposite ends of the hairpin-loop sequence, such that the hairpin-loop sequence is between the bioluminescent marker and the quencher. The quencher can be coupled to the 3' end of the hairpin-loop sequence, while the bioluminescent marker can be coupled to the 5' end of the hairpin-loop sequence or vice versa. The bioluminescent stem-loop probe can be capable of switching between a closed configuration, as shown in Fig. 1 , and an open configuration, as shown in Fig. 2.

[0037] As used herein, "coupled" has its standard meaning and includes where components are directly bonded to one another and where there are intermediate sequences and/or moieties between the coupled components. For example, the second stem sequence can be coupled to a quencher where the second stem sequence is covalently bonded directly to the quencher or where, as in Fig. 3, there is a linker between second stem sequence and the quencher.

[0038] As used herein, "complementary" has its standard meaning and includes where two, separate single strand sequences can hybridize with one another to form a double helix. Examples of the hybridized state of two complementary sequences are shown in Figs. 1 (stem), Fig. 2 (hairpin-loop-to-target) and Fig. 3 (stem).

[0039] The quencher can reduce the bioluminescent output of the bioluminescent marker when the stem-loop probe is in the closed configuration. In other words, when the quencher is proximate the bioluminescent marker, the quencher can interact with the bioluminescent marker to reduce the detectable bioluminescence. It should be noted that where the quencher relies on an energy transfer mechanism, the

bioluminescent marker may emit radiation that is not detectible because the radiation is immediately absorbed by the quencher.

[0040] As used herein, "bioluminescent output" refers to the amount of detectable bioluminescence originating from a bioluminescent source. For example, the quenchers disclosed herein include both energy transfer quenchers and active-site inhibitors (e.g., substrate analogs), including substrate (e.g., bioluminescent pigment) inhibitors. [0041] Energy transfer quenchers absorb bioluminescent energy emitted by the source, whereas active-site or substrate inhibitors actually prevent the bioluminescent reactions from occurring by preventing the interactions between the active-sites (e.g., the active sites of an enzyme, such as luciferase) and the substrates (e.g., luciferin) necessary to produce the bioluminescent reaction.

[0042] The quencher can reduce a bioluminescent output of the bioluminescent marker by energy transfer, active-site inhibition, or both. As used herein, "active site inhibition" and related terms, such as active site quencher, refer to reductions of bioluminescent output that result because the active-site cannot properly interact with the substrate.

[0043] As used herein, "energy transfer inhibition" and related terms, such as energy transfer quencher, refer to reductions in bioluminescent output that result because bioluminescence is absorbed, whether by direct energy transfer, resonance energy transfer, or some other mechanism. Exemplary energy transfer inhibitors include, but are not limited to (i) rhodamine dyes selected from the group consisting of tetramethyl-6-carboxyrhodamine (TAMRA), tetrapropano-6-carboxyrhodamine (ROX), and (ii) DABSYL, DABCYL, cyanine dyes including nitrothiazole blue (NTB), anthraquinone, malachite green, nitrothiazole, and nitroimidazole compounds and the like.

[0044] The quencher can also be an active-site inhibitor formed from active-site substrate analogs, such as the following:

[0045] Quenchers A-H are reacted so that they can be coupled to the stem-loop probe. As a result the actual chemical structure of the quenchers will be slightly different that that shown in the free-standing compounds shown above. Generally, the reaction will occur at an amine of the above compounds.

[0046] As shown in Fig. 3, the bioluminescent stem-loop probe can also include a linker coupled to the hairpin-loop sequence and the quencher. The linker can be between the hairpin-loop sequence and the quencher. The hairpin-loop sequence and quencher can be coupled to opposite ends of the linker. In some bioluminescent SLPs, the linker can be located between the second stem sequence and the quencher.

[0047] As used herein, a "linker" is any sequence that allows the quencher additional mobility when the bioluminescent stem-loop probe is in the closed

configuration. In particular, a linker may be of sufficient length to (i) enable the quencher to interact with an active site and/or substrate that is not immediately adjacent to the closed stem, and (ii) allow the bioluminescent stem-loop probe to close when the hairpin-loop sequence is hot hybridized with the target sequence.

[0048] The bioluminescent stem-loop probe can include more than one quencher per stem-loop complex. In such probes, a dendrimer linkage - for example, a dendrimer phosphoramidite - can be used to couple the hairpin-loop sequence to multiple quenchers.

[0049] The hairpin-loop sequence can comprise an aptamer. The aptamer can be selected from a DNA aptamer, a RNA aptamer, a peptide aptamer and combinations thereof. The aptamer can be selected to be complementary to a target sequence, such as a DNA sequence, an RNA sequence, a peptide sequence and combinations thereof. It is to be understood that "DNA sequence" is intended to be broadly construed to include less commonly studied DNA sequences that include, but are not limited to, DNA binding domains.

[0050] The bioluminescent stem-loop probe can also include a first stem sequence and a complementary second stem sequence. As shown in Figs. 1 & 2, the first stem sequence can be between the hairpin-loop sequence and the bioluminescent marker, and the second stem sequence can be between the hairpin-loop sequence and the quencher. The hairpin-loop and bioluminescent marker can be coupled at opposite ends of the first stem sequence and the hairpin-loop and quencher can be coupled at opposite ends of the second stem sequence. When hybridized, the first and second stem sequences can form at least 3 G-C base pairs, at least 4 G-C base pairs, at least 5 G-C base pairs, or at least 6 G-C base pairs. Alternately, when hybridized, the first and second stem sequences can form a G-C analog.

[0051] The first and second stem sequences should be selected such that, under analytical conditions, the bioluminescent stem-loop probe will remain in a closed configuration until the hairpin-loop sequence hybridizes with the target sequence.

Conversely, the first and second stem sequences will form a double-stranded stem, but will open when the hairpin-loop sequence hybridizes with a complementary target sequence.

[0052] The bioluminescent marker can include a bioluminescent protein, a truncated bioluminescent protein, a bioluminescent enzyme, a truncated bioluminescent enzyme, or a combination thereof. The bioluminescent marker can include a luciferase, a truncated luciferase, or a combination thereof. The bioluminescent marker can include a luciferase selected from the group consisting of Renilla luciferase (RLuc), Gaussia luciferase (GLuc), Photonus pyralis luciferase (FLuc), Vargula luciferase (VLuc), truncated variants thereof, and combinations thereof.

[0053] Exemplary bioluminescent substrates {i.e., bioluminescent pigments) include, but are not limited to, coelenterazine, coelentrazine variants (e, f, fcp, h, hep, etc.), Vargulin, (4S)-2-(6-hydroxy-1 ,3-benzothiazol-2-yl)-4,5-dihydrothiazole-4-carboxylic acid ("firefly luciferin"), and (£)-2-methyl-4-(2,6,6-trimethyl-1-cyclohex-1-yl)-1-buten-1- ol formate ( af/a luciferin"). The bioluminescent enzyme and/or bioluminescent protein can catalyze the bioluminescent reaction of the substrate. For example, the bioluminescent enzyme can catalyze the reaction of coelenterazine into its two main metabolites coelenteramide and coelenteramine. [0054] The bioluminescent marker can include a bioluminescent protein selected from the group consisting of aequorin, obelin, mitrocomin, clytin, and truncated variants of these proteins. As will be understood, the bioluminescent proteins or truncated bioluminescent proteins can include a bioluminescent enzyme, a bioluminescent substrate, or both.

[0055] The bioluminescent stem-loop probe can also include an affinity handle between the quencher and the hairpin-loop sequence. For example, one end of the affinity handle can be coupled to or proximate an end of the quencher or the hairpin- loop, while the opposite end of the affinity handle can be free (e.g., as shown in Fig. 1). A biotin-modified thymidine, such as that shown in Fig. 1 , can be used as an exemplary affinity handle. After synthesis of the bioluminescent SLPs, the affinity handle can be used for isolating the bioluminescent SLPs from unreacted bioluminescent enzymes and/or bioluminescent proteins. For example, the bioluminescent stem-loop probe can be isolated using affinity chromatography.

[0056] As shown in Fig. 4, the bioluminescent stem-loop probe can include multiple hairpin-loop constructs. In an exemplary bioluminescent probe, at least two hairpin-loop constructs can be coupled to the bioluminescent marker. Each of the hairpin-loop constructs can include (i) a hairpin-loop sequence comprising a sequence complementary to a biological target sequence, and (ii) a quencher coupled to the hairpin-loop sequence, where the hairpin-loop sequence is between the bioluminescent marker and the quencher. As with the other hairpin-loop probes described herein, each of the hairpin-loop constructs can be capable of switching between a closed position and an open position. Furthermore, any and all bioluminescent stem-loop probe configurations described herein can be incorporated into bioluminescent probes that include multiple hairpin-loop constructs.

[0057] For each bioluminescent marker, the bioluminescent stem-loop probe can include at least three of the hairpin-loop constructs, at least four hairpin-loop constructs, at least five hairpin-loop constructs, or at least six hairpin-loop constructs.

[0058] Because the bioluminescent markers include a number of active-sites and/or substrates distributed in various locations, it can be beneficial to have multiple quenchers per bioluminescent stem-loop probe. In addition, it can be beneficial to have a linker coupled between the hairpin-loop sequence and the quencher that provides the quencher mobility to reach the active-sites and/or substrates when the stem-loop construct is in the closed configuration. Another useful approach, is to include a dendrimer linkage - for example, dendrimer phosphoramidite - to couple the hairpin- loop sequence to multiple quenchers. The dendrimer linkage can be coupled to the quenchers directly or by way of individual linkers.

[0059] The quenchers can be any of the energy inhibitors or active-site inhibitors described herein, including any of the following active-site inhibitors:

[0060] A bioluminescent composition comprising a carrier liquid and one or more of the BSLPs described herein is also described. The bioluminescent composition can include at least two different bioluminescent stem-loop probes, at least three different bioluminescent stem-loop probes, at least four different bioluminescent stem-loop probes, or at least five different bioluminescent stem-loop probes. For example, the first bioluminescent stem-loop probe can include a first bioluminescent marker and a first hairpin-loop sequence and the second bioluminescent probe can include a different bioluminescent marker and a different hairpin-loop sequence. Each additional

"different" bioluminescent stem-loop probe can have a bioluminescent marker and hairpin-loop sequence that is different from the other bioluminescent stem-loop probes in the bioluminescent composition. The bioluminescent composition can also include fluorescent stem-loop probes and other image enhancement compounds.

[0061] The composition can also include a bioluminescent facilitator

complementary to the bioluminescent marker. Exemplary bioluminescent facilitators include, but are not limited to a substrate, e.g., luciferin, a molecular oxygen source, adenosine triphosphate (ATP), and a cation, e.g., divalent cations, Ca ²⁺ and Mg ²⁺ . More than one bioluminescent facilitator may be included in the composition to facilitate bioluminescence.

[0062] The bioluminescent facilitator can be a bioluminescent substrate, e.g., a luciferin or coelenterazine. The bioluminescent stem-loop probe in the composition can include a bioluminescent marker comprising a luciferase and the bioluminescent facilitator can include a luciferin and/or molecular oxygen.

[0063] An average ratio of hairpin-loop constructs-to-bioluminescent markers in the composition can be at least 2:1 , at least 3:1 , at least 4:1 , at least 5:1, at least 6:1 , or at least 10:1. Following affinity separation of the bioluminescent stem-loop probe, the average ratio of hairpin-loop constructs-to-bioluminescent markers can be calculated using a Bradford protein assay and the molecular extinction coefficient of the quencher.

[0064] An analytical method utilizing any of the bioluminescent stem-loop probes and/or bioluminescent compositions described herein is also described. Exemplary analytical methods include, but are not limited to, in vitro, in vivo, and in situ imaging of DNA/RNA in cells, SNP screening and genetic analysis, monitoring of real-time PCR, and the detection of proteins and small molecules. [0065] The analytical method can include mixing a bioluminescent composition as described herein with a target composition, and then detecting bioluminescence from the mixture. The method can include detecting bioluminescence and/or fluorescence from each of the different bioluminescent probes (and fluorescent probes, when applicable) present in the mixture sequentially, simultaneously or a combination of both.

[0066] The method can include introducing a bioluminescent facilitator to the mixture prior to detecting. The bioluminescent facilitator can be introduced after the bioluminescent composition has been mixed with the target composition to form the mixture. The bioluminescent facilitator can be introduced after sufficient time has elapsed for the hairpin-loop sequence of the bioluminescent stem-loop probes to hybridize with any target sequences present in the target composition. In some instances, the bioluminescent facilitator can be introduced less than two minutes prior to detection, less than one minute prior to detection, or less than 30 second prior to detection/ or less than 10 seconds prior to detection, or less than 5 seconds prior to detection, or during detection. For example, a bioluminescent substrate can be added to the bioluminescent-target mixture during detection.

[0067] In the method, the mixture can include a bioluminescent facilitator complementary to the bioluminescent marker. The bioluminescent facilitator can be added as part of the bioluminescent composition or added separately.

[0068] The mixing can occur in vitro, in vivo, ex vivo, or in situ. In some embodiments, mixing can include injecting the mixture into a living organism, a petri dish, or a cuvette or similar laboratory container. This can be followed by injecting the bioluminescent facilitator into the mixture prior to or during detection. [0069] The methods described herein can be used for any medical, analytical, environmental, forensic, or diagnostic purpose. However, the methods described herein can also be used for non-invasive, non-therapeutic, diagnostic purposes, i.e., only for data gathering.

[0070] The target composition can include biological material. The target can include biological material selected from the group consisting of DNA, DNA fragments, RNA, RNA fragments, proteins, protein fragments, naturally-occurring molecules, and mixtures thereof.

[0071] The biological target sequence can be a nucleotide or peptide sequence that may be found in the biological, environmental, or food material. For example, the biological target sequence can be a portion of a nucleotide sequence known or believed to be associated with a particular condition (e.g., cancer, heart disease, etc.), associated with a predisposition to a disease state, an environmental contaminant, a food contaminant, etc.

[0072] In the fluorescent stem-loop probes (FSLPs) of the prior art, it is necessary to irradiate the FSLPs in order for them to fluoresce. This need for external irradiation reduces the signal-to-noise ratio and limits the usefulness of FSLPs. Thus, a particular benefit of the bioluminescent stem-loop probes described herein is that no stimulating radiation is necessary to generate the bioluminescence. As used herein, "stimulating radiation" refers to any radiation emitted by an external radiation source in order to stimulate a fluorescent response from an electromagnetic radiation emitting marker, whether the marker is bioluminescent or fluorescent. [0073] The following examples are provided for purposes of illustrating, explaining, and describing embodiments of this invention, and are intended to be non- limiting.

Examples

Background

[0074] These developments relate to bioluminescent stem-loop probes (BSLPs) that provide unprecedented sensitivity and selectivity for in vivo imaging and real-time in situ detection of biomarkers. In the following studies, bioluminescent reporters (as used herein "markers" and "reporters" are used interchangeably) have been shown to exhibit superior sensitivity and low detection limits compared to conventional stem-loop probes (SLPs). It appears that employing a bioluminescent reporter in a SLP design will provide for low background noise, signal amplification by enzymatic light generation, and highly efficient quenching through the use of active-site inhibitors or energy transfer-based molecules. For reasons set forth herein, active-site inhibitors may be preferred. Thus, BSLPs can provide a sensing tool with superior sensitivity, selectivity, and applicability. This is demonstrated by the data generated using a BSLP utilizing Renilla luciferase (Rluc) as the bioluminescent marker and DABCYL as the quencher.

[0075] The BSLPs described in Example 1 have demonstrated excellent sensitivity and a high signal-to-noise ratio, achieving one of the lowest detection limits (0.4 nM) reported so far with SLPs of any kind. Furthermore, the incorporation of a photoprotein as the bioluminescent marker in the BSLP did not impact the stability or ability to undergo conformational change upon hybridization with the target. [0076] Additional strategies for further enhancing the BSLP design include employing a more robust bioluminescent photoprotein. For example, Gaussia luciferase (Glue), which is (i) the smallest coelenterazine-dependent bioluminescent protein (185 aa, 19.9 kDa, -half the size of Rluc), (ii) thermostable up to 90 °C, and (iii) has been shown to yield significantly higher bioluminescence than Rluc. This should improve the sensitivity of the BSLP and make it robust enough for application in qPCR-based detection systems.

[0077] Another strategy is to incorporate a bioluminescent enzyme with high substrate turnover, such as Photinus pyralis "firefly" luciferase (Flue), to provide signal amplification, thus eliminating the need to perform PCR-based target amplification. This should overcome the one-signal per SLP limitation and prove beneficial for the detection of very dilute nucleic acid targets, as well as imaging applications requiring longer exposure times to improve sensitivity.

[0078] Yet another approach for improving the bioluminescent stem-loop probes is to quench the bioluminescent reporter signal using a substrate analog or other active- site inhibitor rather than an energy-transfer based quencher. This should help overcome the problem of inefficient quenching typical of FSLP systems and provide a unique control over the reporter signal as opposed to distance-dependent, energy- transfer systems.

[0079] Coelenterazine-based bioluminescent proteins have been shown to be non-toxic for in vivo applications and are thus aptly suited for live cell imaging

applications. Thus, such probes should be useful for using sBSLPs for in vivo imaging of breast tumors and circulating miRNA. Thus, the embodiments described herein are unique with respect to at least the following features: • The design of BSLPs utilizing high-output, thermostable bioluminescent proteins as reporters.

• The design of BSLPs capable of signal amplification by luminescent substrate turnover.

• The design of BSLPs quenched by substrate analogs or other active-site inhibitors to provide superior control over reporter signal, thereby drastically reducing background noise from inefficient quenching as seen with energy- transfer distance-dependent quenchers.

• Employing these new BSLPs to perform in vivo tumor imaging and quantification of miRNAs.

Example 1 - BLSP Utilizing Rluc as a Bioluminescent Marker [0080] The BSLP was designed with a hairpin-loop sequence complementary to miR-21 = TAGCTTATCAGACTGATGTTGA. miR-21 is a 22 nucleotide (nt) miRNA target implicated as a biomarker in several cancer types. Renilla luciferase (Rluc) was expressed in and purified from Escherichia coli (E. coli) using methods previously established in the published literature. See, e.g., Loening et al., "Consensus Guided Mutagenesis of Renilla Luciferase Yields Enhanced Stability and Light Output," Protein Engineering, Design & Selection: PEDS, Vol. 19(9), Pages 391-400 (September 1 , 2006). The hairpin-loop sequence was synthesized with a 6 bp 83% GC stem on either side:

5'NH ₂ -GGGGGA TCAACATCAGTCTGATAAGCTA [Bio-dT] CCCCC-DABCYL. [0081] In addition, as shown in Fig. 1 , a biotin-modified thymidine was coupled to the hairpin-loop sequence as an affinity handle. Finally, a DABCYL quencher was coupled to the 3' stem (the C-based stem). Such segments can be ordered commercially from a variety of laboratories, including Eurofins MWG Operon. [0082] The coupling of the above-identified hairpin-loop construct to the Rluc proceeded as shown in Fig. 5. The 5' amino modification of the hairpin-loop construct was chemically converted to a benzaldehyde moiety by succinimidyl 4-formylbenzoate (SFB, Pierce - Thermo Fisher Scientific Inc.) in 50 x excess in a 100 mM sodium phosphate, 150 mM sodium chloride, pH 7.2 buffer. Amine residues of purified Rluc were modified with succinimidyl 4-hydrazinonicotinate acetone hydrazone (SANH, Pierce - Thermo Fisher Scientific Inc.) in 10 x excess in a 100 mM sodium phosphate, 150 mM sodium chloride, pH 7.2 buffer. Once a stable amide bond was formed between 4-hydrazinonicotinate and Rluc, the alkyl hydrazone was hydrolyzed by buffer exchanging into a 100 mM sodium citrate, 150 mM sodium chloride, pH 6.0 buffer, which yields the aldehyde-reactive hydrazine moiety. SFB-modified oligonucleotide was added in 1.5 x excess to form a stable hydrazone conjugate (Fig. 5).

[0083] The biotin affinity-handle on the probe stem was used to separate the bioluminescent stem-loop probes from the excess Rluc remaining in solution after conjugation. The thymidine in the stem of the probe was replaced with a biotin-modified thymidine (Bio-dT). This provided a convenient affinity handle for purification without detriment to the structural integrity of the SLP sequence needed for proper stem-loop formation.

[0084] A monomeric avidin-immobilized agarose (Pierce Thermo Scientific) purification column was used for separation. The purification protocol suggested by the manufacturer was followed and elution of the BSLP was performed using D-biotin.

Elution fractions were collected based on the 475 nm absorption of DABCYL. The conjugation of Rluc to the SLP was confirmed using the SDS-PAGE analysis (Fig. 6). Using this chemical synthesis strategy, BSLPs that include more than one stem-loop construct can be formed and isolated.

[0085] SLP Characterization. For direct comparison, a conventional fluorescent stem-loop probe (FSLP) was used in parallel with the Rluc-BSLP in the following experiments. The FSLP was synthesized (Eurofins MWG Operon) with the same sequence as the BSLP, utilizing 6-carboxyfluorescein (6FAM) as the fluorescent reporter (ex. 495 nm, em. 524 nm) and Black Hole Quencher 1 (BHQ1) as the quencher (ex. 534 nm). The FSLP was characterized by fixing the target concentration at a point in the middle of the linear portion of the initial calibration curve and varying the concentration of FSLP used to achieve the best S/N ratio (Fig. 7). The BSLP was also evaluated using the same procedure.

[0086] The optimal concentration for each SLP was chosen by varying the amount of SLP while holding the target concentration constant. An optimal S/N ratio of 1.6 was achieved using 10 pmol of FSLP, whereas 0.5 pmol of BSLP gave an optimal S/N ratio of 9 (Figure 8). In contrast to the BSLP, at 0.5 pmol, the FSLP signal was too weak to be distinguished from background noise. This drastic improvement in signal amplitude achieved with the BSLP appears to be characteristic of bioluminescent reporters because of the absence of external excitation. This increased signal amplitude allows the BSLP to generate a reliable quantitative response even when added at a low concentration.

[0087] Calibration in a buffer matrix. The concentration at which the best S/N ratio was achieved for the BSLP and the FSLP was used for all following assays. A standard white polypropylene 96-well plate was employed to generate a calibration curve. Calibrations were performed using varying amounts of target sequence mixed with 0.5 pmol of BSLP in a 100 mM sodium phosphate, 1 mM EDTA, pH 7.4 buffer and allowed to hybridize at ambient temperature for 3 hr (a sufficient quantitative signal was also demonstrated using 1 hr hybridization time).

[0088] Total-light bioluminescent readings were taken using a PerkinElmer Victor X Light bioluminometer equipped with a syringe auto-injector. The bioluminescent reaction was initiated by injecting 50 μΙ_ of a 2.5 pg/mL dilution of native coelenterazine (NanoLight Technology) prepared in 100 mM sodium phosphate, 1 mM EDTA, pH 7.4 buffer immediately before detection. Total well volume including injected coelenterazine was held at 150 μΙ_. The exceptional sensitivity afforded by the bioluminescent signal was evidenced in the calibrations performed at the optimal SLP concentrations of ~3 nM BSLP and -67 nM FSLP (Fig. 9). By slope comparison, the BSLP signal is 50 times more sensitive than the FSLP signal. Consequently, the BSLP was able to achieve a limit of detection (LOD) of 0.4 nM, whereas the FSLP exhibited a LOD of 10 nM (Fig. 9). This 25 times lower LOD is a significant improvement over conventional FSLPs, as well as many of the advancements made to improve the traditional fluorescence method (Table 1 ).

Table 1. LOO comparison to several FSLP modifications.

SLP Type/M odificati on LOD (nM) Reference

MP OA this study

FSLP 10 this study

LNA 7Λ 11

Graphene Oxide 2 16

P A 1.6 12

Rber Optie 1.1 32

0.5 13

Eli ¹ * Complex 0.S 2»

[0089] Micro-RNA detection in a Human Serum Matrix. A mouse serum spiked with miRNA target miR21 was used to prepare a calibration curve. All serum samples were diluted to 25% initial concentration with 100 mM sodium phosphate, 1 mM EDTA pH 7.4 buffer and boiled for 5 min to remove any nuclease. Once cooled, 50 μΙ_ of the serum was added to each well before the addition of synthetic target and BSLP. The total well volume before coelenterazine injection was held at 100 μΙ_. Serum samples from breast cancer patients were employed in place of synthetic target and the mouse serum in the assay set-up to detect the levels of miR21 in these samples (Fig. 10). The concentrations of miR21 detected in serum samples were validated using a solid-phase miRNA detection method developed in the laboratory.

[0090] A mismatch study was conducted to evaluate the selectivity of the hairpin- loop sequence. The mismatch probes contained the following mutations to the wild- type miR21 sequence:

• single mismatch (SM) - T6A;

• double mismatch (DM) - A12T, G18C;

• triple mismatch (TM) - T5A, A12T, G18C. [0091] A calibration curve shown in Fig. 1 1 was generated using matched and mismatched probes demonstrating the single-nucleotide mismatch specificity of the BSLP probe. In Fig. 11 , a perfect match is indicated by "PM," while SM, DM and TM indicated single, double and triple mismatches, respectively.

Prophetic Example 1 - Incorporate bioluminescent proteins that are thermostable and exhibit higher light output with longer glow half-life into BSLP design

[0092] Incorporation of thermostable, high-output bioluminescent proteins. Stem- loop probes are commonly employed in the quantitative/real-time detection of PCR products. In order to utilize BSLPs in applications where thermal stability is essential, it would be necessary to employ a thermostable bioluminescent protein, such as Gaussia princeps luciferase (Glue). Glue is derived from the mesopelagic (350-1000 m) marine copepod Gaussia princeps.

[0093] Glue is the smallest coelenterazine-dependent bioluminescent protein among the luciferases isolated so far. Glue is a 185 amino acid, 19.9 kDa bioluminescent photoprotein capable of generating light through the enzyme-assisted oxidative decarboxylation of coelenterazine to coeleteramide. This reaction gives off light at approximately 487 nm (Fig. 12). Fig. 12 shows emission scans for Rluc and Glue monitored using Varian Cary Eclipse spectrofluorometer. The Glue emission is red-shifted ~10nm from the Rluc and exhibits almost a 10-fold higher relative luminescent output. The dotted curves correspond to normalized emissions. [0094] Glue contains 10 cysteines, making proper folding in non-native, prokaryotic expression systems extremely difficult due to the lack of chaperones. To overcome this challenge and achieve the benefits of bacterial expression and downstream extraction and purification, the Glue gene was codon-optimized for Escherichia coli and inserted as a synthetic construct containing Nde\ and Xba\ restriction sites at the EcoRV site in the general vector pUC57 (Genscript). It was subsequently cloned using the Nde\ and Xba\ restriction sites into the cold shock expression vector pCold I (Takara Bio, Japan / Clontech, US). The pCold I vector has an N-terminal 6x Histag with Xa cleavage site upstream of the MCS for convenient purification of the recombinant protein by IMAC.

[0095] Glue was expressed by growing E. coli ER2523 cultures transformed with the pCold::Gluc vector to an OD600 of approximately 0.5-0.7, cold shocking in an ice- bath for 1 h, inducing the lac operon with 1 mM IPTG, and expressing at 15 °C/150 rpm for 24 h. The crude Glue was purified using a Νΐ·ΝΤΑ agarose column. The elution fractions were analyzed for bioluminescent activity using a PerkinElmer Victor X Light and visualized by SDS-PAGE (Fig. 13). The activity of Glue was compared with that of Rluc (Figure 1 1 & 13). In Fig. 13, it should be noted that Glue purified by IMAC typically runs at ~25kDa

[0096] The luminescence activity graph of matched concentrations of Glue and Rluc showed that Glue is approximately 10 times more active than Rluc. Furthermore, the bioluminescent half-life of Glue (~1.1 s) is substantially longer than that of Rluc (-0.05 s) (Fig. 14).

[0097] The thermostability of Glue was also verified by exposing Glue to several PCR cycles and monitoring its luminescence activity (Fig. 15). The bioluminescence readings were taken at room temperature. The PCR cycles were as follows, 1 minute at 90°C, 1 minute at 55°C and 1 minute at 65°C.

[0098] It is believed that BSLPs utilizing Glue as the bioluminescent marker can be synthesized following the same protocol synthesis protocol utilized to produce the Rluc-based BSLPs described in Example 1. The same validation studies described herein could be used to validate and calibrate a Gluc-based BSLP. After comparing the performance of Glue BSLP for in vitro miRNA detection, this probe could also be used in a PCR-based detection.

[0099] For PCR-based detection, miR21 could be used as the target miRNA and its serum detection can be performed using RT-PCR method employing Glue BSLP. Standard RT-PCR protocol will be followed by an end-point PCR detection. The target sample will be prepped using a small RNA extraction kit (Ambion). Small RNAs will be modified with a self-annealing hairpin primer. The next preparation will be an RT reaction containing dNTP mix, nuclease-free water, reverse transcriptase, and primer- modified miRNA template. Pulsed RT will be performed using the thermal cycler with conditions of 30 min at 16°C, followed by pulsed RT of 60 cycles at 30°C for 30 s, 42°C for 30 s and 50°C for 1 s. The PCR reaction mix will be incubated at 85°C for ^' 5 min to inactivate the reverse transcriptase. This will be followed by an end-point PCR detection using the Glue SLP. For that, a mixture will be formed from the RT-PCR product with nuclease-free water, PCR buffer, dNTP mix, forward and reverse primer, polymerase, and the Glue SLP. Reactions will be placed in a preheated (94°C) thermal cycler and incubated at 94°C for 2 min, followed by 20-40 cycles of 50°C for 15 s and 60°C for 1 min. Reaction products will be analyzed by measuring the bioluminescence signal using the luminometer. RT PCR and end-point PCR reactions will be also performed using a control RNA. The sensitivity and specificity of the PCR product detection using the Gluc-based BSLP will be evaluated.

[00100] Alternative Approaches. Using bioluminescent proteins such as Glue, which is smaller and more thermostable than Rluc, presents an obvious advantage to the BSLP design. However, there may be challenges associated with the increased bioluminescent activity of Glue. For example, if the quenching system cannot accommodate the higher bioluminescent signal from Glue, there would be an increase in background noise in the closed conformation, which would be detrimental to detection sensitivity. This issue would be particularly pronounced in experiments utilizing longer integration times for signal amplification.

[00101] Exemplary energy transfer-based quenchers that may be useful across the Glue emission spectrum are listed in Table 2.

Table 2. Various energy transfer-based quenchers which could potentially be used with Glue.

Qt*e« *wtf Absorption Maximum (urn)

DPQ-I A 430

0ASCYL 47S

alack Hote Quencher{m ) 495

[00102] SLPs with these different quenchers can be obtained from commercial sources (Molecular Probes) and can be chemically conjugated to SLPs. For example, succinimidyl ester derivatives of these quenchers can be directly conjugated to amine- modified SLPs using well-established conjugation protocols. To further improve quenching efficiency, molecular assemblies of multiple (usually three) quenchers can be attached using a linker with a dendritic modification. The use of multi-quencher dendritic assemblies with FSLPs has shown improved quenching efficiency giving a 20- fold improvement in S/N by statistically improving the likelihood of proper dipole alignment and coupling between the fluorophore and quencher. Exemplary methods of dendritic attachment are previously described by Yang et a/., "Molecular Assembly of Superquenchers in Signaling Molecular Interactions," Journal of American Chemical Society, Vol. 127(37), pages 12772-73 (September 2005). Of course, this same strategy can be applied using substrate analogs or other active-site inhibitors as further described herein.

Prophetic Example 2 - Incorporating Bioluminescent Enzymes with High

Turnovers into the BSLP Construct

[00103] Because only one SLP can be opened per target sequence {e.g., nucleic acid molecule), the signal intensity and sensitivity of a bioluminescent marker is of extreme importance in SLP-based assays. To increase the sensitivity of detection, others have taken an approach of enhancing quenching efficiency. [00104] In contrast, the bioluminescent proteins described herein may have an additional advantage in that their glow-type signal emission can be integrated over longer time periods. This can overcome the limitation of one SLP signal per target molecule. Additionally, incorporation of bioluminescent enzymes such as Flue may further enhance sensitivity, because the enzymatic turnover of the substrate is very high. This is especially important for the detection of dilute compositions of nucleic acid target, such as detection of miRNA, which is significantly down-regulated in certain disease conditions. Thus, BSLPs could eliminate the need for PCR target amplification, which is generally coupled to the SLP for detection of low concentration targets.

[00105] There are two approaches to achieve signal enhancement via SLP turnover that are of particular interest. In the first approach, signal integration can be performed using Gluc-based BSLP. In the second approach, Flue can be incorporated into the BSLP design.

[00106] Bioluminescent proteins that utilize coelenterazine as the substrate emit luminescence based on flash or in glow-type kinetics. As demonstrated in Fig. 14, the half-life of Glue luminescence is 1.1 s, which is significant compared to the 0.05 sec half life of Rluc. Furthermore, the bioluminescence signal generated from the Glue can be integrated for about 3 min (~ 20 % maintenance of activity at 3 min) allowing for signal enhancement. Thus, integration of the signal from the Gluc-based BSLP may provide improved performance for some techniques.

[00107] The other approach would be to use a true bioluminescent enzyme, such as Flue (Flue). Flue and Rluc are both commonly used bioluminescent markers;

however, these proteins differ in their substrate and cofactor requirement, as well as, in their structures. Flue is a 61 kDa protein cloned from beetles (Photinus pyralis), while Rluc is a 39 kDa protein from sea pansies {Renilla reniformis). Flue requires luciferin, ATP, magnesium, and molecular oxygen to produce bioluminescence, while Rluc requires only coelenterazine and molecular oxygen. The bioluminescence light generated by Flue is greenish yellow with an emission maximum around 560 nm, whereas Rluc emits blue light with an emission maximum around 480 nm. Due to these differences Flue and Rluc are often used together in dual-reporter assays. The quantum yield of the Flue bioluminescence reaction is 0.88, which is very high.

Another, major difference between the two enzymes, is that once the substrate of Rluc, coelenterazine, is converted to the product, coelenteramide, it is released from the enzyme pocket much slower compared to the release of the Flue reaction product. A few mutations in Rluc have produced glow-type emission allowing for integration of the bioluminescence signal. The glow-type emission obtained using Flue is much longer and hence it further improves the signal integration capability.

[00108] The Flue can be obtained using conventional techniques and can be conjugated to the SLP using amine chemistry, as described above. For example, Flue has been well characterized and has been cloned and expressed in E. coli (see, e.g., J. de Wet, et al., "Cloning of Firefly Liciferase cDNA and the Expression of Active

Luciferase in Escherichia coli," Proceedings of the National Academy of Sciences of the United States of America, Vol. 82(23), Pages 7870-73 (December 1985)). The purified protein will be evaluated for its bioluminescence activity and other photophysical characteristics such as quantum yield, specific activity, etc.

[00109] In addition, different linker lengths will be evaluated for incorporating Flue in the BSLP design. It will be important to ensure proper closing of the stem part of the probe. SLPs have been linked to solid phases and to QD nanoparticles without hampering the performance of SLPs. This indicates that attaching larger proteins, such as Flue, to the stem of SLPs should not affect its performance.

[00110] Different stem lengths and GC base-pair (or GC analog) content can be used to aid in stem closing. In addition, the use of locked nucleic acid (LNA) in the design of SLPs, employed for solid-phase assays, has been shown to improve stability of the SLPs. Thus, LNA can be incorporated into the design of SLPs conjugated to photoproteins, such as Flue. LNAs are bicyclic high affinity RNA analogs. These nucleotides are synthesized by chemically locking the furanose ring of the sugar phosphate backbone in an N-type conformation, by the introduction of a 2'-0,4'-C methylene bridge. This confers higher structural rigidity to the LNA base pair, thus providing for higher stability to the stem when incorporated in place of DNA bases. Other properties of LNA bases, such as high resistance against degradation and thermostability, have been shown to yield low background signal and efficient target hybridization when used in SLP-based nucleic acid detection assays.

[00111] Alternative Approaches. An alternative approach could be to use truncated bioluminescent enzymes to overcome potential issues with the size of Flue. However, activity of the truncated Flue is significantly lower than full length Flue. Thus, another approach would be to employ truncated Vargula luciferase. Vargula luciferase catalyzes the oxidation of vargulin luciferin in the presence of molecular oxygen, emitting bright blue light. Vargula luciferase is 10-20 fold brighter than Flue and has the turnover number of 1600 per min. Vargula luciferase is a 555 amino acid protein, however, a truncated Vargula luciferase (Pro28-Cys 3 2) has been shown to retain about 38 % of the bioluminescence activity of the full length protein. This 248 amino acid, 38.7 kDa protein is comparable in size to Rluc, which was used in the BSLP construct of Example 1. Therefore, the small size of the bioluminescent protein, combined with the enzymatic turnover property of Vargula luciferase, could prove advantageous in the design of highly sensitive BSLP. [00112] Vargula luciferase genes can be obtained commercially, such as from

TargetingSystems, California. The gene corresponding to the truncated protein (amino acid 28-312) can be cloned in the pCold vector by following the same protocol as the

Glue cloning. Furthermore, a DNA hybridization assay based on truncated Rluc has been developed (Cissel, et al., "Reassembly of a Bioluminescent Protein Renilla

Luciferase Directed Through DNA Hybridization," Bioconjugate Chemistry, Vol. 20(1 ),

Pages 15-19 (January 2009)). Thus, problems are not anticipated in the plasmid construction and purification of the truncated Vargula luciferase.

Prophetic Example 3 - BSLPs Quenched by an Active-Site Inhibitor in the Closed Conformation

[00113] As shown in Fig. 3, the BSLPs described herein can include bioluminescent markers that are quenched by an active-site inhibitor when the BSLP is in the closed conformation. Opening of the hairpin-loop will separate the inhibitor from the active-site, allowing the bioluminescent substrate to access the active-site to produce bioluminescence.

[00114] One major problem in conventional SLP detection systems is incomplete quenching of the reporter signal in the closed conformation. Given the mechanism of light generation in FSLP design, energy-transfer based quenchers are perhaps the only appropriate option. However, the efficiency of this sort of quencher is dependent on a number of factors, including distance or proximity to the reporter and proper dipole alignment with the excited reporter. These variables lead to incomplete quenching of the fluorescent signal and higher background interference in the closed conformations. Thus, the use of active-site inhibitors (e.g., active-site analogs) should provide a quenching technique unique to the BSLP designs described herein.

[00115] Through the use of an active-site inhibitor of the bioluminescent protein, bioluminescence should be effectively quenched through disruption of the enzymatic catalysis of the substrate. Tethering the active-site inhibitor to the BSLP will bring the active-site inhibitor close to the binding site on the protein in the closed conformation. However, when the stem opens in the presence of the target sequence the inhibitor is moved away from the binding site allowing for the substrate to bind to the

bioluminescent protein, releasing radiation.

[001 6] Tethering of inhibitors to biomolecules has been successfully reported in the literature. Because the local concentration is drastically increased through tethering, the active site inhibitor can be chosen in such a way that its binding constant is considerably weaker than the substrate (e.g., coelenterazine, which has a K _D ~ 30 nM ⁴⁰ ). A weak inhibitor binding constant is beneficial because it will help ensure that the binding affinity of the inhibitor does not pose a significant contribution to the stem melting temperature (T _M ) and prevent the SLP from undergoing conformational opening upon binding target.

[00117] Several studies have identified mechanistic inhibitors that can act on Rluc active sites with varying degrees of affinity. Four inhibitors with K, values ranging from 10 ^"4 to 10 ^"7 M may be of particular interest for use in the BSLPs described herein.

[00118] These compounds should also work similarly in BSLPs where the bioluminescent marker is Glue or any other coelenterazine-dependent protein or enzyme.

[00119] Docking simulations will be carried out on these inhibitors using Molecular Operating Environment (i.e. MOE - Chemical Computing Group, Montreal, Quebec, Canada) to understand their binding characteristics computationally, and compare them to coelenterazine-binding. Since Glue is also a coelenterazine-dependent protein, the selected compounds should also work similarly in the Gluc-based BSLP design.

[00120] As shown in Fig. 3, inclusion of a linker between the SLP and the inhibitor may be particularly useful for BSLP designs incorporating active-site inhibitors. The linker used must be sufficiently soluble in the surrounding solution and provide enough flexibility that the linker does not prevent proper binding in the active-site.

[00121] As shown in Fig. 16, one approach for synthesizing a BSLP with a linker- quencher complex is to couple a carboxyl containing linker to the active-site inhibitor compounds through the aliphatic and aromatic primary amines present in these structures. The linker can be attached through the formation of an amide bond via reaction with 2,4 _> 6-triacyloxy-1 ,3,5-triazine. A polyethylene glycol (PEG) linker containing a carboxylic acid (COOH) and i-butyl carbamate protected amine (NBoc) can be used. Such a linker is available in varying sizes from Quanta BioDesign, Ltd.

(Powell, Ohio), which allows for the optimal length linker to be selected based on experimental results. The reaction can proceed through the following steps:

step 1) the carboxyl group replaces the chlorine in cyanuric chloride to yield amine-reactive 2,4,6-triacyloxy-1 ,3,5-triazine;

step 2) the amide bond is formed through the nucleophilic attack on the carbonyl of 2,4,6-triacyloxy-1 ,3,5-triazine, resulting 3 equivalents of PEG-linker modified inhibitor; and

step 3) the boc-protecting group is removed from the linker exposing the amine for conjugation to SLP through bifunctional linkers.

[00122] Once the PEG linker-modified inhibitor is synthesized (Fig. 16), the linker can be attached to the custom-modified hairpin-loop sequence using a cross-linker such as SANH, SMCC, DSS, etc. (all of which are available from Pierce - Thermo Fisher Scientific Inc.). Rluc can be conjugated to the hairpin-loop construct using SANH as shown in Figure 5.

[00123] The current method used to conjugate SLP(s) to Rluc attaches aldehyde- modified SLPs to primary amines (Lys residues) present on the Rluc surface. The SLP stem duplex is B-form DNA and is approximately 20 A in diameter. Assuming that Rluc and the inhibitor are both attached with similarly sized flexible linkers, the stem duplex distance provides a good starting distance for the selection of potential attachment sites.

[00124] Controlled conjugation of the SLP to the bioluminescent marker can also be achieved using maleimide chemistry. For example, surface-accessible cysteines can be introduced near the active site of the bioluminescent reporter using point mutations produced by site-directed mutagenesis. This will allow for very controlled conjugation of the SLP to the bioluminescent reporter using maleimide chemistry, such as the heteroblfunctional crosslinker succinimidyl-4-(A/-maleimidomethyl)cyclohexane-1- carboxylate (SMCC) available from Pierce-Thermo Fisher Scientific Inc. [00125] Alternative Approaches. The identification of bioluminescent protein and enzyme inhibitors with the right binding constant that would not prevent the opening of the stem in the presence of the target is obviously important. It has been reported that DNA hybridization typically yields dissociation constants in the nM to sub-pM range for about 20 nt length hairpin-loop seqeunces. This tight binding upon target hybridization should be sufficient to overcome the binding of the inhibitor to the bioluminescnet proteins and enzymes.

Prophetic Example 4 - Use of BSLPs for In Vivo Imaging of Circulating miRNAs, primary tumor and metastasis

[00126] It is an objective of this technology to utilize BSLPs as an imaging technique to detect circulating miRNAs released by a primary tumor and metastases, as well as, imaging of the primary tumor and metastases themselves. Initially, miRNAs being secreted by a triple negative breast cancer cell line MDA231 will be identified by expression profiling. BSLPs specific to the miRNAs expressed by MDA231 can be further screened to exclude BSLPs that are cross-reacting with rodent miRNAs. Further screening of BSLPs specific to human tumor derived miRNAs lacking cross-reactivity with rodent forms can be tested in mouse serum in vitro. Finally BSLPs targeting specific miRNAs that were identified in vitro to be suitable to detect circulating and tumor-derived miRNAs can be tested in mice using in vivo small animal

bioluminescence detection.

[00127] Part I Identification of miRNAs expressed in MDA231 and excreted in the supernatant. MDA231 cells, exosomes, and cell culture supernatant will be subjected to miRNA profiling by real-time PCR arrays for both human miRNA expression as well as cross-reactivity to rodent miRNAs. The detected miRNAs will be categorized in high, medium and low expressing species. miRNAs that were detected with the rodent panel will be compared by sequence alignment to human miRNAs and possible cross-reacting species will be excluded from further use for downstream applications.

[00128] Part II Bioluminescent stem-loop probe design. The probes will be designed based on the miRNA target sequences. Either Gluc-based BSLPs, Fluc- based BSLPs, or both can be used to look at a single target or dual targets.

Furthermore, Glue and Rluc could be detected together because of their different half- lives allowing for time-resolved emission. Exiqon LNA based miRNA inhibitors could also be used as target sequences to target specific human miRNAs. This can be used to identify the best approach for using BSLPs in miRNA imaging.

[00129] Part III In vitro detection of miRNAs secreted in serum by MDA231 derived tumors in immuno-compromised mice. MDA231 cells stably expressing red fluorescent protein (RFP) will be implanted in mammary fat pads of NOG (NOD/Shi-sc/d/IL-2Rynull) mice to form a primary tumor. MDA231 cells were chosen because, in NOG mice, these cells reliably form tumors that metastasize to lung, liver and bone tissue. Primary tumors are typically formed after approximately 30 days and can be assessed by palpitation at the injection site and detection of RFP using in vivo imaging. Once primary tumors are detected serum can be collected from these mice and a miRNA profile against both human and rodent miRNAs can be created by miRNA qPCR arrays. The profile can be compared to profiles from parental control mice not containing tumors and miRNA profiles from Part I. The miRNAs for imaging can be selected by being detected with qPCR arrays in MDA231 cell supernatant, serum of mice implanted with MDA231 and the lack of cross reactivity with rodent miRNAs based on expression profiling and sequence comparison. Candidate miRNAs can also be tested in mouse serum with BSLPs specific to these miRNAs to determine suitability for downstream applications.

[00130] Part IV In vivo small animal imaging of circulating miRNAs, solid tumors and metastasis using BSLPs. NOG mice can be injected with luciferin and increasing amounts of a Fluc-based BSLP that can yield bioluminescence over a long time period allowing for sensitivity evaluations, such as specificity and tolerable dose. Synthetic miRNAs injected into mice and BSLPs specifically designed to detect the synthetic miRNAs can be used to assess the sensitivity of the system for detecting circulating miRNAs. Subsequently NOG mice containing MDA231 derived tumors can be injected with a dose of BSLPs reacting with a specific miRNA (determined in partsl of this aim) and imaged at 10, 20 and 30 days to detect primary tumor. Once the primary tumor has been detected, the mice can be further injected and imaged after 60, 90 and 120 days to detect metastasis. The presence of primary tumor and larger metastasis will be verified by imaging of RFP.

[00131] The foregoing is provided for purposes of illustrating, explaining, and describing embodiments of this invention. Modifications and adaptations to these embodiments will be apparent to those skilled in the art and may be made without departing from the scope or spirit of this invention.