RELATED APPLICATIONS

[0001] This disclosure claims benefit and priority of United States Provisional

Patent Application serial no. 63/211,399 filed June 16, 2021, United States Provisional Patent Application serial no. 63/211,410 filed June 16, 2021, and United States Provisional Patent Application serial no. 63/211,477 filed June 16, 2021, all of which are incorporated herein by reference in their entirety.

INCORPORATION OF SEQUENCE LISTING

[0002] A computer readable form of the Sequence Listing “3244-

P65278PC00_SequenceListing” (36,110 bytes) and was created on June 16, 2022, is filed herewith by electronic submission and is incorporated by reference herein.

FIELD

[0003] The present disclosure relates to the field of biosensors, and in particular, to biosensors and methods of use thereof for detecting a target analyte comprising a microorganism, a virus, and/or a molecule present on a microorganism or virus, such as spike protein of severe acute respiratory syndrome coronavirus 2.

BACKGROUND

[0004] The COVID-19 pandemic, caused by SARS-CoV-2 (severe acute respiratory syndrome coronavirus 2), has resulted in enormous loss of human life and economic burden to society (1). The strategy of large-scale testing, contact tracing and isolation has been implemented by countries all over the world, which has been proven effective to control the spread of SARS-CoV-2. Although assays based on quantitative reverse transcription real-time polymerase chain reaction (qRT-PCR) have been extremely successful for detecting SARS-CoV-2, the high cost and slow turnaround time prevents its use as a rapid screening tool for the general public (2). As countries around the world work to slowly return to normalcy, the need for simpler, faster, more cost-effective large-scale testing has become critical to prevent or contain new outbreaks and help create safe environments for social and economic activities (3).

1

7595282 [0005] Antigen (Ag) tests capable of detecting a protein unique to SARS-CoV-2 have been approved by various health agencies. Examples include the Abbott PanBio™ COVID-19 Ag test, the Abbott BINAX Now™ COVID-19 Ag test, and the Ellume rapid COVID-19 test, all of which operate as lateral flow immunoassays for detection of the nucleocapsid protein and utilize nasal pharyngeal swabs for sample collection. While relatively rapid and inexpensive, such antigen tests are inherently less sensitive than RT- PCR assays simply because the viral protein targets cannot be amplified. For example, a recent study in Australia has found that even though the specificity of the Abbott PanBio™ COVID-19 Ag test was 99.96%, the sensitivity can be as low as 77.3% (4). In another study, the Abbott PanBio™ COVID-19 Ag test was examined for samples collected from assessment centers within the community using nasopharyngeal (NP), throat, and saliva swabs. For NP sampling, the sensitivity and specificity were found to be 86.1% and 99.9%, respectively; however, throat sensitivity and saliva sensitivity were found to be only 57.7% and 2.6%, respectively (5). The need for nasal pharyngeal swabs means that these tests still require supervised sample collection, and cannot be used for self-testing using more easily obtained lower nasal or saliva samples.

[0006] To improve the sensitivity and ease-of-use of rapid tests, one approach is to identify molecular recognition elements (MREs) with improved affinity and versatility relative to antibodies, which should allow detection of lower levels of virus in a wider range of sample matrixes. Aptamers, which are nucleic acid-based MREs that can be selected from random sequence pools by in vitro selection (6, 7), can provide several advantages over antibodies for development of rapid tests. These include small size, high chemical and thermal stability, easy and precise modification, scaleable production, minimal batch-to- batch variation (8), and the ability to apply aptamers to detect targets in a range of clinical samples (9-11), making aptamers popular MREs for biosensor development (12-14).

[0007] Some groups have isolated DNA aptamers that recognize the Spike protein of SARS-CoV-2 (15-19), however, almost all these aptamers were selected against the receptor-binding domain (RBD) of the spike protein and were used to inhibit the binding of the spike protein to the human angiotensin-converting enzyme 2 (ACE2).

[0008] The background herein is included solely to explain the context of the disclosure. This is not to be taken as an admission that any of the material referred to was published, known, or part of the common general knowledge as of the priority date.

2

7595282 SUMMARY

[0009] In accordance with an aspect of the present disclosure, provided herein is an aptamer that binds to severe acute respiratory syndrome coronavirus 2 (SARS-CoV- 2) spike protein, comprising a 5'-end region, a binding region and a 3’ end, wherein the 5’ end hybridizes to the 3 '-end region, and wherein the binding region has a nucleotide sequence selected from the group consisting of SEQ ID NOs: 34-135, a functional fragment, or a functional variant thereof. In some embodiments, the 5 '-end region comprises SEQ ID NO: 2 and the 3'-end region comprises SEQ ID NO: 4. In some embodiments, the binding region comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 34-44, 83, 85, 134, and 135. In some embodiments, the aptamer comprises a nucleotide sequence selected form the group consisting of SEQ ID NOs: 6-20, 22-29, and 31-33. In some embodiments, the aptamer comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-15, 20, 21, and 33. In some embodiments, the aptamer comprises a nucleotide sequence selected form the group consisting of SEQ ID NOs: 6-15. In some embodiments, the aptamer comprises a nucleotide sequence of SEQ ID NO: 6, 8, or 10. In some embodiments, the aptamer comprises a nucleotide sequence of SEQ ID NO: 17 or 27. In some embodiments, the aptamer further comprises at least one additional binding region, wherein each additional binding region comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 34-135, a functional fragment, or a functional variant thereof. In some embodiments, each additional binding region comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 33-44, 83, 85, 134, and 135. In some embodiments, the aptamer comprises two binding regions. In some embodiments, any two binding regions are connected by a binding regions linker. In some embodiments, the binding regions linker comprises a natural or a synthetic nucleotide linker. In some embodiments, the binding regions linker comprises polythymidine. In some embodiments, the aptamer comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 142-144 and 150. In some embodiments, the aptamer binds to the SARS-CoV-2 spike protein with at least nanomolar affinity.

[0010] Also provided is a biosensor for detecting SARS-CoV-2 spike protein comprising an aptamer described herein functionalized on and/or in a material.

[0011] In some embodiments, the biosensor further comprises:

3

7595282 a working electrode; a blocking species functionalized on the working electrode; a detection species, optionally comprised in a solution; and a counter electrode; wherein the aptamer is functionalized on the working electrode; and wherein the working electrode is configured to provide a change in signal if the SARS-CoV-2 spike protein is present.

[0012] In some embodiments, the biosensor is on an electrochemical chip. In some embodiments, the blocking species comprises polyethylene glycol (PEG). In some embodiments, the aptamer is functionalized on the electrode via chemical bonding, an intermediate linker, or physical adsorption. In some embodiments, the blocking species is functionalized on the electrode via chemical bonding, an intermediate linker, or physical adsorption. In some embodiments, the chemical bonding occurs via thiol and/or gold chemistry. In some embodiments, the working electrode has a surface density of about 1.1 x 10 ¹⁴ to about 1.5 ^c 10 ¹⁴ aptamers per cm ² . In some embodiments, the change in signal comprises a change in current, potential or impedance. In some embodiments, the change in signal is an increase in impedance if the SARS-CoV-2 spike protein is present. In some embodiments, the change in impedance is measured by charge transfer resistance of the solution comprising detection species. In some embodiments, the detection species comprises redox species. In some embodiments, the redox species comprises Fe ²⁺ and/or Fe ³⁺ ions. In some embodiments, the working electrode comprises a conductive material, semi-conductive material, or a combination thereof. In some embodiments, the working electrode comprises metal, metal alloy, metal oxide, superconductor, semi-conductor, carbon-based material, conductive polymer, or combinations thereof. In some embodiments, the working electrode comprises metal. In some embodiments, the metal is gold.

[0013] In some embodiments, the biosensor further comprises a reference electrode. In some embodiments, the biosensor is for use in screening and/or diagnostics, environmental monitoring, health monitoring, and/or pharmaceutical development. In

4

7595282 some embodiments, the biosensor is for use in screening, diagnostics, and/or health monitoring.

[0014] Also provided is a device comprising a biosensor described herein, wherein the device is a hand-held device.

[0015] Also provided is a method for detecting the presence of SARS-CoV-2 spike protein in a sample, the method comprising: a) contacting the working electrode of a biosensor described herein with the sample; b) contacting the working electrode from step a) with the detection species of the biosensor described herein; and c) detecting a change in signal; wherein detecting a change in signal indicates the presence of the SARS- CoV-2 spike protein in the sample.

[0016] In some embodiments, the change in signal comprises a change in current, potential or impedance. In some embodiments, the change in signal is an increase in impedance if the SARS-CoV-2 spike protein is present. In some embodiments, the change in impedance is measured by charge transfer resistance or double layer capacitance of the solution comprising detection species. In some embodiments, the method further comprises diluting the sample in buffer before step a). In some embodiments, the contacting the working electrode of the biosensor with the sample comprises incubating the working electrode with the sample for about 5 minutes. In some embodiments, the method further comprises washing the biosensor before step b). In some embodiments, a change in signal is detected within at least 10 minutes of step a). In some embodiments, a change in signal is detected within at least 3 minutes of step b). In some embodiments, the sample is a saliva sample. In some embodiments, the method detects SARS-CoV-2 infection in a subject. In some embodiments, the method further comprises testing the sample for SARS-CoV-2 RNA using an amplification-based method.

[0017] Also provided is a kit for detecting SARS-CoV-2 spike protein in a sample, wherein the kit comprises a biosensor described herein, a device described

5

7595282 herein, or components required for a method described herein, and instructions for use of the kit.

[0018] Also provided is a method of identifying or producing an aptamer capable of binding to a target analyte, the method comprising: a) providing a plurality of nucleic acid molecules comprising at least one random nucleotide domain flanked by a 5'-end region and a 3'-end region, wherein the 5'-end region hybridizes to the 3'-end region to form a duplex DNA element, and wherein the random nucleotide domain comprises an aptamer-like structure; b) annealing the plurality of nucleic acid molecules to allow formation of secondary structures; c) contacting the plurality of nucleic acid molecules with the target analyte; d) collecting nucleic acid molecules which have bound to the target analyte; and e) amplifying the nucleic acid molecules from step d) to yield a mixture of nucleic acid molecules enriched in nucleotide sequences that are capable of binding to the target analyte.

[0019] In some embodiments, the 5'-end region comprises a forward primer binding site and the 3 '-end region comprises a reverse primer binding site for amplifying the nucleic acid molecules by polymerase chain reaction (PCR). In some embodiments, step c) comprises incubating the plurality of nucleic acid molecules with the target analyte in solution. In some embodiments, the method further comprises immobilizing the target analyte on a solid support before step c). In some embodiments, step d) further comprises separating the nucleic acid molecules which have bound to the target analyte from unbound nucleic acid molecules. In some embodiments, the 5'-end region comprises SEQ ID NO: 2 and the 3'-end region comprises SEQ ID NO: 4, which hybridize to form a duplex DNA element. In some embodiments, the target analyte is a microorganism, a virus, and/or a molecule present on a microorganism or a virus. In some embodiments, the target analyte is SARS-CoV-2 spike protein.

6

7595282 [0020] Other features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating embodiments of the disclosure, are given by way of illustration only and the scope of the claims should not be limited by these embodiments, but should be given the broadest interpretation consistent with the description as a whole.

DRAWINGS

[0021] Certain embodiments of the disclosure will now be described in greater detail with reference to the attached drawings in which:

[0022] FIG. 1A shows the pre-engineered secondary structure of the DNA library in exemplary embodiments of the disclosure.

[0023] FIG. IB shows the sequences of the forward primer (SEQ ID NO: 2) and reverse primers (SEQ ID NO: 3, 5) for the amplification of the DNA library by PCR in exemplary embodiments of the disclosure

[0024] FIG. 2A shows an in vitro selection schematic used for the isolation of

DNA aptamers for SI protein using beads-based selection in exemplary embodiments of the disclosure: the selection began with a library containing ~6 x 10 ¹⁴ unique sequences, the library was incubated with SI coated magnetic beads to retain SI binding sequences, which were eluted and amplified by PCR to produce an enriched pool for the next round of selection - the first three cycles were performed with this method.

[0025] FIG. 2B shows an in vitro selection schematic used for the isolation of

DNA aptamers for SI protein using gel based selection in exemplary embodiments of the disclosure: for selection cycles 4-13, the DNA pool was incubated with free SI, followed by native polyacrylamide gel electrophoresis to isolate the DNA/S1 complexes, which have retarded gel mobility, and the complex band was cut out from the gel, eluted and amplified by PCR to produce a new pool for the next round of selection.

[0026] FIG. 3 A shows assessment of binding of selected enriched DNA pools using EMSA in exemplary embodiments of the disclosure.

7

7595282 [0027] FIG. 3B shows a fraction bound of pools 0, 5, 7, 9, 10, 11 and 13 - FAM- labelled DNA (25 nM) and SI protein (250 nM) were used for the binding analysis in exemplary embodiments of the disclosure.

[0028] FIG. 4A shows SI protein aptamer selection and the sequence of the

DNA library used for in vitro selection in exemplary embodiments of the disclosure.

[0029] FIG. 4B shows SI protein aptamer selection and the random domain sequence (40 nt) of the top 10 DNA sequences (SEQ ID NOs: 34-43) in pool 13 and their binding affinity in exemplary embodiments of the disclosure.

[0030] FIG. 5A shows an assessment of binding affinity of MSA1 (SEQ ID NO:

6) and MSA5 (SEQ ID NO: 10) by dot blot assay through representative dot blot results showing binding of MSA1 and MSA5 to the SI subunit in exemplary embodiments of the disclosure.

[0031] FIG. 5B shows binding curves used to derive the K _A values for MSA1 and MSA5 for (B) the SI subunit in exemplary embodiments of the disclosure.

[0032] FIG. 5C shows assessment of binding affinity of MSA1 (SEQ ID NO:

6) and MSA5 (SEQ ID NO: 10) by dot blot assay through representative dot blot results showing binding of MSA1 and MSA5 to the trimeric S protein of SARS-CoV-2 in exemplary embodiments of the disclosure.

[0033] FIG. 5D shows the binding curves used to derive the KA values for

MSA1 and MSA5 for the trimeric S protein of SARS-CoV-2 in exemplary embodiments of the disclosure.

[0034] FIG. 6A shows assessment of MSA1 (SEQ ID NO: 6) and MSA5 (SEQ

ID NO: 10) for RBD binding through dot blot results of MSA1 and MSA5 binding to the RBD of the spike protein of SARS-CoV-2 (BA: bound aptamer; UA: unbound aptamer) in exemplary embodiments of the disclosure.

[0035] FIG. 6B shows assessment of MSA1 (SEQ ID NO: 6) and MSA5 (SEQ

ID NO: 10) for RBD binding through binding curves used to derive the K _A values in exemplary embodiments of the disclosure.

[0036] FIG. 7 A shows dot blot results of MSA1 (SEQ ID NO: 6) and MSA5

(SEQ ID NO: 10) for binding to the SI protein of SARS-CoV-2 and control proteins

8

7595282 (BA: bound aptamer; UA: unbound aptamer) in exemplary embodiments of the disclosure.

[0037] FIG. 7B shows dot blot results of MSA1 (SEQ ID NO: 6) and MSA5

(SEQ ID NO: 10) for binding to the SI protein of SARS-CoV-2 and control proteins (BA: bound aptamer; UA: unbound aptamer) in exemplary embodiments of the disclosure.

[0038] FIG. 7C shows the affinity (K _d ) of MSA1 and MSA5 for binding to the

SI protein in the 50% pooled human saliva in exemplary embodiments of the disclosure.

[0039] FIG. 8A shows dot blot results of MSA1 in exemplary embodiments of the disclosure.

[0040] FIG. 8B shows dot blot results of MSA5 for binding to the S 1 protein of

SARS-CoV-2 and control proteins that include the RBD and the spike (S) protein of SARS-CoVl, the RBD of MERS, and the RBD of HCoV-229E (BA: bound aptamer; UA: unbound aptamer; 50 nM proteins were used for the tests) in exemplary embodiments of the disclosure.

[0041] FIG. 9A shows dot blot results of MSA1 for binding to the spike (S) protein of SARS-CoV-1 in exemplary embodiments of the disclosure.

[0042] FIG. 9B shows dot blot results of MSA1 for binding to the RBD of

MERS (BA: bound aptamer; UA: unbound aptamer) and (C) binding curves used to evaluate the K _d values in exemplary embodiments of the disclosure.

[0043] FIG. 10A shows representative dot blot results showing binding of

MSA1 (SEQ ID NO: 6) in exemplary embodiments of the disclosure.

[0044] FIG. 10B shows representative dot blot results showing binding of

MSA5 (SEQ ID NO: 10) to the trimeric S protein of the wild-type Wuhan variant (WHS) and the UK B.1.1.7 variant (UKS) of SARS-CoV-2 in exemplary embodiments of the disclosure.

[0045] FIG. 11 A shows affinity (K _d ) analysis of binding of MSA1 (SEQ ID NO:

6) to to the trimeric S proteins of the original Wuhan variant and the B.1.1.7 variant in exemplary embodiments of the disclosure.

9

7595282 [0046] FIG. 1 IB shows affinity (¾) analysis of binding ofMSA5 (SEQ ID NO:

10) to the trimeric S proteins of the original Wuhan variant and the B.1.1.7 variant in exemplary embodiments of the disclosure.

[0047] FIG. llC shows the affinity (Kd) analysis of the binding of MSA1 and

MSA5 to a pseudotyped lenti virus (PV) that was engineered to display the S -protein of SARS-CoV-2 and the same lentivirus that lacks the S-protein (CV) in exemplary embodiments of the disclosure.

[0048] FIG. 12A shows dot blot results of MSA1 (SEQ ID NO: 6) and MSA5

(SEQ ID NO: 10) for binding to a pseudotyped lentivirus (PV) that was engineered to display the wild-type S-protein of SARS-CoV-2 in exemplary embodiments of the disclosure.

[0049] FIG. 12B shows dot blot results of MSA1 (SEQ ID NO: 6) and MSA5

(SEQ ID NO: 10) for binding to the same lentivirus that lacks the S-protein (CV) in exemplary embodiments of the disclosure.

[0050] FIG. 13A shows relative binding activity of MSA1 (SEQ ID NO: 6) in exemplary embodiments of the disclosure.

[0051] FIG.13B shows relative binding activity of MSA5 (SEQ ID NO: 10) to

SI protein and pseudotyped virus of SARS-CoV2 in exemplary embodiments of the disclosure.

[0052] FIG. 14A shows the assay design principle for a colorimetric assay to detect the pseudotyped lentivirus of SARS-CoV-2 in 50% saliva via a sandwich assay using MSA1 (SEQ ID NO: 6) in exemplary embodiments of the disclosure.

[0053] FIG. 14B shows a photograph of the colorimetric test for a colorimetric assay to detect the pseudotyped lentivirus of SARS-CoV-2 in 50% saliva via a sandwich assay using MSA1 (SEQ ID NO: 6) in exemplary embodiments of the disclosure.

[0054] FIG. 14C shows absorbance at 450 nm of the reaction solutions for a colorimetric assay to detect the pseudotyped lentivirus of SARS-CoV-2 in 50% saliva via a sandwich assay using MSA1 (SEQ ID NO: 6) in exemplary embodiments of the disclosure.

10

7595282 [0055] FIG. 14D shows the linear response curve in the range of 0.5-20 pM pseudovirus for a colorimetric assay to detect the pseudotyped lentivirus of SARS- CoV-2 in 50% saliva via a sandwich assay using MSA1 (SEQ ID NO: 6) in exemplary embodiments of the disclosure.

[0056] FIG. 15 shows the predicted secondary structure of MSA1 (SEQ ID NO:

6) and the binding affinity of its truncation mutants in exemplary embodiments of the disclosure.

[0057] FIG. 16 shows the predicted secondary structure of MSA5 (SEQ ID NO:

10) and the binding activity of its truncation mutants in exemplary embodiments of the disclosure.

[0058] FIG. 17 shows the predicted secondary structure of MSA3 (SEQ ID NO:

8) and the binding activity of its truncation mutants in exemplary embodiments of the disclosure.

[0059] FIG. 18 shows a comparison of the hairpin structures of the minimized mutants of MSA1(SEQ ID NO: 6), MS A3 (SEQ ID NO: 8) and MSA5 (SEQ ID NO: 10) in exemplary embodiments of the disclosure.

[0060] FIG. 19A shows dot blot results of two reported aptamers, CoV2-RBD-

1 and Apt-S-268s, for binding to the spike protein of SARS-CoV-2 (BA: bound aptamer; UA: unbound aptamer) in exemplary embodiments of the disclosure.

[0061] FIG, 19B shows binding curves used to derive the K _& values in exemplary embodiments of the disclosure.

[0062] FIG. 20A shows nucleotide BLAST comparison of MSAl-10 (SEQ ID

NOs: 6-15) aptamers identified in this disclosure and a selection of published spike aptamer sequences as displayed by numerical nucleotide BLAST scores for all sequence pairs where a hit was reported in exemplary embodiments of the disclosure (sequences of high similarity generate high scores indicated in dark shading; high alignment scores along the diagonal represent self-alignment; high scores along a column or row indicate similarity of the sequence to other sequences in the dataset) - using a BLASTn algorithm run with parameters word size = 5 and strand = plus/plus; heatmap is coloured based on bit-score intervals.

11

7595282 [0063] FIG. 20B shows a local alignment of the two most significant hits observed between MSAl-10 aptamers and published aptamers (Apt-S-79s vs. MSA2 and CoV2-2 vs. MSA10) - alignment is observed between G-rich regions of both aptamer sequences in exemplary embodiments of the disclosure.

[0064] FIG. 21 A shows the secondary structures of truncated aptamers MSA1T

(MSA1-T2; SEQ ID NO: 17) and MSA5T (MSA5-T2; SEQ ID NO: 27), as well as dimeric aptamers DSA1N5 (SEQ ID NO: 142), DSA1N1 (SEQ ID NO: 143) and DSA5N5 (SEQ ID NO: 144) built with MSA1T, MSA5T and 30-mer polythymidine linker (T30) in exemplary embodiments of the disclosure.

[0065] FIG. 21 B shows affinity tests and Kd (nM) values of the aptamers binding to the wild-type trimeric spike protein (Wuhan variant, WHTS) and the UK variant trimeric spike protein (UKTS) - the scrambled sequences of these aptamers (MIC, M5C and DMC; SEQ ID NO: 145, 146 and 149) were also tested as negative controls in exemplary embodiments of the disclosure.

[0066] FIG. 22 shows affinity tests of the dimeric DSA1N5 aptamer (SEQ ID

NO: 39) with different polyT linkers on the MSA5T (10, 15, 20, 30 and 40 of polythy mi dines; SEQ ID NO: 136, 137, 138, 139 and 140) binding the trimeric wild- type spike protein of SARS-CoV-2 in exemplary embodiments of the disclosure.

[0067] FIG. 23 shows the dot blot results of DSA1N5 (SEQ ID NO: 142),

DSA1N1 (SEQ ID NO: 143), DSA5N5 (SEQ ID NO: 144), DMC (SEQ ID NO: 149), MSA1T (SEQ ID NO: 17), MSA5T (SEQ ID NO: 27), MIC (SEQ ID NO: 145) and M5C (SEQ ID NO: 146) for the full spike proteins of wild-type SARS-CoV-2 in exemplary embodiments of the disclosure (DMC, MIC and M5C are the mutant sequences of DSA1N5, MSA1T and MSA5T; BA and UA are bound and unbound aptamers).

[0068] FIG. 24A shows a comparison of binding of MSA1T (SEQ ID NO: 17) in exemplary embodiments of the disclosure.

[0069] FIG. 24B shows a comparison of binding of MSA5T (SEQ ID NO: 27) to the SI subunit and the full-length spike protein of wild-type SARS-CoV-2 in exemplary embodiments of the disclosure.

12

7595282 [0070] FIG. 25 A shows competition between MS AIT (SEQ ID NO: 17) and

MSA5T (SEQ ID NO: 27) for binding to SI. The schematic in which radioactive MSA1T is allowed to bind fully to SI before competition with MSA5T in exemplary embodiments of the disclosure.

[0071] FIG. 25B shows competition between MS AIT (SEQ ID NO: 17) and

MSA5T (SEQ ID NO: 27) for binding to SI through assay results using a 100 nM solution of SI incubated with 2.5 nM radioactive (*) MSA1T, followed by the addition of 3-100 nM non-radioactive MSA5T in exemplary embodiments of the disclosure.

[0072] FIG. 26 shows the dimeric aptamer DSA1N5 (SEQ ID NO: 142) binding with mutant trimeric spike proteins of varial varaints that emerged in UK (UKTS), South Africa (SATS) and Brazil (BZTS) in exemplary embodiments of the disclosure.

[0073] FIG. 27 shows binding between DSA1N5 (SEQ ID NO: 142) and pseudotyped lentiviruses expressing the spike of SARS-CoV-2 in exemplary embodiments of the disclosure - CV : control lentivirus, WHPV and UKPV : lentiviruses pseudotyped with the spike protein of the original Wuhan virus and the UK variant, WHTS and UKTS: trimeric spike protein of the wild-type Wuhan virus and the UK variant, DMC: inactive mutant dimeric aptamer control.

[0074] FIG. 28A shows Cov-eChip optimization using acyclic voltammetry of bare gold electrodes to assess reproducibility and surface area Cov-eChip optimization in exemplary embodiments of the disclosure.

[0075] FIG. 28B shows the Nyquist plots for bare, polyethylene glycol (PEG)- functionalized and aptamer-functionalized electrodes for Coy-eChip optimization in exemplary embodiments of the disclosure.

[0076] FIG. 28C shows optimization of aptamer concentration for Cov-eChip optimization in exemplary embodiments of the disclosure.

[0077] FIG. 28D shows chronocoulometry for Coy-eChip optimization performed on the functionalized surface to calculate the aptamer surface density using the optimized aptamer concentration of 2 mM - the dash lines refer to measurement done in 10 mM Tris buffer (pH = 7.2) whereas the solid lines refer to measurement

13

7595282 done in 1 mM of ruthenium hexamine containing 10 mM Tris buffer (pH = 7.2) in exemplary embodiments of the disclosure.

[0078] FIG. 29A shows Cov-eChip assay data analysis for the equivalent circuit model used for fitting the electrochemical impedance spectroscopy (EIS) data - the solution resistance, Rs, is in series with the capacitance, C, charge transfer resistance, Ret, and the Warburg element, W, in exemplary embodiments of the disclosure.

[0079] FIG. 29B shows the list of the parameters and their values extracted from the fitting during Coy-eChip assay data analysis in exemplary embodiments of the disclosure.

[0080] FIG. 30A shows the design and validation of the aptamer based electrochemical assay for the detection of SARS-CoV-2 spike protein in exemplary embodiments of the disclosure. A schematic of the electrochemical assay for the detection of SARS-CoV-2 using spike protein aptamer - after incubation with the viral target, the charge transfer resistance increases due to surface blocking of the redox reaction of the Fe ²⁺ /Fe ³⁺ ions in exemplary embodiments of the disclosure. :

[0081] FIG. 30B shows the design and validation of the aptamer based electrochemical assay for the detection of SARS-CoV-2 spike protein in exemplary embodiments of the disclosure. Changes in the charge transfer resistance measured in the redox solution containing Fe ²⁺ /Fe ³⁺ ions at different time interval (5, 10, 20 minutes) tested with and without 40 fM trimeric spike protein (error bars represent the standard deviation from the mean obtained using three, n=3, separate devices per sample).

[0082] FIG. 30C Shown is a Nyquist plot of the different concentrations of trimeric spike protein spiked in buffer incubated on the chip for 5 min for the design and validation of the aptamer based electrochemical assay for the detection of SARS- CoV-2 spike protein in exemplary embodiments of the disclosure.

[0083] FIG. 30D shows a calibration plot of the different concentrations of the trimeric spike protein for the design and validation of the aptamer based electrochemical assay for the detection of SARS-CoV-2 spike protein in exemplary embodiments of the disclosure. Dotted line indicates the mean signal change for the buffer without viral load (n=3) and the points represent the mean of the signal change calculated using charge transfer resistance (RCT) extracted from Nyquist plot (R _d f-

14

7595282 Rc _t i)/ Rc _Tt i) for a given sample (error bars represent the standard deviation from the mean obtained using three, n=3, separate devices per sample).

[0084] FIG. 31A shows a Nyquist plot obtained for detecting different concentrations of the pseudotyped virus in diluted saliva for Cov-eChip Assay validation with pseudotyped virus spiked in diluted pooled saliva in exemplary embodiments of the disclosure:

[0085] FIG. 3 IB shows the list of parameters and their values extracted from the fitting for Cov-eChip Assay validation with pseudotyped virus spiked in diluted pooled saliva in exemplary embodiments of the disclosure.

[0086] FIG. 32A shows a calibration plot of the different concentrations of the

WH and UK pseudotyped virus spiked in diluted pooled saliva (dotted line indicates the signal change for the diluted pooled saliva without viral load) for electrochemical detection of pseudotyped virus, in exemplary embodiments of the disclosure.

[0087] FIG. 32B shows control experiments done with diluted pooled saliva, mutant aptamer functionalized chip incubated with 10 ³ cp/mL pseudotyped virus spiked diluted pooled saliva, Interleukin-6- 1000 pg/mL spiked diluted pooled saliva, Streptavi din-1000 pg/mL spiked diluted pooled saliva, S. aureus- 10 ⁵ CFU/mL spiked diluted pooled saliva, control lentivirus-10 ⁵ cp/mL spiked diluted pooled saliva, pseudotyped virus (10 ³ - 10 ⁴ cp/mL) spiked diluted pooled saliva for electrochemical detection of pseudotyped virus, in exemplary embodiments of the disclosure.

[0088] FIG. 32C shows a method for collection of patient saliva - patient sample treatment was done by heating the collected sample at 65 °C for 30 min followed by diluting in binding buffer (1:1 v/v %) for electrochemical detection of pseudotyped virus, in exemplary embodiments of the disclosure.

[0089] FIG. 32D shows a charge transfer resistance for 25 COVID- 19 negative saliva samples before and after spiking with 10 ⁴ cp/mL Wuhan pseudotyped virus (error bars represent the standard deviation from the mean obtained using three, n=3, separate devices per sample) for electrochemical detection of pseudotyped virus, in exemplary embodiments of the disclosure.

15

7595282 [0090] FIG. 33 shows the effect of saliva sample heating on the performance of the Cov-eChip assay saliva in exemplary embodiments of the disclosure: a 1000 cp/mL of pseudovirus was spiked in diluted pooled saliva, which were heat inactivated by heating at 65 °C for 30 min and compared with pseudotyped lentivirus spiked in diluted pooled saliva without heating (left-side bars of pair indicate the un-spiked saliva and right-side bars of pair indicate the spiked saliva samples).

[0091] FIG. 34A shows a schematic of the Cov eChip assay in exemplary embodiments of the disclosure: following sample dilution, the sample is added to the electrode and incubated for 5 min at room temperature, washed for 1 min and scanned for 2 min using a handheld mobile-operated potentiostat.

[0092] FIG. 34B shows signal change measured on the Cov-eChip using 34 clinically-obtained COVID-19 positive (right side; grey -Wuhan variant, dark grey-UK variant) and 37 negative (left side) patient saliva samples, in exemplary embodiments of the disclosure: dotted line indicates the cut-off point for the assay andthe bars represent the mean of the signal change calculated using charge transfer resistance (RCT) extracted from Nyquist plot (Rcif-Rcii)/ Rcri) for a given sample (error bars represent the standard deviation from the mean obtained using three, n=3, separate devices per sample showing the clinical performance of the Cov-eChip assay.

[0093] FIG. 34C shows a box and whisker plot showing distribution of the

COVID-19 positive and negative patient saliva samples presented in FIG. 34B, demonstrating the clinical performance of the Cov-eChip assay, in exemplary embodiments of the disclosure.

[0094] FIG. 35 shows false negative sample study with pseudotyped virus in exemplary embodiments of the disclosure: the signal measured from the false negative samples before (left-side of pair) and after (right-side of pair) spiking with 10 ⁶ cp/mL of pseudovirus.

[0095] FIG. 36A shows a comparison of binding profdes of MSA1 with the SI subunit of wildtype SARS-CoV-2 (WH-S1) and the SI subunit of B.1.617.2 variant (IN-SI) in exemplary embodiments of the disclosure.

16

7595282 [0096] FIG. 36B shows a comparison of binding profiles of MSA5 with the SI subunit of wildtype SARS-CoV-2 (WH-S1) and the SI subunit of B.1.617.2 variant (IN-SI) in exemplary embodiments of the disclosure.

[0097] FIG. 36C shows a comparison of binding profiles of DSA1N5 with the

SI subunit of wildtype SARS-CoV-2 (WH-S1) and the SI subunit of B.1.617.2 variant (IN-SI) in exemplary embodiments of the disclosure.

[0098] FIG. 37 shows the performance of monomeric aptamers MS AIT and

MSA5T for detection of trimeric spike protein in exemplary embodiments of the disclosure. Calibration plot of the different concentrations of the trimeric spike protein tested with monomeric aptamers MS AIT and MSA5T.

[0099] FIG. 38 shows the performance of monomeric aptamers MSA1T and

MSA5T for detection of Wuhan pseudotyped virus in exemplary embodiments of the disclosure. Calibration plot of the different concentrations of the WHPV tested with monomeric aptamers MS AIT and MSA5T.

[00100] FIG. 39 shows the Receiver-Operator Characteristics Curve for the Cov- eChip assay in exemplary embodiments of the disclosure. The overall accuracy, or area under the curve (AUC) was 0.923 (Cl, 0.860 - 0.985) with an optimum sensitivity of 80.5% (true positive cases detected) at a threshold of 1.27 ARct/Rct and a corresponding specificity of 100% (no false positive cases detected). TPF is true positive fraction. FPF is false-positive fraction.

DETAILED DESCRIPTION

I Definitions

[00101] Unless otherwise indicated, the definitions and embodiments described in this and other sections are intended to be applicable to all embodiments and aspects of the present disclosure herein described for which they are suitable as would be understood by a person skilled in the art. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting.

[00102] In understanding the scope of the present disclosure, the term “comprising” and its derivatives, as used herein, are intended to be open ended terms that specify the

17

7595282 presence of the stated features, elements, components, groups, integers, and/or steps, but do not exclude the presence of other unstated features, elements, components, groups, integers and/or steps. The foregoing also applies to words having similar meanings such as the terms, “including”, “having” and their derivatives. The term “consisting” and its derivatives, as used herein, are intended to be closed terms that specify the presence of the stated features, elements, components, groups, integers, and/or steps, but exclude the presence of other unstated features, elements, components, groups, integers and/or steps. The term “consisting essentially of’, as used herein, is intended to specify the presence of the stated features, elements, components, groups, integers, and/or steps as well as those that do not materially affect the basic and novel characteristic(s) of features, elements, components, groups, integers, and/or steps.

[00103] Terms of degree such as “substantially”, “about” and “approximately” as used herein mean a reasonable amount of deviation of the modified term such that the end result is not significantly changed. These terms of degree should be construed as including a deviation of at least ±5% of the modified term if this deviation would not negate the meaning of the word it modifies. The modifier “about” used in connection with a quantity is inclusive of the stated value and has the meaning dictated by the context (e.g., it includes the degree of error associated with measurement of the particular quantity). In addition, all ranges disclosed herein are inclusive of the endpoints and also any intermediate range points, whether explicitly stated or not, and the endpoints are independently combinable with each other.

[00104] As used in this disclosure, the singular forms “a”, “an” and “the” include plural references unless the content clearly dictates otherwise.

[00105] In embodiments comprising an “additional” or “second” component, the second component as used herein is chemically different from the other components or first component. A “third” component is different from the other, first, and second components, and further enumerated or “additional” components are similarly different.

[00106] The term “and/or” as used herein means that the listed items are present, or used, individually or in combination. In effect, this term means that “at least one of’ or “one or more” of the listed items is used or present.

18

7595282 [00107] The abbreviation, “e.g.” is derived from the Latin exempli gratia and is used herein to indicate a non-limiting example. Thus, the abbreviation “e.g.” is synonymous with the term “for example.” The word “or” is intended to include “and” unless the context clearly indicates otherwise.

[00108] The term "sample" or "test sample" as used herein refers to any material in which the presence or amount of a target analyte is unknown and can be determined in an assay. The sample can be from any source, for example, any biological (e.g. human or animal samples, including clinical samples), environmental (e.g. water, soil or air) or natural (e.g. plants) source, or from any manufactured or synthetic source (e.g. food or drinks). The sample can be comprised or is suspected of comprising one or more analytes. The sample can be a "biological sample" comprising cellular and non- cellular material, including, but not limited to, tissue samples, saliva, sputum, urine, blood, serum, other bodily fluids and/or secretions. In some embodiments, the sample comprises saliva, sputum, oropharyngeal and/or nasopharyngeal secretions. In some embodiments, the sample comprises saliva.

[00109] The term “target”, “analyte” or “target analyte” as used herein refer to any agent, including, but not limited to, a small inorganic molecule, small organic molecule, metal ion, biomolecule, toxin, biopolymer (such as a nucleic acid, carbohydrate, lipid, peptide, protein), cell, tissue, microorganism and virus, for which one would like to sense or detect. The analyte can be either isolated from a natural source or synthetic. The analyte can be a single compound or a class of compounds, such as a class of compounds that share structural or functional features. The term analyte also includes combinations (e.g. mixtures) of compounds or agents such as, but not limited, to combinatorial libraries and samples from an organism or a natural environment.

[00110] The term "treatment or treating" as used herein refer to an approach for obtaining beneficial or desired results, including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of disease, stabilized (i.e. not worsening) state of disease, preventing spread of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.

19

7595282 [00111] The term "subject" as used herein includes all members of the animal kingdom including mammals such as a mouse, a rat, a dog and a human.

[00112] The term “virus” as used herein refer to an organism of simple structure, composed of proteins and nucleic acids, and capable of reproducing only within specific living cells, using its metabolism. In some embodiments, the virus is an enveloped virus, a non-enveloped virus, a DNA virus, a single-stranded RNA virus and/or a double-stranded RNA virus. Non-limiting examples of virus include rhinovirus, myxovirus (including influenza virus), paramyxovirus, coronavirus such as SARS- CoV-2, norovirus, rotavirus, herpes simplex virus, pox virus (including variola virus), reovirus, adenovirus, enterovirus, encephalomyocarditis virus, cytomegalovirus, varicella zoster virus, rabies lyssavirus and retrovirus (including HIV).

[00113] The term “severe acute respiratory syndrome coronavirus 2”, “coronavirus 2”, or “SARS-CoV-2” as used herein refer to a coronavirus first identified in Wuhan, China in 2019 that causes coronavirus disease (COVID-19). The term includes any variant of the SARS-CoV-2 virus with a variant and/or mutated nucleic acid sequence from the original version identified in Wuhan. Variants includes, but are not limited to, UK B.l.1.7 (501Y.V1), South Africa B.1.351 (501Y.V2), Brazil P.l (501Y.V3) and India B.1.617.

[00114] The term “nucleic acid” as used herein refers to a biopolymer comprising monomers of nucleotides, such as deoxyribonucleic acid (DNA), ribonucleic acid (RNA) and other polynucleotides of modified nucleotides and/or nucleotide derivatives, and can be either double stranded (ds) or single stranded (ss). In some embodiments, modified nucleotides contain one or more modified bases (e.g. unusual bases such as inosine, and functional modifications to the bases such as amino), modified backbones (e.g. peptide nucleic acid, PNA) and/or other chemically, enzymatically, or metabolically modified forms.

[00115] The term "aptamer" as used herein refers to a short, chemically synthesized nucleic acid molecule or oligonucleotide sequence which can be generated by in vitro selection to fold into specific three-dimensional structures that bind to a specific analyte with dissociation constants, for example, in the pico- to nano-molar range. Aptamers can be single-stranded DNA, RNA, modified nucleotides and/or nucleotide derivatives. Aptamers can also be naturally occurring RNA aptamers termed

20

7595282 “riboswitches”. Functional aptamer sequences can also be rationally designed, truncated, conjugated or otherwise modified from original parent (or full length) sequences. A functional fragment of an aptamer is the portion of an aptamer that retains aptameric function, for example, function in binding to molecules such as protein, lipid, carbohydrate, and nucleic acid. A functional variant of an aptamer refers to an aptamer that has been modified, with nucleotide derivates or otherwise, elongated or truncated, and still retains aptameric function.

[00116] The term “hybridizes”, “hybridized” or “hybridization” as used herein refers to the sequence specific non-covalent binding interaction with a complementary, or partially complementary, nucleic acid sequence. When, for example, the 5'-end region of an aptamer hybridizes to the 3'-end region, it can form a duplex DNA element.

[00117] The term “biosensor” as used herein refers to a device that incorporates a biological entity as a molecular recognition element and is capable of producing a measurable signal upon binding of a target analyte to the molecular recognition element. The biosensor can also be part of a larger device.

[00118] The term “binding region” as used herein refers to the portion of an aptamer that is capable of binding to a target, for example, a nucleic acid target. In some embodiments, the binding region comprises a nucleotide sequence selected form the group consisting of SEQ ID NOs: 34-135. This binding region can be selected from a library with random nucleotide domains that has aptamer-like structures, as disclosed in the present disclosure.

[00119] The term “working electrode” as used herein refers to an electrode in an electrochemical system on which the reaction of interest is occurring. The working electrode can be used in conjunction with a counter electrode in a two-electrode system, and further a reference electrode in a three-electrode system. The counter electrode, also called the auxiliary electrode, is an electrode used in, for example, a three-electrode electrochemical cell for voltammetric analysis or other reactions in which an electric current is expected to flow. The counter electrode can also be part of a two-electrode system. The counter electrode is distinct from the reference electrode, which establishes the electrical potential against which other potentials can be measured, and the working electrode, at which the cell reaction takes place. As such, a reference electrode has a stable and well-known electrode potential. Depending on whether the reaction on the

21

7595282 electrode is a reduction or an oxidation, the working electrode is called cathodic or anodic, respectively. Working electrodes can, for example, comprise materials ranging from inert metals such as gold, silver or platinum, to inert carbon such as glassy carbon, boron doped diamond or pyrolytic carbon, and mercury drop and fdm electrodes.

[00120] The term “functionalizing” or “functionalized on” as used herein refers to various common approaches for functionalizing a material, which can be classified as mechanical, physical, chemical and biological. Any suitable form of coupling may be utilized (e.g. coating, binding, etc.). The functionalized material, for example, an aptamer or a blocking species, is also immobilized.

[00121] Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below.

II. Aptamers. Biosensors Devices Kits and Methods of the Disclosure

[00122] Disclosed herein is an aptamer that binds to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) spike protein, comprising a 5 '-end region, a 3’ end region and a binding region, wherein the 5 ’-end region hybridizes to the 3'-end region, and wherein the binding region has a nucleotide sequence selected from the group consisting of SEQ ID NOs: 34-135, a functional fragment, or a functional variant thereof. In some embodiments, the aptamer comprises a sequence in Table 1, Table 3, Table 4, or Table 5. In some embodiments, the 5'-end region comprises SEQ ID NO: 2 and the 3'-end region comprises SEQ ID NO: 4. In some embodiments, the binding region comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 34-44, 83, 85, 134, and 135. In some embodiments, the aptamer comprises a nucleotide sequence selected form the group consisting of SEQ ID NOs: 6-20, 22-29, and 31-33. In some embodiments, the aptamer comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-15, 20, 21, and 33. In some embodiments, the aptamer comprises a nucleotide sequence selected form the group consisting of SEQ ID NOs: 6-15. In some embodiments, the aptamer comprises a nucleotide sequence of SEQ ID NO: 6, 8, or 10. In some embodiments, the aptamer comprises a nucleotide sequence of SEQ ID NO: 17 or 27.

22

7595282 [00123] Higher affinity of multimeric constructs, such as dimers having two binding regions, or multimers having three or more binding regions, of the selected aptamers for both the full-length trimeric spike protein and the intact virus, as well as variants thereof, is also disclosed herein. Accordingly, in some embodiments, the aptamer further comprises at least one additional binding region, wherein each additional binding region comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 34-135, a functional fragment, or a functional variant thereof. In some embodiments, the aptamer comprises a sequence selected from the group consisting of SEQ ID NOs: 6-20, 22-29, 31-34, 83, 85, 134 or 135. In some embodiments, each additional binding region comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 33-44, 83, 85, 134, and 135. In some embodiments, the binding region is flanked by a 5'-end region comprises SEQ ID NO: 2 and a 3'-end region comprises SEQ ID NO: 4. In some embodiments, the aptamer comprises the sequence of SEQ ID NO: 17 or 27. In some embodiments, the aptamer consists of SEQ ID NO: 17 or 27. In some embodiments, the aptamer comprises two binding regions. In some embodiments, any two binding regions are connected by a binding regions linker. In some embodiments, the binding regions linker comprises a natural or a synthetic nucleotide linker. In some embodiments, the binding regions linker comprises polythymidine. In some embodiments, the aptamer comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 142-144 and 150. In some embodiments, the aptamer consists of anucleotide sequence selected from the group consisting of SEQ ID NOs: 142-144 or 150. In some embodiments, the aptamer is a dimer. In some embodiments, the aptamer is multimer. In some embodiments, the aptamer binds to the SARS-CoV-2 spike protein with at least nanomolar affinity.

[00124] Also provided is a biosensor for detecting SARS-CoV-2 spike protein comprising an aptamer described herein functionalized on and/or in a material.

[00125] In some embodiments, the biosensor further comprises: a working electrode; a blocking species functionalized on the working electrode; a detection species, optionally comprised in a solution; and

23

7595282 a counter electrode; wherein the aptamer is functionalized on the working electrode; and wherein the working electrode is configured to provide a change in signal if the SARS-CoV-2 spike protein is present.

[00126] In some embodiments, the biosensor is on an electrochemical chip. In some embodiments, the biosensor comprises an electrochemical chip. In some embodiments, the biosensor comprises a multi-electrode electrochemical chip. In some embodiments, the biosensor further comprises a reference electrode. In some embodiments, the biosensor is for use in screening and/or diagnostics, environmental monitoring, health monitoring, and/or pharmaceutical development. In some embodiments, the biosensor is for use in screening, diagnostics, and/or health monitoring.

[00127] In some embodiments, the aptamer comprises at least two nucleotide sequences that bind to SARS-CoV-2 spike protein. In some embodiments, the aptamer comprises two nucleotide sequences that bind to SARS-CoV-2 spike protein. In some embodiments, the aptamer is a dimer.

[00128] In some embodiments, the aptamer comprises a sequence in Table 1, 3, 4, or 5. In some embodiments, the aptamer comprises a sequence selected from the group consisting of SEQ ID NOs: 34-135 and a 5'-end region and a 3'-end region, the 5'-end region and the 3'-end region comprising nucleotide sequences that hybridize to one another, or a functional fragment and/or functional modification thereof. In some embodiments, the aptamer comprises a sequence selected from the group consisting of SEQ ID NOs: 6-20, 22-29, 31-34, 83, 85, 134 or 135. In some embodiments, the aptamer consists of a sequence selected from the group consisting of SEQ ID NOs: 6- 20, 22-29, 31-34, 83, 85, 134 or 135. In some embodiments, the aptamer comprises the sequence of SEQ ID NOs: 17 or 27. In some embodiments, the aptamer consists of SEQ ID NO: 17 or 27. In some embodiments, the aptamer comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 142-144 or 150. In some embodiments, the aptamer consists of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 142-144 or 150.

24

7595282 [00129] The presence of a blocking species functionalized on the working electrode can increase the charge transfer resistance (R _et ) due to the presence of passivating materials blocking the surface diffusion of redox reagents in the measurement solution. In some embodiments, the blocking species comprises proteins, nucleic acids, sugars and/or synthetic polymers. In some embodiments, the blocking species comprises bovine serum albumin (BSA), fish sperm DNA, mercapto hexanol, polyethylene glycol (PEG), and polyadenylic acid (poly A). In some embodiments, the blocking species comprises polyethylene glycol (PEG).

[00130] In some embodiments, the aptamer further comprises a linker for coupling to the working electrode. In some embodiments, the blocking species further comprises a linker for coupling to the working electrode.

[00131] Functionalizing the electrode with the aptamer and/or blocking species can be done by any suitable technique, for example, as described in Putzbach, W., & Ronkainen, N. J. (2013). Immobilization techniques in the fabrication of nanomaterial- based electrochemical biosensors: A review. In Sensors ( Switzerland) (Vol. 13, Issue 4, pp. 4811-4840). MDPI AG. In some embodiments, functionalization of the electrode with the aptamer and/or blocking species is done via a linker.

[00132] In some embodiments, the aptamer is functionalized on the electrode via chemical bonding, an intermediate linker, or physical adsorption. In some embodiments, the blocking species are functionalized on the electrode via chemical bonding, an intermediate linker, or physical adsorption. In some embodiments, the linker for the aptamer and the linker for the blocking species comprise the same linker. In some embodiments, the aptamer and/or blocking species is directly linked to the working electrode. In some embodiments, the linker is a bifunctional linker comprising complementary reactive functional groups. Examples of reactive functional groups include, but are not limited to, thiol, amine, epoxy, carboxylic acid, azide, and alkyne. In some embodiments, the chemical bonding occurs via thiol and/or gold chemistry. In some embodiments, the linker comprises a thiol.

[00133] In some embodiments, the aptamer and/or blocking species is indirectly linked to the working electrode. In some embodiments, the linker is a biotin,

25

7595282 streptavidin, cystamine, or glutaraldehyde. In some embodiments, the aptamer and/or blocking species is linked to the working electrode via biotin-streptavidin interactions.

[00134] In some embodiments, the working electrode has a surface density of about 1.1 x 10 ¹⁴ to about 1.5 ^c 10 ¹⁴ aptamers per cm ² .

[00135] In some embodiments, the change in signal comprises a change in current, potential or impedance. In some embodiments, the change in signal is an increase in impedance if the SARS-CoV-2 spike protein is present. In some embodiments, the change in signal is a decrease in impedance if the SARS-CoV-2 spike protein is present. A detection species, for example, a redox species, is useful for electrochemical signal generation and detection. In some embodiments, the change in impedance is measured by charge transfer resistance of the solution comprising detection species. In some embodiments, the change in impedance is measured by double layer capacitance of the solution comprising detection species.

[00136] In some embodiments, the detection species comprise redox species. Examples of redox species include, but are not limited to, ruthenium hexamine chloride, methylene blue, methylene blue succinymide, methylene blue maleimide, Atto MB2 maleimide (Sigma Aldrich) and other methylene blue derivatives, ferrocene and Fe ²⁺ and/or Fe ³⁺ ions. In some embodiments, the redox species comprise Fe ²⁺ and/or Fe ³⁺ ions.

[00137] In some embodiments, the working electrode comprises a conductive material, semi-conductive material, or a combination thereof. In some embodiments, the working electrode comprises metal, metal alloy, metal oxide, superconductor, semi conductor, carbon-based material, conductive polymer, or combinations thereof. Examples include, but are not limited to, gold, platinum, palladium, carbon-based materials such as glassy carbon, graphite, graphene, or carbon nanotubes, nickel oxide, bismuth oxide, indium tin oxide, and titanium dioxide.

[00138] In some embodiments, the working electrode comprises metal. The metal can be selected from aluminum (Al), antimony (Sb), bismuth (Bi), boron (B), cadmium (Cd), carbon (C), cerium (Ce), chromium (Cr), cobalt (Co), copper (Cu), dysprosium (Dy), erbium (Er), europium (Eu), gadolinium (Gd), germanium (Ge), gold (Au), graphite (C), hafnium (Hf), holmium (Ho), indium (In), iridium (Ir), iron (Fe),

26

7595282 lanthanum (La), lutetium (Lu), magnesium (Mg), manganese (Mn), molybdenum (Mo), neodymium (Nd), nickel (Ni), niobium (Nb), palladium (Pd), platinum (Pt), praseodymium (Pr), rhenium (Re), ruthenium (Ru), samarium (Sm), selenium (Se), scandium (Sc), silver (Ag), silicon (Si), tantalum (Ta), terbium (Tb), thulium (Tm), tin (Sn), titanium (Ti), tungsten (W), vanadium (V), ytterbium (Yb), yttrium (Y), zirconium (Zr) and/or zinc (Zn). Typically, the metals are selected from gold, other noble metals, or combinations thereof.

[00139] In some embodiments, the working electrode comprises gold.

[00140] In some embodiments, the biosensor further comprises a reference electrode. In some embodiments, the counter electrode is also a reference electrode.

[00141] The electrodes can be made from any suitable method, for example, a seed layer for the nanostructured electrodes can be made by sputter-coating, evaporation, chemical vapor deposition, or a pulsed laser method, inkjet printing.

[00142] Also provided herein is a device comprising the biosensor described herein. In some embodiments, the device is a hand-held device. In some embodiments, the device is a hand-held electrical reader. In some embodiments, the biosensor or electrochemical chip disclosed herein are inserted into the reader. In some embodiments, the biosensor or device described herein is for use in screening and/or diagnostics, environmental monitoring, health monitoring, and/or pharmaceutical development.

[00143] In some embodiments, the biosensor or device described herein is for use in screening, diagnostics, and/or health monitoring. In some embodiments, the biosensor or device described herein is for use in detecting infection-causing pathogens in point-of-care diagnostics and health monitoring. In some embodiments, the biosensor or device described herein is for use in detecting SARS-CoV-2 infection and/or COVID-19. In some embodiments, the biosensor or device described herein can be used without the need for sample pre-treatment, target labeling, and/or amplification. In some embodiments, the biosensor or device described herein increases the accuracy and decreases the timeline for diagnosis.

[00144] Also provided is a method for detecting the presence of SARS-CoV-2 spike protein in a sample, the method comprising:

27

7595282 a) contacting the working electrode of a biosensor described herein with the sample; b) contacting the working electrode from step a) with the detection species of the biosensor described herein; and c) detecting a change in signal; wherein detecting a change in signal indicates the presence of the SARS- CoV-2 spike protein in the sample.

[00145] In some embodiments, the working electrode or biosensor is exposed to the sample under conditions for binding the aptamer to the SARS-CoV-2 spike protein. In some embodiments, the change in signal comprises a change in current, potential or impedance. In some embodiments, the change in signal is an increase in impedance if the SARS-CoV-2 spike protein is present. In some embodiments, the change in impedance is measured by charge transfer resistance or double layer capacitance of the solution comprising detection species. In some embodiments, the method further comprises diluting the sample in buffer before step a). In some embodiments, the contacting the working electrode of the biosensor with the sample in step a) comprises incubating the working electrode with the sample for about 5 minutes.

[00146] In some embodiments, the method further comprises washing the biosensor before step b). In some embodiments, washing the biosensor removes non- specifically bound and/or unbound non-target species from the working electrode. In some embodiments, washing the biosensor decreases interference from non-target species. In some embodiments, washing the biosensor is performed for about 1 minute.

[00147] In some embodiments, a change in signal is detected within 10 minutes of step a). In some embodiments, a change in signal is detected within 3 minutes of step b). In some embodiments, detecting a change in signal is performed for about 3 minutes. In some embodiments, the sample is a saliva sample. In some embodiments, the method detects SARS-CoV-2 infection in a subject. In some embodiments, the method detects COVID-19 in a subject. In some embodiments, the method further comprises a method of diagnosing SARS-CoV-2 infection and/or COVID-19 in a subject. In some embodiments, the method further comprises a method of treating SARS-CoV-2 infection and/or COVID-19 in a subject. In some embodiments, the method further comprises

28

7595282 testing the sample for SARS-CoV-2 RNA using an amplification-based method. In some embodiments, the amplification-based method is polymerase chain reaction (PCR).

[00148] In some embodiments, the SARS-CoV-2 spike protein is detected at about sub-nanomolar concentration. In some embodiments, the SARS-CoV-2 spike protein is detected at about picomolar concentration. In some embodiments, the SARS- CoV-2 spike protein is detected at about femtomolar concentration.

[00149] In some embodiments, the buffer provides conditions for binding the aptamer to the target analyte. In some embodiments, the method can be performed without the need for sample pre-treatment, target labeling, and/or amplification. In some embodiments, the method increases the accuracy and decreases the timeline for diagnosis.

[00150] In some embodiments, the method detects COVID-19 in a subject. In some embodiments, the method further comprises a method of diagnosing SARS-CoV- 2 infection and/or COVID-19 infection in a subject. In some embodiments, the method further comprises treating SARS-CoV-2 infection and/or COVID-19 infection in a subject.

[00151] In some embodiments, the method further comprises testing the sample for SARS-CoV-2 RNA using an amplification-based method. In some embodiments, the amplification-based method is polymerase chain reaction (PCR).

[00152] Also provided is a kit for detecting SARS-CoV-2 spike protein in a sample, wherein the kit comprises a biosensor described herein, a device described herein, or components required for a method described herein, and instructions for use of the kit. In some embodiments, the kit further comprises reagents and/or solutions, such as buffers, to provide conditions for binding the aptamer to the SARS-CoV-2 spike protein. In some embodiments, the kit further comprises a sample collection device, such as a swab and container.

[00153] Also provided herein is use of the biosensor, the device or the kit disclosed herein, to determine the presence of a target analyte. In some embodiments, the target analyte comprises SARS-CoV-2 spike protein.

29

7595282 [00154] In some embodiments, an electrochemical impedance-based readout is utilized as this provides a rapid, single-step detection method with high detection sensitivity using simple handheld instrumentation that can be scaled up for widespread use, making it ideally suited for developing rapid COVID-19 tests for use at home or in congregate settings. The biosensor or device of the present disclosure has been confirmed as a rapid test. The rapid test is denoted as the Cov-eChip, and has been evaluated with the spike proteins of both the original Wuhan SARS-CoV-2 and the B.1.1.17 variant of concern (UK variant), and has been validated using a large number (>70) of clinical saliva samples, demonstrating performance exceeding any currently reported rapid test. In some embodiments, the biosensor or device is for use in a rapid test. In some embodiments, the rapid test is Cov-eChip. In some embodiments, the rapid test detects Wuhan SARS-CoV-2 or UK variant. In some embodiments, the Cov-eChip detects Wuhan SARS-CoV-2 or UK variant.

[00155] Also disclosed herein is the selection of DNA aptamers against the wild- type monomeric SI spike protein subdomain from a pre-structured random DNA library using a combination of magnetic bead-based SELEX (systematic evolution of ligands by exponential enrichment) and electrophoretic mobility shift assays (EMSA). High-affinity molecular recognition elements (MREs) for SARS-CoV-2 were generated through in vitro selection experiments performed to identify DNA aptamers for the SI subunit of the spike protein of SARS-CoV-2 (SI protein). Using a pool containing ~6 x 10 ¹⁴ pre structured random single-stranded DNA sequences, over 100 candidate aptamers were obtained after 13 cycles of enrichment under progressively more stringent selection pressure.

[00156] Analysis of the affinity of the top 10 candidates indicated that all exhibited strong binding to the SI protein. The optimization of three exemplary high affinity aptamers using truncation analysis to yield minimal sequences with nanomolar affinity for the SI protein, and their performance for detection of SI protein, full trimeric spike protein and spike protein pseudotyped lentivirus both in buffer and diluted saliva is also disclosed. A simple saliva-based test for SARS-CoV-2 using the optimal S 1 protein binding aptamer is also demonstrated.

[00157] Accordingly, also provided is a method of identifying or producing an aptamer capable of binding to a target analyte, the method comprising:

30

7595282 a) providing a plurality of nucleic acid molecules comprising at least one random nucleotide domain flanked by a 5'-end region and a 3'-end region, wherein the 5'-end region hybridizes to the 3'-end region to form a duplex DNA element, and wherein the random nucleotide domain comprises an aptamer-like structures; b) annealing the plurality of nucleic acid molecules to allow formation of secondary structures; c) contacting the plurality of nucleic acid molecules with the target analyte; d) collecting nucleic acid molecules which have bound to the target analyte; and amplifying the nucleic acid molecules from step d) to yield a mixture of nucleic acid molecules enriched in nucleotide sequences that are capable of binding to the target analyte.

[00158] In some embodiments, the 5 '-end region comprises a forward primer binding site and the 3 '-end region comprises a reverse primer binding site for amplifying the nucleic acid molecules by polymerase chain reaction (PCR). In some embodiments, step c) comprises incubating the plurality of nucleic acid molecules with the target analyte in solution. In some embodiments, the method further comprises immobilizing the target analyte on a solid support before step c). In some embodiments, step d) comprises separating the nucleic acid molecules which have bound to the target analyte from unbound nucleic acid molecules. In some embodiments, the 5'-end region comprises SEQ ID NO: 2 and the 3'-end region comprises SEQ ID NO: 4, which hybridize to form a duplex DNA element. In some embodiments, the target analyte is a microorganism, a virus, and/or a molecule present on a microorganism or a virus. In some embodiments, in the target analyte is SARS-CoV-2 spike protein.

EXAMPLES

[00159] The following non-limiting Examples are illustrative of the present disclosure:

31

7595282 Example 1: Selection of DNA ap tamers against SARS-CoV-2 SI subunit of spike protein (SI protein)

[00160] Materials and Methods

[00161] Chemicals and reagents. DNA oligonucleotides were ordered from Integrated DNA Technologies (IDT) and purified by 10% (w/v) denaturing polyacrylamide gel electrophoresis with 8 M urea (dPAGE) before use. The sequences of the oligonucleotides used herein are listed in Table 1. Taq DNA polymerase was purchased from GenScript. The Wuhan SARS-Cov-2 spike protein subunit SI (catalog number: 40591-V08B1) was purchased from Sino Biological Inc. 4-(2 -hydroxy ethyl)- 1-piperazineethanesulfonic acid (HEPES), sodium chloride (NaCl), magnesium chloride (MgCh), sodium phosphate dibasic (Na2HP04), potassium phosphate monobasic (KH2PO4), potassium chloride (KC1), Tween-20, and all other chemicals were purchased from Sigma-Aldrich (Oakville, Canada) and used without further purification. Milli-Q water was used for all experiments.

[00162] Conjugation of SI protein to magnetic beads. HisPur Ni-NTA magnetic beads (16 pL, 5% w/v, 12.5 mg/mL) were first washed once with PBST buffer (0.5 mL, 1.8 mM KH2PO4, 10 mM Na ₂ HP0 ₄ , 2.7 mM KC1, 137 mM NaCl, 0.01% v/v Tween- 20). Magnetic beads pellets were then resuspended in 5* PBST buffer (40 pL). Imidazole (4 pL, 1 M), SI protein with His-tag (100 pL, 0.5 mg/mL) and water (60 pL) were mixed with magnetic beads and incubated at 4 °C for 12 h. Afterward, Sl- conjugated magnetic beads (20 pL) were washed twice with PBST and resuspended in PBST buffer with 200 mM imidazole. The free SI protein in the first wash fraction was collected. After heating at 90 °C for 10 min, SI -conjugated magnetic beads were pelleted by a magnet, and the SI protein in the supernatant was collected as the SI protein bound on magnetic beads. The free and bound SI proteins were analyzed by SDS PAGE. The SI protein bound on magnetic beads was determined to be 0.147 mg/mL. The SI protein-conjugated magnetic beads (1 mg/mL magnetic beads and 0.147 mg/mL SI protein) were stored at 4 °C and kept away from light before use.

[00163] Selection of DNA aptamers for SI proteins. The SELEX processes were carried out by a combination of magnetic bead-based and native gel-based methods. Briefly, the DNA library was diluted with Selection buffer (lx SB; 50 mM HEPES, 6

32

7595282 mM KC1, 150 mMNaCl, 2.5 mM CaCh, 2.5 mM MgCb, 0.01% v/v Tween-20, pH 7.4) and heated at 90 °C for 1 min, followed by annealing at room temperature for 10 min. Then, the SI protein-conjugated magnetic beads were washed twice with lx SB and mixed with the DNA library at 23 °C for 30 min. After washing three times with 1 x SB (1 mL), the magnetic beads were resuspended with 1 ^c Taq buffer (200 pL, 50 mM KC1, 10 mM Tris-HCl, 1.5 mM MgCh, 1% v/v Triton X-100, pH 9.0) and heated at 90 °C for 10 min. The DNA in the supernatant was collected, followed by the addition of the reverse primer RP1 (10 pL, 10 pM), the forward primer FP1 (10 pL, 10 pM), Taq DNA polymerase (2 pL, 5 U/pL), and dNTPs (20 pL, 2 mM) for PCR1. PCR1 was carried out using the following temperature profile: preheating at 94 °C for 30 s; thermo cycles of 94 °C for 30 s, 50°C for 30 s, and 72 °C for 30 s; annealing at 72 °C for 5 min. Next, the PCR1 product was used as the template for PCR2. The PCR2 mixture was prepared by mixing the PCR1 product (50 uL), FP1 (25 pL, 10 pM), RP2 (25 pL, 10 pM), 10x Taq buffer (50 uL), Taq DNA polymerase (5 pL, 5 U/pL), dNTPs (10 pL, 10 mM), and water (335 uL). The amplification reaction used the same temperature profile as PCR1. After amplification, the PCR2 product was pelleted by ethanol precipitation. Briefly, the PCR2 product (500 pL), NaOAc buffer (50 pL, 3 M, pH 5.2) and ethanol (1.25 mL, -20 °C) were mixed and placed at -20 °C for 10 min. The PCR2 product was pelleted by centrifugation at 12,000 g for 10 min. The pellet was washed once by 70% v/v ethanol (1 mL, -20 °C) after discarding the supernatant. Finally, the aptamer coding strand was purified by dPAGE. The gel band containing the DNA was visualized by the UV shadow method, cut out, and then eluted using elution buffer (500 uL, 200 mM NaCl, 10 mM Tris, 1 mM EDTA, pH 7.5). The DNA was further concentrated by ethanol precipitation as described above. The purified DNA was quantified by UV-Vis absorbance at 260 nm and utilized for the next round of selection. A total of 3 rounds of magnetic bead-based SELEX was carried out.

[00164] Next, the native gel-based selection was employed to further enrich the DNA library. The purified PCR2 product from round 3 above was dissolved with lx SB (10 pL) and heated at 90 °C for 1 min, followed by annealing at room temperature for 10 min. Then, free SI protein in lx SB (10 pL) was introduced and incubated at 23 °C for 30 min. The DNA-protein complex was separated from unbound DNA by 10% (v/v) native PAGE, which was analyzed by phosphoimaging (Typhoon™ FLA

33

7595282 9500, GE Healthcare, USA). Afterward, the DNA was eluted from the gel with 1 ^c Taq buffer (200 pL) by incubation at 23 °C for 20 min. The DNA in the supernatant was collected, followed by the addition of RP1 (10 pL, 10 mM), FP1 (10 pL, 10 pM), Taq DNA polymerase (2 pL, 5 U/pL), and dNTP (20 pL, 2 mM) for PCR1. This was followed by PCR2 using the primer set FP1 and RP2 as described above. Finally, the PCR2 products were purified by dPAGE and utilized for the next round of SELEX. A total of 10 rounds of gel -based SELEX was carried out. Selected DNA libraries were amplified by PCR using primers with sequencing tags and then analyzed using the MiSeq (Illumina) sequencing platform using previously published protocols (20).

[00165] Results and Discussion

[00166] A library of ~6 x 10 ¹⁴ DNA molecules with 40 nucleotides in the random domain was used for the aptamer selection (the sequences of all synthetic oligonucleotides are provided in Table 1). In addition to the 40-nt (nt: nucleotide) random region, the two flanking constant regions were designed such that they would create a stable pairing element (named PI; FIG. 1A). This was made for two reasons. First, many known DNA aptamers adopt hairpin structures (21-24), and therefore, this design might populate the library with many aptamer-like structures, which could work to enhance the chance of finding diverse, high-affinity DNA aptamers. Second, engaging the two constant-regions into a predefined pairing element could help prevent them from playing an important role in the recognition of S 1 protein. Ultimately this will simplify the task of establishing secondary structures and minimizing the sizes of selected aptamers.

[00167] A combination of a magnetic bead-based (for the first 3 rounds) and

EMSA (electrophoretic mobility shift assay )-based (for the subsequent 10 rounds) selection methods were used to derive the S 1 protein binding aptamers from the DNA library. For bead-based selection (FIG. 2A), the histidine tag-containing SI protein was conjugated on nickel-nitrilotriacetic acid (Ni-NTA) modified magnetic beads, which were then incubated with the DNA library. The unbound sequences were removed, followed by washes with binding buffer. The bead-bound sequences were eluted, and amplified by PCR to regenerate an enriched pool using a previously published protocol

(25, 26). For EMSA-based selection (FIG. 2B), free SI protein was first incubated with the DNA pool, followed by separation of the SI -DNA complexes from the unbound

34

7595282 DNA using native polyacrylamide gel electrophoresis. After elution from the gel, the bound DNA was amplified by PCR to make a new pool for the next round of selection.

[00168] Two PCR steps were conducted for each round, the first with the primer set of FP1 and RP1 and the second with that of FP1 and RP2 (FIG. IB). RP2 contained the sequence of RP1 linked to 20 thymidines via a non-amplifiable, 18-atom hexa- ethylene glycol spacer (iSP18), and therefore, the non-aptameric strand within the double-stranded DNA product from PCR2 is longer than the aptameric strand by 20 nucleotides. This arrangement facilitated the separation of the aptameric strands by denaturing (8 M urea) gel electrophoresis (dPAGE), a strategy that has been successfully used in many previous selection experiments conducted (25, 26).

[00169] The selection pressure was gradually increased by decreasing the library and protein concentrations (Table 2). Specifically, for the bead-based selection (rounds 1-3), the concentration of the DNA pool was reduced from 50 mM in round 1, to 2 mM in round 2, and 220 nM in round 3. Similarly, the concentration of the SI protein was reduced from 3.2 mM in round 1, to 1.6 mM in round 2, and to 800 nM in round 3. After switching to the gel-based selection (rounds 4-13), the DNA concentration in round 4 was set at 1 mM, but reduced to 500 nM in round 5, 250 nM in round 6, and 50 nM for the rest. The protein concentration was used at 3.3 mM in rounds 4-6, then reduced to 1.32 mM in round 6, 660 nM in round 6, and 160 nM for the remaining rounds.

[00170] The original DNA library (Pool 0) was assessed, as well as the 5 ^th , 7 ^th , 9 ^th , 10 ^th , 11 ^th and 13 ^th pools for binding to the SI protein by EMSA. The data presented in FIG. 3 confirmed that the selection was successful. There was a significant increase in the SI protein binding activity from the 7 ^th pool to the 9 ^th pool. Strong binding activity was also observed for the later pools but the level of binding did not increase significantly (FIG. 3).

[00171] High-throughput sequencing was then conducted with Pool 13 using a previously described protocol (20). Many sequences were discovered; the top 10 ranked sequences are provided in FIG. 4B; the top 100 sequences are listed in Table 3. The aptamers are named MSAX where MSA stands for Monomeric Spike-binding DNA Aptamer and X is the numeral that represents the ranking of an aptamer. For example, MSA1 and MSA5 refer to the top-ranked and 5 ^th -ranked DNA aptamer in the 13 ^th pool.

35

7595282 Example 2: Aptamer binding affinity and specificity for spike protein

[00172] Materials and Methods

[00173] Chemicals and reagents. The Wuhan SARS-Cov-2 spike protein subunit SI (catalog number: 40591-V08B1) and RBD (catalog number: 40592-V08B) was purchased from Sino Biological Inc. The SARS-CoV-2 full spike protein (molecular weight 140 kDa; plasmid encoding the mammalian cell codon optimized sequence for SARS-CoV-2 full length spike protein was generously gifted from the lab of Dr. Florian Krammer, Ichan School of Medicine (27)). In brief, proteins were produced in Expi293 cells (ThermoFisher Scientific) using the manufacturers’ instructions. When culture viability reached 40%, supernatants were collected and spun at 500 g for 5 minutes. The supernatant was then incubated with 1 ml of Ni-NTA agarose (Qiagen) per 25 ml of transfected cell supernatant overnight, with shaking, at 4 °C. The following day 10 ml polypropylene gravity flow columns (Qiagen) were used to elute the protein. Spike proteins were concentrated in 50 kDa Amicon centrifugal units (Millipore) prior to being resuspended in phosphate buffered saline (PBS). The full spike protein for the UK B.1.1.7 variant (UKS, catalog number: SPN-C52H6) was obtained from Aero Biosystems. The SARS-CoV-1 full spike protein (SARSl-S, catalog number: 100789- 1) was purchased from BPS Bioscience Inc. The SARS-CoV-1 RBD (molecular weight: 30 kDa), MERS-CoV RBD (38 kDa) and HCoV-229E RBD (28 kDa) were provided by the Miller lab at McMaster University. The RBD proteins were generated in Expi293 cells and contained C-terminal His-tag for purification. The pooled human saliva (Lot 31887) was purchased from Innovative Research Inc (Novi, Michigan). Nitrocellulose blotting membranes (catalog No. 10600125) were purchased from GE Healthcare Inc. Nylon hybridization transfer membranes (NEF994001PK) were purchased from PerkinElmer Inc (Woodbridge, ON, Canada). Pierce™ streptavidin coated plates, streptavidin-conjugated HRP (Invitrogen™, catalog No. 19534-050), 1- Step™ Ultra TMB-ELISA Substrate Solution (Lot VL3152681), Ni-NTA magnetic agarose beads, T4 DNA ligase, T4 polynucleotide kinase (PNK), adenosine triphosphate (ATP), and deoxyribonucleoside 5 '-triphosphates (dNTPs) were purchased from Thermo Scientific (Ottawa, ON, Canada). g-[ ³² R]-ATR was acquired from PerkinElmer. Bovine serum albumin (BSA), human thrombin and IgG from human serum were purchased from Sigma-Aldrich (Oakville, Canada). 4-(2-

36

7595282 hydroxyethyl)-l-piperazineethanesulfonic acid (HEPES), sodium chloride (NaCl), magnesium chloride (MgCh), sodium phosphate dibasic (NazHPCri), potassium phosphate monobasic (KH ₂ PO ₄ ), potassium chloride (KC1), Tween-20, and all other chemicals were purchased from Sigma-Aldrich (Oakville, Canada) and used without further purification. Milli-Q water was used for all experiments.

[00174] Phosphorylation ofDNA Aptamers. DNA aptamers were labeled with g- [ ³² P] ATP at the 5 '-end using PNK reactions according to the manufacturer's protocol. Briefly, 2 pL of 1 mM DNA aptamers were mixed with 2 pL g-[ ³² R] ATP, 1 pL of 10x PNK reaction buffer A, 1 pL PNK and 4 pL water. The mixture was incubated at 37 °C for 20 min, then purified by 10% dPAGE.

[00175] Dot-blot Binding Assays. Dot-blot assays were performed using a Whatman Minifold- 1 96 well apparatus linked to a vacuum pump. Before experiments, nitrocellulose membranes and nylon membranes were incubated in lx SB (50 mM HEPES, pH 7.4, 150 mM NaCl, 6 mM KC1, 2.5 mM MgCh, 2.5 mM CaCh, 0.01% Tween-20) for 1 h. The g-[ ³² R] labeled DNA aptamer (4 pL, 10 nM) was dissolved in 196 pL of 1 x SB and heated at 90 °C for 5 min, then cooled at room temperature for 20 min. The protein partner was dissolved and diluted in the same buffer. 5 pL of the aptamer solution was mixed with 15 pL of the protein solution with different concentrations (0-500 nM). The mixture was incubated at room temperature for 1 h. The dot-blot apparatus was assembled with a nitrocellulose membrane on the top, a nylon membrane in the middle, and a wetted Whatman paper at the bottom. After washing each well with 100 pL of lx SB, the DNA-protein mixtures were loaded and drained by the vacuum pump (force: 550 mmHg for 8 seconds). The wells were then washed twice with 100 pL of 1 x SB. The radioactivity in the membrane was measured via phosphor storage and a Typhoon 9200 imager (GE Healthcare) and analyzed using Image J software (Molecular Dynamics). The binding between aptamers and pseudotyped or control viruses was performed similarly using the same method except for the viral concentrations (0-500 pM) and incubation time (20 min). The dot blot experiments with saliva samples were also done similarly. Each binding assay was performed 3 times. For the specificity test, each protein was used at 50 nM. The binding assay in saliva was performed similarly.

37

7595282 [00176] The bound fraction (membrane-bound fraction) was quantified and ploted against the concentration of the protein. The KA values were derived via curve fiting using Origin 8.0 using the equation Y = B _max X/(¾ + X) (Y is the bound fraction of aptamer with protein, B _max is the maximum bound fraction of aptamer, and X is protein concentration).

[00177] Results and Discussion

[00178] Assessment of binding affinity of the top 10 aptamers for SI protein. The standard dot blot assay was used to assess the binding affinity of the selected aptamers, a technique that has been widely used to determine the affinity of protein binding aptamers (28, 29). Two representative dot blots of MSA1 and MSA5 are provided in FIG. 5A. The data was then used to derive the dissociation constant (¾) for each aptamer (FIG. 5B). These analyses were carried for all of the top 10 aptamers and their KA values are provided in FIG. 4B. Using this assay, all the aptamers showed binding to SI protein, although their KA values varied substantially: MSA1, MSA3 and MSA5 represent the three best aptamers, with KA values of 1.8 nM, 1.9 nM and 2.7 nM respectively. These KA values are lower than other reported RBD-binding or SI protein binding DNA aptamers (Table 4), indicating the MSA aptamers have higher affinities, though it is noted that a recently reported bivalent RBD-binding circular DNA aptamer has a reported KA of 0.13 nM (18). MSA7 and MSA10 are the two lowest-binding aptamers, with the KA values around 100 nM. The other top 5 aptamers have KA values in the range from ~10 - 40 nM, which are similar to most of the previously reported aptamers.

[00179] Assessment of binding affinity of MSA1 and MSA5 for the full spike protein. The aptamers disclosed herein were selected to bind the SI subunit of SARS- CoV-2 spike protein. However, the full spike protein is a trimer, with each subunit consisting of a heterodimer containing a S 1 and S2 domain covalently linked to each other (30), and thus the binding of aptamers to the trimeric spike proteins of SARS- CoV-2 was also tested. As the trimeric spike proteins are densely glycosylated proteins (31), it is functionally important that the aptamers be able to recognize the trimeric S complex.

38

7595282 [00180] For these experiments it was decided to move forward with the MSA1 and MSA5 aptamers, as exemplary aptamers from the selection with high affinity for the SI protein. MSA1 was chosen both for its top ranking and high affinity; MSA5 was picked for its high affinity and its G-rich sequence property, which is a common motif for many reported DNA aptamers. The dot blot assays shown in FIG. 5C demonstrate that both MSA1 and MSA5 still exhibit strong binding to the trimeric S-protein complex, w ith K _d values of 19.8 nM and 5.6 nM, respectively (FIG. 5D). The decrease in affinity can be due to the structural differences between the monomeric SI and the trimeric S complex as well as the glycosylation of the trimeric S complex.

[00181] Assessment of binding affinity ofMSAl and MSA5 for the RBD of the spike protein. To determine if the featured aptamers MSA1 and MSA5 would also bind to the RBD of the spike protein, given they were selected using the RBD-containing SI protein, dot blot assays for RBD were also performed. The dot blot assays shown in FIG. 6 indicate that MSA1 and MSA5 still recognize the RBD with high affinity, as reflected by the Kd values (3.1 and 4.0 nM, respectively), which are only slightly higher than their K values for the SI protein (1.8 and 2.7 nM, respectively).

[00182] Selectivity Assessment of MSA1 and MSA5. The specificity of MSA1 and MSA5 were next tested by evaluating their binding to the following four proteins: bovine serum albumin (BSA), human a-thrombin (Tb), human immunoglobulin G (IgG) and RNase H2 of Clostridium difficile (CD-RNase H2). BSA is commonly used as a control protein to test the specificity of aptamers. IgG is an important antibody present in human blood and saliva. Human a-thrombin was chosen as a control protein because it has been widely used in aptamer studies due to the existence of a high-affinity DNA aptamer that specifically recognizes this human protein (32, 33). CD-RNase H2 was chosen to represent a nucleic acid binding protein to assess potential non-specific binding to nucleases and other DNA-binding proteins potentially present in blood or saliva.

[00183] FIG. 7A shows dot blot assay data for both MSA1 and MSA5 binding to these proteins, along with the use of the SI protein as the positive control and binding buffer as the no-protein control. The data indicate that none of the four control proteins showed detectable binding to either aptamer, indicating that both MSA1 and MSA5

39

7595282 recognize SI protein highly specifically and that the common human proteins in biological fluids or proteins with intrinsic nucleic acid binding properties do not interact with the aptamers.

[00184] Using the dot blot assay, the binding of MSA1 and MSA5 was also tested with an additional four relevant proteins, including the RBD and the spike protein of SARS-CoV-1, the RBD of Middle East Respiratory Syndrome (MERS) and the RBD of Coronavirus HCoV-229E, a seasonal human coronavirus; the data are provided in FIG. 8. MSA1 shows weak binding to the spike protein of SARS-CoV-1 and the RBD of MERS (FIG. 8A), whereas MSA5 did not recognize any of these control proteins (FIG. 8B). However, the binding affinity of MSA1 for the spike protein of SARS-CoV- 1 and the RBD of MERS was very poor, with KA values greater than 150 nM and 100 nM, respectively (FIG. 9). Given that both SARS-CoV-1 and MERS are no longer in circulation and that the aptamer does not recognize HCoV-229E, MSA1 and MSA5 show sufficient selectivity for SARS-CoV-2.

[00185] Binding of SI protein by MSA 1 and MSA5 in human saliva. One of the uses for these aptamers is to detect SARS-CoV-2 in saliva specimens, which could allow self-sample collection to make testing for SARS-CoV-2 easier. To examine their functionality in human saliva, MSA1 and MSA5 were tested for binding to the SI protein spiked into 50% pooled human saliva (diluted with binding buffer) using dot blot assays (FIG. 7B). Both aptamers performed well in 50% saliva, producing similar KA values in saliva (FIG. 7C) relative to binding buffer (FIG. 5B).

[00186] Human saliva represents a very complex biological fluid, which contains a variety of proteins including digestive enzymes and nucleic acid binding proteins, as well as polysaccharides, mucus and electrolytes (34, 35). The full functionality of MSA1 and MSA5 towards SI protein in saliva confirms the high selectivity of the aptamers and points to the potential utility of using these aptamers for SARS-CoV-2 diagnostics.

[00187] Binding of the spike protein of the UK variant by MSA 1 andMSA5. The spike protein of coronavirus es, particularly their receptor binding domains (RBDs), are known to mutate frequently (36). Several variants of concerns of SARS-CoV-2 have emerged, among which is the B.1.1.7 variant that emerged in the United Kingdom (UK)

40

7595282 and was first reported in September 2020 (37). It is also known as 501Y.V1 and has a N501Y mutation in the RBD. The B.1.1.7 variant has now spread globally and in some countries, such as Canada, it has become the domain SARS-CoV-2 virus in circulation.

[00188] To determine if MSA1 and MSA5 could still recognize the mutated spike protein of the B.1.1.7 variant, dot blot assays were performed to compare the binding of MSA1 (FIG. 10A) and MSA5 (FIG. 10B) to the trimeric S protein of both the wild-type Wuhan virus (WHS) and B.l.1.7 variant (UKS). Interestingly, as seen in FIG. 11 A, the MSA1 aptamer showed significantly higher affinity for the UKS (KA of 1.2 nM) than the WHS (KA of 19.8 nM). MSA5 exhibited nearly identical KA values for the trimeric S protein of both the wild-type and B.l.1.7 variants (FIG. 1 IB). While the binding of MSA5 was not affected by the N501Y mutation, the MSA1 aptamer bound with 16-fold higher affinity to the UK variant with the N501Y mutation, indicating that this mutation is within the binding domain for MSA1. This observation also shows that it is possible for an aptamer to show stronger binding to a mutant, even though it was not the target used for selection.

Example 3: Binding of a pseudotyped SARS-CoV-2 lentivirus and heat- treated SI protein

[00189] Materials and Methods

[00190] Chemicals and reagents. Pseudotyped virus of SARS-CoV-2 (reagents were obtained through BEI resources, NIAID, NIH: SARS-Related Coronavirus 2, Wuhan-Hu-1 Spike-Pseudotyped Lentiviral Kit, NR-52948) were provided by the Miller lab at McMaster University. The viral concentration was determined by infecting the 293T-ACE2 cells (BEI NR-52511) with lentiviral particles carrying the luciferase gene and pseudotyped with the SARS-CoV-2 spike essentially as described by Crawford et al (38). In brief, HEK293T cells were seeded in 15 cm dishes at 1.1 x 10 ⁷ cells/mL in 15 mL of standard Dulbecco’s Modified Eagle Medium (DMEM). 16 - 24 hours post seeding, cells were co-transfected with HDM-nCoV-Spike-IDTopt-ALAYT (BEI catalog number NR-52515), pHAGE-CMV-Luc2-IRES-ZsGreen-W (BEI catalog number NR-52516), HDM-Hgpm2 (BEI catalog number NR-52517) HDM-tatlb (BEI catalog number NR-52518) and pRC-CMV-Revlb (BEI catalog NR-52519). 18 - 24 h post-transfection the media was replaced with full DMEM and 60 h post transfection,

41

7595282 the supernatant was collected and fdtered with a 0.45 pm fdter and stored at -80 DC until future use. For purification, 40 mL of supernatant was concentrated by spinning at 19,400 rpmfor 2h. The resulting pellet was resuspended in 400 pi of FIBS S, followed by 15 min of continuous vortexing at room temperature. The expressed luciferase was measured by the bicinchoninic acid (BCA) assay and used to determine the viral concentrations. 4-(2-hydroxyethyl)-l-piperazineethanesulfonic acid (HEPES), sodium chloride (NaCl), magnesium chloride (MgCh), sodium phosphate dibasic (NazHPCri), potassium phosphate monobasic (KH2PO4), potassium chloride (KC1), Tween-20, and all other chemicals were purchased from Sigma- Aldrich (Oakville, Canada) and used without further purification. Milli-Q water was used for all experiments.

[00191] Results and Discussion

[00192] Binding of a pseudotyped SARS-CoV-2 lentivirus by MSA1 and MSA5.

MSA1 and MSA5 were tested for binding to a pseudotyped SARS-CoV-2 lentivirus. Specifically, a pseudotyped lentivirus (PV) that was engineered to display the full trimeric S-protein of SARS-CoV-2 within the viral envelope was used (38-40). The surface of this virus resembles that of SARS-CoV-2; it can enter human cells but cannot replicate itself, allowing for its use in biosafety-level-2 labs as a model virus (38). The same lentivirus that lacks the S-protein was used as a control virus (CV) for this experiment.

[00193] Dot blot assays were performed with both the PV (FIG. 12A) and the CV (FIG. 12B) for MSA1 and MSA5, and the binding data is presented in FIG. 11C. Both MSA1 and MSA5 were found to recognize the PV (FIG. 12A) but not the CV (FIG. 12B). The KA values were determined to be 22.7 pM and 11.8 pM, respectively, for MSA1 and MSA5 (FIG. 11C). The increased affinity in comparison to the purified SI protein can be justified by the fact that each viral particle carries many copies of the S-protein. Although the copy number of the spike protein on the surface of the SARS- CoV-2 viruses has been reported to be ~30 (41, 42), the copy number on the viral particles of the PV has not been reported. However, if it is assumed that each PV virus carries 100 copies of the S-protein, the protein-equivalent KA values for MSA1 and MSA5 are estimated to be 2.3 nM and 1.2 nM, which are close to the KA values for the SI protein (1.8 nM and 2.7 nM, respectively). Importantly, both MSA1 and MSA5 can

42

7595282 recognize fully functional spike proteins of SARS-CoV-2, even though they were selected using purified S 1 protein.

[00194] Binding of MSA1 and MSA5 to heat-treated SI protein and the pseudotyped SARS-CoV-2 virus. Working with either SARS-CoV-2 viruses or patient clinical samples containing SARS-CoV-2 poses a high risk of acquiring infection for health care providers and research personnel. One simple way to deactivate the virus is to use heat. For example, many viruses can be simply deactivated at 60 °C for 30 min, 65 °C for 15 min or 80 °C for 1 min (43). It has been reported that heat treatment for 5 min at temperatures above 65 °C can completely deactivate SARS-CoV-2 viruses (44). Based on these observations, heat deactivation of the clinical samples before testing can effectively avoid infection during the assay. However, it is also possible that heat deactivation can significantly affect the integrity of the spike protein of SARS- CoV-2, resulting in the loss of antigenicity of the virus. For example, heat inactivation for immunoanalysis of antibodies to SARS-CoV-2 is not recommended due to the possibility of false-negative results when the serum samples were pre-inactivated at 56 °C for 30 minutes (45).

[00195] Evaluation of aptamer binding to both the SI protein and PV was assessed after each of these samples was heated at 65 °C for 60 min. Surprisingly, both MSA1 and MSA5 maintained nearly full binding activity to both the SI protein PV following heat treatment (FIG. 13). This observation shows that the spike protein is thermally stable and implies that both MSA1 and MSA5 are compatible with a safe test protocol for SARS-CoV-2 detection that involves a viral deactivation step at 65 °C.

Example 4: Colorimetric assay for viral detection in saliva [00196] Materials and Methods

[00197] Pierce™ streptavidin coated plates, streptavidin-conjugated HRP

(Invitrogen™, catalogNo. 19534-050), 1 -Step™ Ultra TMB-ELIS A Substrate Solution (Lot VL3152681) and Ni-NTA magnetic agarose beads were purchased from Thermo Scientific (Ottawa, ON, Canada). 4-(2-hydroxyethyl)-l-piperazineethanesulfonic acid (HEPES), sodium chloride (NaCl), magnesium chloride (MgCb), sodium phosphate dibasic (Na ₂ HP0 ₄ ), potassium phosphate monobasic (KH2PO4), potassium chloride (KC1), Tween-20, and all other chemicals were purchased from Sigma-Aldrich

43

7595282 (Oakville, Canada) and used without further purification. Milli-Q water was used for all experiments.

[00198] Colorimetric Assay. The colorimetric assay was conducted on a streptavi din-coated microtiter plate. The wells of the microtiter plate were washed three times with washing buffer (200 pL, 1 ^c SB with 0.1% v/v BSA) after the attachment of each reagent. Briefly, blocking buffer (200 pL, PBST, 10% w/v BSA) was first added to the wells and incubated at 37 °C for 1 h to block the wells. Second, biotinylated MSA1 (100 pL, 500 nM) in lx dilution buffer (lx SB with 2% v/v BSA) was introduced (to bind streptavi din) by shaking at 70 rpm at 22 °C for 30 min. Then, different concentrations of the pseudotyped lenti virus of SARS-CoV-2 spiked in 50% v/v saliva (diluted with lx dilution buffer) were added and shaken at 70 rpm at 22 °C for 60 min (viral capture by the aptamer on the plate). Next, biotinylated MSA1 (100 pL, 500 nM) in dilution buffer was added again and shaken at 70 rpm at 22 °C for 30 min (reporter aptamer binding with the virus). Finally, streptavidin-conjugated HRP (100 pL, 1:1000 dilution) in dilution buffer was added and shaken at 70 rpm at 22 °C for 30 min (to bind the reporter aptamer). TMB substrate (100 pL) was then introduced and incubated at 22 °C for 20 min. The catalytic reaction was terminated by FhSCri (20 pL, 2 M). A plate reader was used to measure the absorbance at 450 nm.

[00199] Results and Discussion

[00200] A colorimetric assay for viral detection in Saliva using MSA1. Using these aptamers to develop a colorimetric assay to detect the PV in 50% saliva was next examined. The MSA1 aptamer was used for this demonstration. Because each viral particle carries multiple spike proteins on its surface, a sandwich assay was designed that uses two identical biotinylated MSA1 aptamers to bind a single viral particle (FIG. 14A). The first aptamer was biotinylated at the 3' end and immobilized (i.e. functionalized) onto a 96-well microtiter plate coated with streptavidin. The second biotinylated MSA1 aptamer was tagged with horseradish peroxidase (HRP) conjugated to streptavidin. The presence of the PV led to immobilization of HRP onto the plate, which oxidized 3,3',5,5'-tetramethylbenzidine (TMB) in the presence of H2O2. After quenching the reaction with H2SO4, the blue-colored oxidized TMB turned yellow and was measured at 450 nm.

44

7595282 [00201] The “yellow” color of the reaction mixture intensified with increasing concentrations of the PV (FIG. 14B). The visual limit of detection (LOD) was 1 pM. The absorbance at 450 nM vs. the concentration of the PV is provided in FIG. 14C, which showed an increase in A450 with increasing viral concentration. A linear response curve in the range of 0.5-20 pM was observed (FIG. 14D). The LOD, defined by 3 times the standard deviation of the blank samples, was determined to be 400 fM, which corresponds to 2.4 x 10 ¹⁰ virus particles per mL. This viral concentration, equivalent to a C _t value of ~16, is in the upper range of viral particle concentration for an infected patient (normal range for infected patients is 10 ³ to 10 ¹¹ viral particles per mL. The LOD could be improved by either performing a pre-concentration step or by reformatting the test to produce a more sensitive readout, such as fluorescence.

Example 5: Secondary structure analysis of aptamers [00202] Results

[00203] Secondary structure analysis of MSA1, MSA5 and MSA3. It has been shown herein that the aptamer selection experiments have resulted in the isolation of three aptamers, MSA1, MS A3 and MSA5, that recognize the SI protein with single digit nanomolar KA values. These aptamers were isolated from a DNA library pre engineered to contain a pairing element to confine the two constant-sequence domains, and hence the secondary structures of these aptamers were examined to determine if this structural motif was present in each of the aptamers and attempts were made to minimize their sizes via the examination of truncation mutants.

[00204] The predicted structure of MSA1 using the mfold program is provided in FIG. 15. In addition to the pre-engineered PI element, MSA1 was predicted to contain two additional pairing elements (3-bp P2 and 7-bp P3; P: pairing element; bp: base-pair) and three unpaired elements (7-nt L2, 25-nt L3, 8-nt SS31; nt: nucleotide; L: loop; SS: single-stranded element; SS31: the single-stranded element linking P3 to PI).

[00205] Six truncation mutants of MSA1, named MSA1-T1 to MSA1-T6, were tested for SI protein binding using the dot blot assay. The results indicated that P3-L3 elements are important for the target recognition as the truncation mutant MSA1-T2 in which P3 and L3 are kept but all of the other elements are eliminated retained full binding activity. The length of P3 can be reduced from 7-bp to 6-bp, as the resultant

45

7595282 mutant MSA1-T3 exhibited similar binding affinity. Further reduction of P3 to 5-bp resulted in substantial loss of activity (increase of KA by 36-fold comparing MSA1-T3 and MSA1-T4). The elimination of L3, however, abolished the binding ability of the aptamer (MSA1-T6; K _A > 500 nM).

[00206] The predicted structure of MSA5 is provided in FIG. 16. The overall structure contains four pairing elements (9-bp PI, 5 -bp P2, 3 -bp P3 and 3 -bp P4) and five unpaired elements (6-nt SS12, 7-nt SS21, 6-nt SS23, 5-nt L3, 9-nt L4). Four truncation mutants of MSA5 were examined by the dot blot assay (named MSA5-T1 to MSA5-T4, respectively). Removing PI, SS12 and SS21 together (loss of 34 nucleotides) led to a significantly truncated mutant, MSA5-T1, that still exhibited strong binding activity (KA of 8.4 nM; a 3.1-fold increase over that of the full-length aptamer). Further reduction of P2 in MSA5-T1 from 5-bp to 2-bp (MSA5-T2; K _A of 10.1 nM; 3.7-fold increase) or increasing the length of P2 to 6-bp (MSA5-T3; K of 7.3 nM; 2.7-fold increase) and 7-bp (MSA5-T4; KA of 6.3 nM; 2.3-fold increase) also led to mutants with similar binding affinity to that of MSA5-T1, although mutants with the stronger P2 elements exhibited better binding affinity. Truncation of P4-L4 (MSA5- T5; KA > 500 nM;) or P3-L3 (MSA5-T6; KA of 264 nM) drastically affected the binding activity (MSA5-T3: MSA5-T4:). Removal of SS23 (MSA5-T7; KA of 22.8 nM; 8.4- fold increase) also affected the binding affinity substantially but did not inactivate the binding. These results indicate that the P2, SS23, P3, L3, P4 and L4 elements play important roles in the target recognition and other structural elements can be eliminated.

[00207] The predicted structure of MS A3 is provided in FIG. 17. Four truncation mutants (named MSA3-T1 to MSA5-T4, respectively) were examined by the dot blot assay. The results also show that MSA3 also uses a hairpin structure to support its binding. Based on the above analysis, it is clear that all of the best three aptamers in terms of binding affinity adopt a simple hairpin structure to achieve the recognition of the SI protein (FIG. 18), as illustrated by exemplary truncation mutants MSA1-T3 (KA of 3.1 nM; 37 nt), MSA3-T2 (if _d of 1.9 nM; 39 nt), MSA5-T4 (if _d of 6.3 nM; 49 nt).

[00208] Discussion

[00209] In summary, described herein is the selection of DNA aptamers from a pre-structured synthetic DNA library using the S 1 subunit of the spike protein of S ARS-

46

7595282 CoV-2 as the binding target, which resulted in the isolation of a large number of different aptamer sequences. Through the examination of the binding affinity and specificity of the top 10 sequences, it was confirmed that the isolated sequences represent high-quality aptamers, with the three exemplary aptamers exhibiting Kd values of 1 - 3 nM for the SI subunit. The top-ranking DNA aptamer, MSA1, has a Kd of 1.8 nM; for comparison, the best Kd value for binding to the SI protein by previously reported aptamers is 13 nM (17). Dot blot assays were also performed with two previously reported aptamers, CoV2-RBD-l (15) and Apt-S-268s (19), to assess binding to the spike protein of SARS-CoV-2 and determined their Kd values (FIG. 19). The experiment confirmed the expected affinity of the CoV2-RBD-l aptamer (FIG. 19A), with a Ad value of 37.4 nM (FIG. 19B), which is significantly poorer than MSA1 and MSA5. Apt-S-268s, however, showed very weak binding the spike protein (FIG. 19A), with an estimated Kd value greater than 200 nM (FIG. 19B).

[00210] A point that is worth noting is the approach of structuring a DNA library with a strong pairing element, which can be a key factor responsible for discovering numerous aptamers. In initial testing of the top 10 aptamer candidates, it was found that all of them bind the S 1 protein with excellent affinity (FIG. 4). The binding affinity of three other aptamers, including MSA11 and two low-ranked aptamers, MSA50 and MSA439, were then further examined. It was found that all three aptamers still showed excellent affinity, with Ad values being 30.1 nM, 10.2 nM and 36.9 nM, respectively (Table 3). Therefore, the structured library approach in which the two constant- sequence regions are engaged into a strong duplex represents an attractive option for aptamer discovery. A structured library approach has been used for the successful discovery of diverse kinase ribozymes (46) and RNA-cleaving DNAzymes (47) and has also been used by Davis and Szostak for the creation of GTP-binding RNA aptamers (48). However, they inserted a short stem-loop in the middle of the random region and combined this library with a non-structured pool to derive GTP-binding aptamers so that the structured library outcompeted the non-structured sequences as all selected aptamers contained the hairpin insert.

[00211] The second advantage of using the structured DNA library for aptamer selection is the reduced workload for establishing secondary structures and obtaining minimized sequences of isolated aptamers. In this approach, the two constant regions

47

7595282 that flank the random domain were placed into a stable pairing element. In essence, the DNA library was structured into a hairpin structure, with the intention to prevent them from playing an important role in the recognition of the SI protein so that they can be easily removed. The results from the secondary structure prediction and sequence truncation analysis applied to the three best aptamers identified from the selection, MSA1, MS A3 and MSA5, confirm that this approach could indeed simplify the task of establishing secondary structures and minimizing the sizes of selected aptamers.

[00212] Several other DNA aptamers have been selected to bind the receptor binding domain (RBD) (15, 18), the SI protein (19), trimerized SI protein (17), and virus mimics (16). A BLAST comparison of the top 10 aptamers was performed with these aptamers and found aptamers disclosed herein to be distinct from all other published aptamers surveyed (FIG. 20 A). The highest scoring sequence similarity was observed between MSA2 against the published aptamer Apt-S-79s; however, alignment of the sequences occurs in the G-rich regions of both aptamers (FIG. 16B) and cannot be indicative of a similar functional element but instead G-rich sequence motifs that are commonly found in a wide range of aptamer selections.

[00213] The DNA aptamers disclosed herein were isolated to bind the purified SI subunit of the spike protein of SARS-CoV-2. However, the exemplary aptamers, MSA1 and MSA5, could recognize the full spike protein of SARS-CoV-2 and the pseudotyped lenti virus that expresses the full spike protein of SARS-CoV-2. It is known that the SI subunit is well folded into a stable structure that closely resembles the full trimeric spike (30). The observation of the equivalent binding of MSA1 and MSA5 to the SI protein, the trimeric spike protein and the pseudotyped virus supports the structural and functional similarity of the SI protein to the functional spike on the virus.

[00214] It was observed that both MSA1 and MSA5 were still able to bind the SI protein and the pseudotyped virus after they were treated at 65 °C for 60 minutes. This indicates that the aptamers disclosed herein recognize an epitope (or epitopes) of the spike protein that is heat resistant. Given that treating the SARS-CoV-2 virus at 65 °C for as short as 5 minutes can completely deactivate it (11), these aptamers can be incorporated into a safe diagnostic method where heat deactivation of clinical samples can be used to avoid infection during the assay which can be of importance if used in congregate settings for screening multiple samples.

48

7595282 [00215] Furthermore, it was found that both MSA1 and MSA5 exhibited similar binding affinity to the trimeric S protein of both the wild-type Wuhan virus and the B.1.1.7 variant, even though these aptamers were selected using the SI subunit of the spike protein from the wild-type virus. Though the precise binding site of these aptamers on the spike protein is not yet known, this observation points to the possibility that the binding site can not be at or near the N501Y mutation in the RBD and/or the conformation of the binding site is not significantly affected by N501Y mutation.

[00216] It was also found that the aptamers maintained full binding activity with the SI protein spiked into 50% human saliva which is an easily accessed sample type that could support home-testing or rapid testing in congregate settings. Based on this finding, a simple colorimetric sandwich assay was developed using the MSA1 aptamer as an MRE and showed that it was capable of detecting pseudotyped lentivirus in 50% saliva with a limit of detection of 400 fM. This proof-of-concept experiment confirmed the potential of these aptamers as diagnostic tools for COVID-19 detection in an easily accessed patient sample for the development of rapid antigen tests for the diagnosis of COVID-19.

[00217] The use of DNA aptamers as recognition elements is expected to make it relatively easy to adapt the test for emerging variants of concern by selecting new aptamers against variant SI proteins followed by evaluation of the highest affinity dimeric constructs, allowing the test to be rapidly deployed to allow screening of new variants.

Example 6: Construction of dimeric aptamers and examination of their binding

[00218] Materials and Methods

[00219] Chemicals and reagents. DNA oligonucleotides were obtained from Integrated DNA Technologies (IDT) and purified by standard 10% denaturing (8 M urea) polyacrylamide gel electrophoresis (dPAGE) before use. The sequences used in making and assessing the dimeric aptamers are listed in Table 5. The Wuhan SARS- CoV-2 spike protein subunit SI (catalog number: 40591-V08B1) was purchased from Sino Biological Inc. The Wuhan SARS-CoV-2 full spike protein (molecular weight 140 kDa), RBD protein (35 kDa) and SARS-CoV-2 spike-pseudotyped lentivirus were

49

7595282 prepared using standard methods detailed above. The trimeric spike protein for the UK B.1.1.7 variant (catalog number: SPN-C52H6) was obtained from Aero Biosystems. The trimeric spike proteins for B.1.351 (catalog number: 510333-1) and P.l (catalog number: 100989-1) variants were obtained from BPS Biosciences Inc. The concentrations of the trimeric spike proteins were quantified using BCA protein assay kits from Thermo Scientific (Catalog number: 23225). The B 1.1.7 variant S ARS-CoV- 2 spike pseudotyped lentivirus was obtained from BPS Bioscience (catalog number: 78112-1). The pooled human saliva (Lot 31887) was purchased from Innovative Research Inc (Novi, Michigan). Nitrocellulose blotting membranes (catalog No. 10600125) were purchased from GE Healthcare Inc. Nylon hybridization transfer membranes (NEF994001PK) were purchased from PerkinElmer Inc (Woodbridge, ON, Canada). T4 DNA ligase, T4 polynucleotide kinase (PNK), adenosine triphosphate (ATP) and deoxyribonucleoside 5 ’-triphosphates (dNTPs) were purchased from Thermo Scientific (Ottawa, ON, Canada). g-[ ³² R]-ATR was acquired from PerkinElmer. Bovine serum albumin (BSA), human thrombin, IL6- Human, streptavidin ( Streptomyces avidinii ) and IgG from human serum were purchased from Millipore Sigma (Oakville, Canada). Staphylococcus aureus 25923 was purchased from the ATCC. RNase H2 was purified using standard methods (25). 4-(2-hydroxyethyl)-l- piperazineethanesulfonic acid (HEPES), sodium chloride, magnesium chloride, Tween- 20, polyethylene glycol (poly(ethylene glycol) methyl ether thiol (6000 kDa), K3[Fe(CN)6], K4[Fe(CN)6] and all other chemicals were purchased from Millipore Sigma (Oakville, Canada) and used without further purification. Milli-Q water was used for all the experiments.

[00220] Ligation of Dimeric Aptamers. Dimeric aptamer is denoted as DSA: Dimeric Spike binding DNA Aptamer (N: and; 1: MSA1-T2; 5: MSA5-T2). MSA1-T2 and MSA5-T2, are denoted as MS AIT and MSA5T from hereon. DSA1N5 was prepared by ligation of MSA1-T and 5'-phosphorylated MSA5T-T30 with T4 DNA ligase and the template sequence LT1. To phosphorylate MSA5T-T30, 200 pmol of MSA5T-T30 was mixed with 10 U (U: unit) of PNK and 2 mM ATP in 50 pL of 1 x PNK buffer A (50 mM Tris-HCl, pH 7.6 at 25 °C, 10 mM MgCb, 5 mM DTT, 0.1 mM spermidine). The mixture was incubated at 37 °C for 1 hour, then heated at 90 °C for 5 min. For ligation, 200 pmol of MSA1T and 300 pmol of LT1 were added into the above

50

7595282 reaction mixture, then heated at 90 °C for 5 min and cooled at room temperature for 20 min. To the above solution, 15 pL of 10x T4 DNA ligase buffer (400 mM Tris-HCl, 100 mM MgCh, 100 mM DTT, 5 mM ATP, pH 7.8) and 10 U of T4 DNA ligase were added. The resultant mixture (total 150 pL) was incubated at room temperature for 2 h and then heated at 90 °C for 5 min to deactivate the ligase. The ligation mixture was concentrated by ethanol precipitation and purified by 10% dPAGE. Other dimeric aptamers with different lengths of polythymidine linkers were prepared using the same method by ligating MSA1T with 5'-phosphorylated MSA5T-T(10, 15, 20, 40). The DMC (dimeric mutant aptamer control) was prepared by ligating mutant sequences MIC and M5C-T30 with the template LT2.

[00221] Radiolabelling of DNA Aptamers. Monomeric and dimeric DNA aptamers were labeled with g-[ ³² R] ATP at the 5 '-end using PNK reactions according to the manufacturer's protocol. Briefly, 2 pL of 1 pM DNA aptamers were mixed with 2 pL of g-[ ³² R] ATP, 1 pL of 10 ^c PNK reaction buffer A, 10 U (U: unit) of PNK and 4 pL water. The mixture was incubated at 37 °C for 20 min, and then purified by 10% dPAGE.

[00222] Dot Blot Binding Assays with Spike Protein. Dot blot assays were performed by using a Whatman Minifold- 1 96-well apparatus and a vacuum pump. Before experiments, nitrocellulose membranes and nylon membranes were incubated in binding buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 6 mM KC1, 2.5 mM MgCh, 2.5 mM CaCh, 0.01% Tween-20) for 1 h. g-[ ³² R] labelled DNA aptamers (1 nM) were dissolved in the binding buffer and heated at 90 °C for 5 min, and then cooled at room temperature for 20 min. Spike proteins were dissolved and diluted in the same buffer. 5 pL of the above aptamer solution was mixed with 15 pL of spike protein with different concentrations. The mixture was incubated at room temperature for 1 h. The dot blot apparatus was assembled with a nitrocellulose membrane on the top, a nylon membrane in the middle and a wetted Whatman paper in the bottom. After washing each well with 100 pL of binding buffer, the binding mixtures were loaded and drained by the vacuum pump (force: 550 mmHg for 8 seconds). The wells were then washed twice with 100 pL binding buffer. The membranes were imaged using a Typhoon 9200 imager (GE Healthcare) and analyzed using Image J software (Molecular Dynamics).

[00223] Dot Blot Binding Assays with SARS-CoV-2 Spike-Pseudotyped

51

7595282 Lentivirus. Dot blot assays with SARS-CoV-2 spike-pseudotyped lentivirus and the control lentivirus without spike protein were performed using the same procedure as described above except the aptamer solutions were incubated with different concentrations of viruses (0 - 500 pM of viral particles; corresponding to 0 - 3 x 10 ¹¹ cp mL ¹ ) for 20 min, followed by performing dot blot assays.

[00224] Results and Discussion

[00225] Given that (1) the spike protein of SARS-CoV-2 is a trimeric protein made of 3 S1-S2 monomers, and (2) each viral particle of SARS-CoV-2 contains ~30 spike proteins (41, 42), and these aptamers were selected using the monomeric SI subunit, the present inventors tested whether multimeric, such as dimeric, aptamers could display much higher affinity for both the full-length trimeric spike protein and the intact virus.

[00226] MSA1 and MSA5, were chosen to build dimeric aptamers as they exhibited the highest affinity to the SI protein. Specifically, two homodimeric aptamers and one heterodimeric aptamer were constructed using MSA1T and MSA5T, the truncated minimal sequences of the two aptamers that retained full activity (FIG. 21 A). These aptamers are named DSA1N1 and DSA5N5 and DSA1N5 (DSA: Dimeric Spike binding DNA Aptamer; N: and; 1: MSA1T; 5: MSA5T). The proposed secondary structures of MSA1T and MSA5T are shown in FIG. 21A. Dimeric aptamers were generated by linking the MSA1T and MSA5T with a polythymidine (polyT) linker.

[00227] The effect of the linkers containing 10, 15, 20, 30 and 40 thymidines on the binding affinity of DSA1N5 to the wild-type trimeric spike protein (Wuhan variant, denoted as WHTS from hereon) was first examined using dot-blot assays. The dimeric aptamers containing a linker of 30, 40, and 20 thymidines showed similar binding affinity (K _d of 0.12, 0.14 and 0.17 nM, respectively, FIG. 22), but those with 15- and 10-thymidine linkers had poorer affinity (Kd of 0.58 and 12.6 nM, respectively). DSA1N5 with the 30-T linker had a binding affinity for the trimeric spike protein that is ~99- and 28-fold higher than the monomeric aptamers MS AIT and MSA5T, respectively (Table 6). The results indicate that the dimeric aptamer approach can produce aptamers with significantly enhanced affinity for the trimeric spike protein, presumably via bivalent recognition (49-56).

52

7595282 [00228] FIG. 21B shows binding curves derived from dot-blot assays using the full trimeric spike proteins of SARS-CoV-2 (representative dot blot assay results are provided in FIG. 23). In comparison to the substantial affinity enhancement observed for the heterodimeric aptamer DSA1N5 (~99-fold; Table 6), the two homodimeric aptamers showed much reduced affinity enhancements relative to their monomeric counterparts (Table 6). As controls, inventors also tested the scrambled sequences of the dimeric and monomeric aptamers (named as DMC, MIC and M5C) and no binding was observed for any of these controls (FIG. 21B and 23).

[00229] The affinity of MS AIT for the trimeric spike protein decreased 4.2-fold relative to the SI subunit (K _d of 11.9 nM vs. 2.8 nM; FIG. 24A), but MSA5T had 1.7- fold higher affinity for the trimeric protein (K _d of 5.8 nM vs. 10.1 nM; FIG. 24B), indicating that the trimer formation affects the MSA1 binding epitope, and that MSA1 and MSA5 bind slightly different epitopes. To determine if MSA1T and MSA5T recognize the same epitope or different epitopes of the spike protein, a competition assay was conducted that used non-radioactive MSA5T to compete with radioactive MSA1T (FIG. 25). Radioactive MSA1T was first incubated with S 1 under the condition where MS AIT was fully bound to SI, followed by the addition of increasing concentrations of MSA5T. The results provided in FIG. 25 indicate that MSA5T can successfully compete with MS AIT, showing that they recognize the same epitope of the SI subunit, though, as noted above, it is possible that the exact epitopes differ slightly.

[00230] Dimeric Aptamers Binding with Spike Proteins of SARS-Cov-2 Variants. In addition to the spike protein from the wild-type virus, the binding of the dimeric aptamer DSA1N5 was also tested with the spike proteins of the three viral variants that first emerged in the UK (B.l.1.7), Brazil (P.l) and South Africa (B.1.351). DSA1N5 retained high affinity to the UK variant spike protein (denoted as UKTS, Kd = 0.21 nM, FIG. 21B), indicating that the 501Y mutation did not alter the binding epitope(s) of the dimeric aptamer (57). However, DSA1N5 showed markedly decreased affinities for both the South Africa (E484 mutation) and Brazil (E484K and K417T mutations) variants trimeric spike proteins (denoted as SATS and BZTS, K = 3.6 and 12.4 nM, respectively, FIG. 26). Thus, the affinity drops by ~30 and ~103-fold for the South Africa and Brazil variants spike proteins, respectively, which would be expected to

53

7595282 have a significant impact on detection sensitivity for SARS-CoV-2 assays. These results show that the E484K and K417T mutations directly impact the aptamer-binding epitopes and thus reselection of monomeric aptamers and generation of new dimeric aptamers will be required to produce high affinity aptamers for these variants.

[00231] Dimeric Aptamer Binding with Pseudotyped Lentiviruses of SARS-Co V-

2. Each viral particle of SARS-CoV-2 carries multiple trimeric spike proteins and the average spacing distance of adjacent spike proteins on coronaviruses has been reported to be -13-15 nm (58, 59). The predicted the length of the dimeric aptamer DSA1N5 is greater than 15 nm. Therefore, it was expected that this aptamer would show enhanced affinity for viral particles.

[00232] To test for viral binding, a pseudotyped lenti virus engineered to express the full trimeric S-protein of SARS-CoV-2 was used (38-40). The same lentivirus that lacks the S-protein was used as a control virus for this experiment.

[00233] Using dot blot assays, DSA1N5 was evaluated for viral recognition (FIG. 27A). The analysis of binding affinity showed that DSA1N5 had high affinity binding to the pseudotyped viruses carrying the wild-type Wuhan variant spike protein (denoted as WHPV), with a KA of 2.1 pM, a 57-fold improvement relative to the Kd for the trimeric spike protein (FIG. 27B). The additional affinity improvement was attributed to the bivalent binding of the same aptamer to two different spike proteins on the viral surface. As controls, no binding was observed between WHPV and DMC (an inactive mutant dimeric aptamer) or between DSA1N5 with the control lentivirus that does not express the spike protein of SARS-CoV-2 (CV).

[00234] DSA1N5 showed similar affinity (2.3 pM) for the pseudotyped lentiviruses expressing the B.1.1.7 variant of the spike protein (UKPV), demonstrating that the dimeric DSA1N5 aptamer should be able to bind both the Wuhan and UK variants of SARS-CoV-2. It produced a 126-fold improvement relative to the Kd for the trimeric spike protein (FIG. 27B).

Example 7: Aptamer-based electrochemical assay

[00235] Materials and Methods

54

7595282 [00236] Cov-eChip fabrication and validation. The Cov-eChip (Metrohm, Dropsens, DRP C220BT) comprises gold (Au) working and counter electrodes, and a silver (Ag) reference electrode. The Cov-eChip was cleaned by rinsing in isopropanol and ddThO and was electrochemically activated in 0.1 M H2SO4 by cyclic voltammetry (0 V to 1.5 V, 0.1 V/s, 10 cycles). A dimeric aptamer (1.5, 2 or 3 mM) carrying the thiol group on the 3' end was first reduced using 200 pM tris(2-carboxyethyl)phosphine for 2 hours at room temperature in the dark and a 5 pL solution was deposited on the working electrode and incubated for 16 - 18 hours at room temperature in the dark. Following functionalization with the aptamer, the electrode was rinsed in the binding buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 6 mM KC1, 2.5 mM MgCh, 2.5 mM CaCh, 0.01% Tween-20) and 5 pL of a 1 mM thiolated polyethylene glycol (poly (ethylene glycol) methyl ether thiol, average molecular weight of 6000 Da) solution was deposited on the working electrode and incubated for 2 hours at room temperature in the dark to block the unreacted surface. Every step of the electrode preparation, such as cleaning, aptamer deposition and PEG backfilling was validated using electrochemical impedance spectroscopy (EIS). Following optimization, the aptamer density on the working electrode was calculated using chrono-coulometry (CH instrument 660D) in 10 mM Tris buffer (pH = 7.2) and 1 mM of ruthenium hexamine containing 10 mM Tris buffer (pH = 7.2).

[00237] Detection of Recombinant spike protein and Pseudotyped Lentivirus using Cov-eChip. All EIS measurements were performed using a Sensit Smart USB- sized potentiometer (Palmsens-BV) with an amplitude of 5 mV and frequency range of 20 kHz to lHz in a 25 pL solution of readout buffer (10 mM phosphate buffered saline (PBS), pH 7.4 containing 2 mM K;,| Fe(CN)r,| and 2 mM K Fe(CN) ₆ ]) at the formal potential of the redox probe (0.23 V vs. Ag/AgCl/KCl saturated). For detection of spike protein, the incubation time for the assay was first optimized using a (40 fM) solution of the spike protein in the binding buffer (same composition as wash buffer). For detection of the spike protein (0-44.4 pM), the target was diluted in binding buffer and incubated on the Cov-eChip for 5 min. For Wuhan pseudotyped lentivirus (0 - 10 ⁶ cp/mL) and UK pseudotyped lentivirus (0 - 10 ⁵ cp/mL) detection, the target was spiked in pooled saliva (5 pL of virus into 45 pL of saliva) that was then diluted 1:1 (v: v) with binding buffer and incubated on the Cov-eChip for 5 min at room temperature. For all

55

7595282 measurements, the chips were dipped into the binding buffer for 1 min and the signal was measured by EIS in the readout buffer over a period of 2 min. The change in the relative charge transfer resistance (A RCT / Ren) was calculated by the equation: where RCT/ is the final charge transfer resistance after sample addition and washing and Ren is the initial charge transfer resistance measured before addition of sample.

[00238] Cross reactivity study using the Cov-eChip. The cross-reactivity of the Cov-eChip was studied by incubating the chip with diluted pooled saliva and IL6 (1000 pg/mL), Streptavidin (1000 pg/mL), IgG (1000 pg/mL), Staphylococcus aureus (10 ⁴ CFU/mL), and control lentivirus (10 ⁵ cp/mL) spiked in diluted pooled saliva for 5 min at room temperature. The interaction of the 2 mM mutant aptamer and Wuhan pseudotyped lentivirus (10 ⁴ cp/mL) was also studied using the same experimental conditions as for the dimeric aptamer assay on Cov-eChip. Evaluation of interferences from patient saliva samples was also evaluated, as described below.

[00239] Validation with Patient Samples. Clinical specimens were collected from COVID-19 in-patient units at Hamilton General and Juravinski Hospitals and out patients from the West End COVID-19 Assessment Clinic, all sites are affiliated with Hamilton Health Sciences (Hamilton, Ontario). The project was approved by the Hamilton Integrated Research Ethics Board (HiREB). COVID-19 positive participants at in-patient units were identified from a clinical database and approached for consent. Participants from the assessment center were approached for consent following NPS collection. Saliva specimens were collected using a saliva self-collection kit (IBI- Scientific) with instructions to pool saliva in their mouths and spit into a collection tube to the 3 ml mark. SARS-CoV-2 RT-PCR testing of NPS specimens were performed at an accredited laboratory (Hamilton Regional Laboratory Medicine Program). Limited, deidentified demographic data was collected (reason for testing, gender, sex, age, surveillance case classification, indigenous status, and symptom status). NPS PCR cycle threshold results were linked to saliva specimens by a laboratory specimen number to allow sample comparison. Saliva specimens were stored at 4 °C for <72 hours and stored long term at -80 °C prior to analysis.

56

7595282 [00240] Prior to testing, all the patient saliva samples were first heat-inactivated at 65 °C for 30 min, and were diluted in binding buffer (1:1 v:v). To evaluate interferences that can arise from variability of patient samples, a selection of 25 negative patient saliva samples (tested using RT-PCR using a previously published method (60) and correlated to corresponding RT-PCR results for NPS samples) were tested as is (unspiked) or spiked with pseudotyped lentivirus to a final concentration of 10 ⁴ cp/mL. A 10 pL solution of the heat inactivated, unspiked or spiked negative saliva samples were incubated for 5 min on the Cov-eChip at room temperature followed by the same washing and measurement conditions described above for saliva samples spiked with lentiviruses.

[00241] For the validation experiment, a total of 37 negative samples, 31 samples that were confirmed positive for the Wuhan wild-type virus, and 3 samples confirmed positive for the B.l.1.7 variant (UK variant) were tested. All patient saliva samples were tested using RT-PCR (cycle threshold (C _t ) values are provided in Table 7) followed by a blinded clinical validation experiment with the electrochemical sensor using saliva that was diluted 1:1 in binding buffer and tested as described above for saliva samples spiked with lentiviruses. Six false negative saliva samples were spiked with 10 ⁶ cp/mL ofWuhan pseudotyped virus. 10 pL of these spiked samples were tested as described above for saliva samples spiked with lentiviruses.

[00242] Data analysis. The charge transfer resistance data obtained from the EIS scans were fit to the Randles circuit (61) using the EIS analyser module of the PalmSens trace software. Every data point corresponds to the mean of three (n = 3) individual datapoints measured for the same conditions on three separate device and the error bar indicates the standard deviation. The limit-of-detection was then calculated by substituting the limit-of-blank (62) as the “y” value in the regression line equation of the calibration curve. A two tailed Student t test was performed for the specificity test. Equations used for the calculation of cut-off point, limit-of-blank, clinical sensitivity, specificity, and concordance are given below.

[00243] Cut-Off point used for assay outcome:

Cut — Off = mean of negative samples + 3 x ( S. D. of negative samples)

57

7595282 [00244] Limit of blank (LOB) for limit of detection for recombinant spike protein in buffer and pseudotyped lentivirus spiked in pooled saliva:

LOB = mean of blank ( buffer or pooled saliva ) + 3 x ( S. D. of blank)

[00245] Clinical Sensitivity:

True positive Sensitivity =

True positive + False negative

[00246] Clinical Specificity:

True negative

Specificity =

True negative + False positive

[00247] Concordance:

Number of correct outcome

Concordance = T otal number of samples tested

[00248] Results

[00249] Generation and Characterization of Aptamer Modified Electrodes. The

DSA1N5-SH aptamer was bound to a gold electrode through a terminal thiol group and the electrode was backfilled with thiol terminated PEG 6000 to minimize non-specific adsorption on the electrode surface. The data on the characterization of the electrode are shown in FIG. 28. Gold electrodes were first cleaned and evaluated for reproducibility using cyclic voltammetry (FIG. 28A). The overlapping reduction and oxidation peaks demonstrate the reproducibility of the electrodes. Following each step of derivatization, the electrodes were evaluated using EIS and analysed using the equivalent circuit model shown in FIG. 29A, with the addition of the aptamer and PEG both showing an increase in the charge transfer resistance (R _et ) due to the presence of passivating materials blocking the surface diffusion of redox reagents in the measurement solution (FIG. 28B and FIG. 29B). The increase in the RCT value validates that the functionalization occurred, and all Cov-eChips were validated by this method prior to use. EIS was further utilized to optimize the concentration of the aptamer (FIG. 28C), demonstrating an optimal concentration of 2 mM for the aptamer solution. The density of the aptamer on the electrode surface was determined using chrono- coulometry (FIG. 28D), providing a surface density value of (1.3 ± 0.2) ^c 10 ¹⁴ aptamers

58

7595282 per cm ² . The overlap in the graphs used for measuring the aptamer surface density also indicates that the aptamer functionalization is very uniform.

[00250] Electrochemical Detection of Spike Protein. The Cov-eChip sensor functionalized with the DSA1N5 aptamer on the working electrode was used to measure the change in charge transfer resistance (denoted as the change in resistance over the initial resistance ( ARCT/RCT )) of the Cov-eChip at different concentrations of full spike protein. In this case, the functionalised Cov-eChip acts as an electrochemical transducer that translates the binding of the SARS-CoV-2 spike protein to the aptamer- modified electrode to an increase in electrochemical impedance (FIG. 30A). Initial studies evaluated the incubation time required for optimal detection of the spike protein (FIG. 30B), indicating an incubation time of as little as 5 min could produce a measurable signal with minimal background. Longer incubation times produced higher signals but also increased the background, and thus a 5 min incubation time was selected. The detection of the spike protein was then tested in binding buffer, which resulted in an enhanced charge transfer resistance as spike protein concentrations increased, indicating reduced access of the redox reagents to the working electrode surface (FIG. 30C). FIG. 30D shows the changes in A Per Rcr versus the concentration of either the WHTS or UKTS. For both proteins, the log-linear range was 4 fM to 4.4 pM with a limit of detection (LOD) of 1 fM for WHTS and 2.8 fM for UKTS (FIG. 30D). The sensitivity of the device for the WHTS (0.93), measured as the signal change (ARCT/RCT) per log of concentration, however, is considerably higher than for the UKTS (0.50). Even so, the results show that the electrochemical assay can detect both WHTS and UKTS, and provides far superior detection sensitivity relative to the dot-blot assays, indicating that this method should allow for detection of the SARS-CoV-2 virus in the clinically relevant concentration range.

[00251] Electrochemical Detection of Pseudotyped Lentiviruses in Saliva Samples. The performance of the Cov-eChip assay was further validated using EIS to test human saliva samples (with a 1:1 dilution) spiked with various concentrations of the WHPV (Nyquist plots and electrochemical parameters are shown in FIG. s 31, panel A and B). A log-linear dynamic range was exhibited in the 10 ³ cp mL ¹ to 10 ⁵ cp mL ¹ range and an LOD of 1,000 cp mL ¹ was calculated based on 3s of the background error (FIG. 32A), again demonstrating superior detection sensitivity relative to the dot-

59

7595282 blot assay. The ability of the Cov-eChip to detect the UKPV was also assessed (FIG. 32A). The result indicates that DSA1N5 was capable of recognizing this variant, but with a poorer detection limit (5000 cp/mL), which is a loss of over 5-fold, but still on par with the LOD of other rapid tests for the WH variant (63-70).

[00252] The Cov-eChip sensor was also challenged with other proteins (IL-6, IgG, Streptavidin), a control lentivirus not expressing spike proteins, and a bacterium (S. aureu ) spiked in human saliva to determine the non-specific interaction of the Cov- eChip with non-target samples (FIG. 32B). The signal measured in response to the WHPV (>l(f cp niL ') was significantly higher than measured with potentially interfering species, demonstrating the capability of the aptamer to bind with the SARS- CoV-2 spike protein with high selectivity.

[00253] Another cross-reactivity experiment was done using a series of negative patient saliva samples that were collected as shown in FIG. 32C. In this case, the saliva samples were first spiked with 10 ⁴ cp niL ¹ of pseudotyped virus and then heat inactivated by treating them at 65 °C for 30 min to ensure operator safety and diluted 1:1 with binding buffer. As shown in FIG. 33, the heating step causes a small decrease in the measured signal (-20%) and an increase in measurement error, but enables safer sample handling of clinical samples in the laboratory. While the negative saliva samples showed a relatively variable initial charge transfer resistance (0.8 ± 0.3), all samples showed substantial increases in the signal after spiking, with an average increase in charge transfer resistance of 0.9 ± 0.4 observed following the spiking of the saliva with the pseudotyped virus (FIG. 32D). These results clearly show that, although the variability of patient samples impacts the measured background signals, it is feasible to use the aptamer-based Cov-eChip assay for detecting low levels of virus even in heterogeneous clinical saliva specimens.

[00254] Validation of the Cov-eChip saliva assay with Clinical Samples. To assess the clinical sensitivity and specificity of the Cov-eChip saliva assay, a panel of

71 patient saliva samples - 34 positives including 3 of the UK variant and 37 negatives according to the nasopharyngeal swab RT-PCR results, and in line with the sample size requirements for obtaining emergency use authorization (71) - were examined in a blinded study. The test procedure included: (1) sample dilution in binding buffer to achieve 50% saliva content; (2) sample incubation on the Cov-eChip (5 min); (3)

60

7595282 washing the chip with binding buffer (1 min); (4) acquiring the EIS signal readout in redox buffer (2 min) using a mobile-operated potentiostat the size of a USB stick (FIG. 34A). Hence, the sample-to-readout time, including sample processing, is under 10 min.

[00255] Seventy-one saliva samples collected from patients diagnosed with SARS-CoV-2 (positive) and those without the infection (negative) were tested on the Cov-eChip. The ARCT/RCT values were clearly different between these groups, 0.5 - 1.2 for the negative group and 0.5 - 3.8 for the positive group (FIG. 34B). By applying a cut-off point at 1.3 (FIG. 30C; determined by calculating the mean + 2 SD of the COVID- 19 negative samples (65)) and performing a head-to-head comparison between the Cov-eChip saliva assay and nasopharyngeal swab RT-PCR (Table 7), a clinical sensitivity of 82% (28/34), specificity of 100% and concordance of 92% was found, which meets the FDA regulations for sensitivity (>80%) and specificity (99%) for home-based antigen tests (72, 73) and surpasses the performance of other antigen based tests for detecting SARS-CoV-2 in saliva (Table 8), none of which tested the required 30 positive and negative samples as required by FDA regulations. Another strength of this experiment is the patient group included both hospital inpatients and ambulatory patients attending a COVID-19 assessment centre representing a spectrum of patients for which this test could be applied to. Furthermore, this is the first report of any rapid tests being able to detect UK variants as positive for SARS-CoV-2.

[00256] The positivity of all the COVID-19 positive samples was made based on nasopharyngeal swab (NPS) RT-PCR data, which tests for viral RNA, while this test is designed to detect the spike protein on the viral particles in saliva. Therefore, it might be possible that even though the NPS test was positive, there were not sufficient viruses in the saliva to be detected by the Cov-eChip assay. Another possibility is that there were unknown inhibitory factors in the saliva that prevented the recognition of the spike protein by the aptamer. To test the latter, six false-negative samples (16, 26, 54, 66, 62, and 159) were further examined by spiking the WHPV into these samples at a concentration of 10 ⁶ cp/mL. At this concentration, the Cov-eChip assay should provide a convincing positive signal. However, as the data provided in FIG. 35 show, none of these spiked samples produced a significantly enhanced signal over the unspiked samples. These results show that there were indeed inhibitory factors in these samples that prevented the aptamer recognition. Since these saliva samples were donated by

61

7595282 hospitalized Covid patients, there is a good possibility that these saliva samples can contain spike-binding neutralizing antibodies (74, 75). Saliva is also a highly diverse and variable fluid containing many proteins with a principle one being mucin, a heavily glycosylated protein (76). Functionally, mucins provide lubrication and a barrier in the oral cavity against bacteria, viruses and environmental contaminants. These virus traps could be another mechanism of interference to hinder aptamer binding (77).

[00257] Further, the comparison of binding profdes of MSA1 (FIG. 36A), MSA5 (FIG. 36B) and DSA1N5 (FIG. 36C) with the SI subunit of wildtype SARS-CoV-2 (WH-S1) and the SI subunit of B.1.617.2 variant (IN-SI) show similar effects with the wildtype and variant. FIG. 37 shows the performance of monomeric aptamers MS AIT and MSA5T for detection of trimeric spike protein. FIG. 37 is a calibration plot of the different concentrations of the trimeric spike protein tested with monomeric aptamers MSA1T and MSA5T. Further, FIG. 38 shows the performance of monomeric aptamers MSA1T and MSA5T for detection of Wuhan pseudotyped virus. FIG. 38 is a calibration plot of the different concentrations of the WHPV tested with monomeric aptamers MSA1T and MSA5T. FIG. 39 shows receiver-operator characteristics curve for the Cov-eChip assay. The overall accuracy, or area under the curve (AUC) was 0.923 (Cl, 0.860 - 0.985) with an optimum sensitivity of 80.5% (true positive cases detected) at a threshold of 1.27 ARct/Rct and a corresponding specificity of 100% (no false positive cases detected). In FIG. 39, TPF refers to true-positive fraction and FPF refers false positive fraction.

[00258] Conclusion

[00259] Given the ongoing surges in COVID- 19 cases coupled with increasing reports of more highly transmissible and infective variants of concern, the need for a simple and rapid saliva-based SARS-CoV-2 test is more critical than ever. Herein, this need has been addressed by the development of an electrochemical sensor based on a dimeric DNA aptamer that can selectively bind the spike protein of both the Wuhan and

UK variants of the virus with high affinity, allowing for detection of the SARS-CoV-2 virus directly in patient saliva samples in under 10 min with a clinical sensitivity of 82% and specificity of 100%. The aptamer-based electrochemical sensor outperforms all current commercial and published rapid tests for SARS-CoV-2, including those that utilize NPS samples. The ability to detect both the original and UK variant of the virus in

62

7595282 an easily obtained saliva sample and to run the test without the need for complicated sample processing steps should allow implementation of the test in a variety of settings, including congregate settings (schools, long-term care homes), airports, arenas, or even as a home-based test run by the test subject. The use of DNA aptamers as recognition elements is expected to make it relatively easy to adapt the test for emerging variants of concern by selecting new aptamers against variant SI proteins followed by evaluation of the highest affinity dimeric constructs, allowing the test to be rapidly deployed to allow screening of new variants.

[00260] While the present disclosure has been described with reference to examples, it is to be understood that the scope of the claims should not be limited by the embodiments set forth in the examples, but should be given the broadest interpretation consistent with the description as a whole.

[00261] All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety. Where a term in the present disclosure is found to be defined differently in a document incorporated herein by reference, the definition provided herein is to serve as the definition for the term.

63

7595282 TABLES

Table 1. All the synthetic oligonucleotides used in this disclosure - sequences are written 5'-3'; 40 base random region = N40 (in bold); L = non-amplifiable linker.

64

7595282

Table 2. Concentrations of DNA and protein used during SELEX.

65

7595282 Table 3. N40 DNA sequences in pool 13 ranked by their percentage.

66

7595282

[a]: SEQ ID NO: 34-135 are the binding domains of the aptamers of the present disclosure. Each N ₄₀ sequence contains primer regions of TTACGTCAAGGTGTCACTCC and GAAGCATCTCTTTGGCGTG at the 5' end and 3' end, respectively.

67

7595282 Table 4. Sequence and Kd values of published DNA aptamers.

68

7595282 [a] S: Spike protein; Virus: S/RBD-virus mimics; RBD: the receptor-binding domain (RBD) of the SARS-CoV-2 spike protein; NA: no Kd value reported.

Table 5. DNA sequences used in making dimeric aptamers.

Table 6. Summary ofKA values of monomeric and dimeric aptamers for the trimeric spike protein of SARS-CoV-2 as well as the affinity enhancement of dimeric/monomeric aptamers.

69

7595282 Table 7. Comparative experiments of the positive COVID-19 samples using NPS C _t and Cov-eChip assay.

Note: Samples in black: positive by CoV-eChip assay; samples in bold italics: false-negatives by CoV-eChip assay.

Table 8. A list of SARS-CoV-2 antigen tests. a) MRE: molecular recognition element; ECS: electrochemical sensor; LFS: lateral flow sensor; b) S: spike protein; N, Nucleocapsid protein

70

7595282 CITATIONS

1. Cutler, D.M. and Summers, L.H. (2020) The COVID-19 Pandemic and the $16 Trillion Virus. JAMA, 324, 1495-1496.

2. Khan,P., Aufdembrink,L.M. and Engelhart,A.E. (2020) Isothermal SARS-CoV-2 Diagnostics: Tools for Enabling Distributed Pandemic Testing as a Means of Supporting Safe Reopenings. ACS Synth Biol, 9, 2861-2880.

3. Mina,M.J. and Andersen, K.G. (2021) COVID-19 testing: One size does not fit all. Science, 371, 126-127.

4. Muhi,S., Tayler,N., Hoang, T., Ballard, S. A., Graham, M., Rojek,A., Kwong.J.C.. Trubiano.J. A.. Smibert,0., Drewett,G., et al. (2021) Multi-site assessment of rapid, point-of-care antigen testing for the diagnosis of SARS-CoV-2 infection in a low- prevalence setting: A validation and implementation study. The Lancet Regional Health Western Pacific, 9.

5. Stokes, W., Berenger,B.M., Portnoy ,D., Scott, B., S/elewicki.J.. Singh, T., Venner,A.A., Turnbull, L., Pabbaraju,K., Shokoples,S., et al. (2021) Clinical performance of the Abbott Panbio with nasopharyngeal, throat, and saliva swabs among symptomatic individuals with COVID-19. Eur J Clin Microbiol Infect Dis, 10.1007/s 10096-021-04202-9.

6. Tuerk,C. and Gold,L. (1990) Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science, 249, 505- 510.

7. Ellington, A.D. and S/ostak.J.W. (1990) In vitro selection of RNA molecules that bind specific ligands. Nature, 346, 818-822.

8. McConnell, E.M., Cozma,I., Morrison, D. and Li,Y. (2020) Biosensors Made of Synthetic Functional Nucleic Acids Toward Better Human Health. Anal Chem, 92, 327-344.

9. Kammer,M.N., Kussrow,A., Gandhi,!, Drabek,R., Batchelor,R.H., Jackson, G.W. and Bomhop,D.J. (2019) Quantification of Opioids in Urine Using an Aptamer-Based Free-Solution Assay . Anal Chem, 91, 10582-10588.

71

7595282 10. Kim,S.H., Lee, I, Lee,B.H., Song,C.-S. and Gu,M.B. (2019) Specific detection of avian influenza H5N2 whole virus particles on lateral flow strips using a pair of sandwich-type aptamers. Biosens Bioelectron, 134, 123-129.

11. Swensen .S., Xiao,Y., Ferguson, B.S., Lubin,A.A., Lai,R.Y., Heeger,A.J., Plaxco,K.W. and Soh,H.T. (2009) Continuous, real-time monitoring of cocaine in undiluted blood serum via a microfluidic, electrochemical aptamer-based sensor. J Am Chem Soc, 131, 4262-4266.

12. Liu,R., McConnell, E.M., Li,J. and Li,Y. (2020) Advances in functional nucleic acid based paper sensors. J Mater Chem B, 8, 3213-3230.

13. Stanciu,L.A., Wei,Q., Barui,A.K. and Mohammad, N. (2021) Recent Advances in Aptamer-Based Biosensors for Global Health Applications. Annu Rev Biomed Eng,

10.1146/annurev-bioeng-082020-035644.

14. Wang,T., Chen,L., Chikkanna,A., Chen,S., Brusius,!, Sbuh,N. and Veedu,R.N. (2021) Development of nucleic acid aptamer-based lateral flow assays: A robust platform for cost-effective point-of-care diagnosis. Theranostics, 11, 5174-5196.

15. Song,Y., Song,J., Wei,X., Huang, M., Sun,M., Zhu,L., Lin,B., Shen,H., Zhu,Z. and Yang,C. (2020) Discovery of Aptamers Targeting the Receptor-Binding Domain of the SARS-CoV-2 Spike Glycoprotein. Anal Chem, 92, 9895-9900.

16. Liu,X., Wang,Y., Wu,J., Qi,J., Zeng,Z., Wan,Q., Chen,Z., Manandhar,P., Cavener,V.S., Boyle, N.R., etal. (2021) Neutralizing Aptamers Block S/RBD-ACE2 Interactions and Prevent Host Cell Infection. Angewandte Chemie International Edition, 60, 10273-10278.

17. Schmitz, A., Weber, A., Bayin,M., Breuers,S., Fieberg,V., Famulok,M. and Mayer, G. (2021) A SARS-CoV-2 Spike Binding DNA Aptamer that Inhibits Pseudo virus Infection by an RBD-Independent Mechanism*. Angew Chem Int Ed Engl, 60, 10279-10285.

18. Sun,M., Liu,S., Wei,X., Wan,S., Huang, M., Song,T., Lu,Y., Weng,X., Lin,Z., Chen,H., etal. (2021) Aptamer Blocking Strategy Inhibits SARS-CoV-2 Virus Infection. Angewandte Chemie International Edition, 60, 10266-10272.

72

7595282 19. Liu,R., He,L., Hu,Y., Luo,Z. and Zhang, J. (2020) A serological aptamer-assisted proximity ligation assay for COVID-19 diagnosis and seeking neutralizing aptamers. Chemical Science, 11, 12157-12164.

20. Gysbers,R., Tram,K., Gu,J. and Li,Y. (2015) Evolution of an Enzyme from a Noncatalytic Nucleic Acid Sequence. Sci Rep, 5, 11405.

21. Huizenga,D.E. and Szostak.J.W. (1995) A DNA Aptamer That Binds Adenosine and ATP. Biochemistry, 34, 656-665.

22. Stojanovic,M.N., de Prada,P. and Landry, D.W. (2000) Fluorescent Sensors Based on Aptamer Self-Assembly. J. Am. Chem. Soc., 122, 11547-11548.

23. Green,L.S., Jellinek,D., Jenison,R., Ostman,A., Heldin,C.-H. and Janjic,N. (1996) Inhibitory DNA Ligands to Platelet-Derived Growth Factor B-Chain. Biochemistry, 35, 14413-14424.

24. Wiegand,T.W., Williams,P.B., Dreskin,S.C., Jouvin,M.H., Kinet,J.P. and Tasset,D. (1996) High-affinity oligonucleotide ligands to human IgE inhibit binding to Fc epsilon receptor I. J Immunol, 157, 221-230.

25. Li,J., Gu,J., Zhang, H., Liu,R., Zhang, W., Mohammed-Elsabagh,M., Xia,J., Morrison, D., Zakaria,S., Chang, D., etal. (2021) A Highly Specific DNA Aptamer for RNase H2 from Clostridium difficile. ACS Appl Mater Interfaces, 13, 9464-9471.

26. AIί,M.M , Aguirre, S.D., Lazim,H. and Li,Y. (2011) Fluorogenic DNAzyme probes as bacterial indicators. Angew Chem Int Ed Engl, 50, 3751-3754.

27. Amanat,F., Stadlbauer,D., Strohmeier,S., Nguyen, T.H.O., Chromikova,V., McMahon, M., Jiang, K., Arunkumar,G.A., Jurczyszak,D., Polanco, J., et al. (2020) A serological assay to detect SARS-CoV-2 seroconversion in humans. Nat Med, 26, 1033-1036.

28. Zhu,J., Li,T., Hu,J. and Wang,E. (2010) A novel dot-blot DNAzyme-linked aptamer assay for protein detection. Anal Bioanal Chem, 397, 2923-2927.

29. Liu,M., Yin,Q., Chang, Y., Zhang, Q., Brennan, J.D. and Li,Y. (2019) In Vitro Selection of Circular DNA Aptamers for Biosensing Applications. Angew Chem Int Ed Engl, 58, 8013-8017.

73

7595282 30. Huang, Y., Yang,C., Xu,X., Xu,W. and Liu,S. (2020) Structural and functional properties of SARS-CoV-2 spike protein: potential antivirus drug development for COVID-19. Acta Pharmacologica Sinica, 41, 1141-1149.

31. Watanabe,Y., Allen, J.D., Wrapp,D., McLellan .S. and Crispin, M. (2020) Site- specific glycan analysis of the SARS-CoV-2 spike. Science , 369, 330-333.

32. Bock,L.C., Griffin, L.C., Latham, J.A., Vermaas,E.H. and Toole, J.J. (1992) Selection of single-stranded DNA molecules that bind and inhibit human thrombin. Nature, 355, 564-566.

33. Russo Krauss,I., Merlino,A., Randazzo,A., Novellino,E., Mazzarella,L. and Sica,F. (2012) High-resolution structures of two complexes between thrombin and thrombin-binding aptamer shed light on the role of cations in the aptamer inhibitory activity. Nucleic Acids Research, 40, 8119-8128.

34. Tiwari,M. (2011) Science behind human saliva. JNatSci Biol Med, 2, 53-58.

35. Hu,S., Xie,Y., Ramachandran,P., Ogorzalek Loo,R.R., Li,Y., Loo,J.A. and Wong,D.T. (2005) Large-scale identification of proteins in human salivary proteome by liquid chromatography/mass spectrometry and two-dimensional gel electrophoresis-mass spectrometry. Proteomics, 5, 1714-1728.

36. Starr, T.N., Greaney,A.J., Hilton, S.K., Ellis, D., Crawford, K.H.D., Dingens,A.S., Navarro, M.J., Bowen, J.E., Tortorici,M.A., Walls, A.C., et al. (2020) Deep Mutational Scanning of SARS-CoV-2 Receptor Binding Domain Reveals Constraints on Folding and ACE2 Binding. Cell, 182, 1295-1310.e20.

37. Recurrent emergence and transmission of a SARS-CoV-2 spike deletion H69/V70 I bioRxiv.

38. Crawford, K.H.D., Eguia,R., Dingens,A.S., Loes,A.N., Malone, K.D., Wolf,C.R., Chu,H.Y., Tortorici,M.A., Veesler,D., Murphy, M., et al. (2020) Protocol and Reagents for Pseudotyping Lend viral Particles with SARS-CoV-2 Spike Protein for Neutralization Assays. Viruses, 12.

39. Chen,X., Li,R., Pan,Z., Qian,C., Yang,Y., You,R., Zhao, I, Liu,P., Gao,L., Li,Z., et al. (2020) Human monoclonal antibodies block the binding of SARS-CoV-2 spike protein to angiotensin converting enzyme 2 receptor. Cell Mol Immunol, 17, 647-649.

74

7595282 40. Ou,X., Liu,Y., Lei,X., Li,P., Mi,D., Ren,L., Guo,L., Guo,R., Chen,T., Hu, I, etal. (2020) Characterization of spike glycoprotein of SARS-CoV-2 on virus entry and its immune cross-reactivity with SARS-CoV. Nat Commun, 11, 1620.

41. Ke,Z., Oton,J., Qu,K., Cortese,M., Zila,V., McKeane,L., Nakane,T., Zivanov,J., Neufeldt.C.J.. Cerikan,B., etal. (2020) Structures and distributions of SARS-CoV-2 spike proteins on intact virions. Nature, 588, 498-502.

42. Yao,H., Song,Y., Chen,Y., Wu,N., Xu,J., Sun,C., Zhang,!, Weng,T., Zhang, Z., Wu,Z., el al. (2020) Molecular Architecture of the SARS-CoV-2 Virus. Cell, 183, 730-738. el3.

43. Kampf,G., Voss, A. and Scheithauer,S. (2020) Inactivation of coronaviruses by heat. J Hosp Infect, 105, 348-349.

44. Abraham, J.P., Plourde,B.D. and Cheng, L. (2020) Using heat to kill SARS-CoV-2. Rev Med Virol, 10.1002/rmv.2115.

45. Hu,X., An,T., Situ,B., Hu,Y., Ou,Z., Li,Q., He,X., Zhang, Y., Tian,P., Sun,D., et al. (2020) Heat inactivation of serum interferes with the immunoanalysis of antibodies to SARS-CoV-2. J Clin Lab Anal, 34, e23411.

46. Lorsch.J.R. and S/ostak.J.W. (1994) In vitro evolution of new ribozymes with polynucleotide kinase activity. Nature, 371, 31-36.

47. Cruz,R.P.G, Withers, J.B. and Li,Y. (2004) Dinucleotide junction cleavage versatility of 8-17 deoxyribozyme. Chem Biol, 11, 57-67.

48. Davis, J.H. and Szostak,J.W. (2002) Isolation of high-affinity GTP aptamers from partially structured RNA libraries. Proc Natl Acad Sci US A, 99, 11616-11621.

49. Zhou, J. & Rossi, J. J. Bivalent Aptamers Deliver the Punch. Chemistry & Biology 15, 644-645 (2008).

50. McNamara, J. O. et al. Multivalent 4-1BB binding aptamers costimulate CD8+ T cells and inhibit tumor growth in mice. J. Clin. Invest. 118, 376-386 (2008).

51. Hughes, Q., Le, B., Gilmore, G., Baker, R. & Veedu, R. Construction of a Bivalent Thrombin Binding Aptamer and Its Antidote with Improved Properties. Molecules 22, 1770 (2017).

75

7595282 52. Kuai, H. et al. Circular Bivalent Aptamers Enable in Vivo Stability and Recognition. J. Am. Chem. Soc. 139, 9128-9131 (2017).

53. Zhou, Y., Qi, X., Liu, Y., Zhang, F. & Yan, H. DNA-Nanoscaffold-Assisted Selection of Femtomolar Bivalent Human a-Thrombin Aptamers with Potent Anticoagulant Activity. ChemBioChem 20, 2494-2503 (2019).

54. Riccardi, C., Napolitano, E., Musumeci, D. & Montesarchio, D. Dimeric and Multimeric DNA Aptamers for Highly Effective Protein Recognition. Molecules 25, 5227 (2020).

55. Torabi, R., Ranjbar, R., Halaji, M. & Heiat, M. Aptamers, the bivalent agents as probes and therapies for coronavirus infections: A systematic review. Molecular and Cellular Probes 53, 101636 (2020).

56. Lin, M., Zhang, J., Wan, H., Yan, C. & Xia, F. Rationally Designed Multivalent Aptamers Targeting Cell Surface for Biomedical Applications. ACSAppl. Mater. Interfaces 13, 9369-9389 (2021).

57. Tian, F. et al. Mutation N501Y in RBD of Spike Protein Strengthens the Interaction between COVID-19 and its Receptor ACE2. bioRxiv 2021.02.14.431117 (2021) doi: 10.1101/2021.02.14.431117.

58. Bar-On, Y. M., Flamholz, A., Phillips, R. & Milo, R. SARS-CoV-2 (COVID- 19) by the numbers. eLife 9, Art. No. e57309 (2020).

59. Neuman, B. W. et al. Supramolecular architecture of severe acute respiratory syndrome coronavirus revealed by electron cryomicroscopy. J Virol 80, 7918-7928 (2006).

60. Ranoa, D. R. E. et al. Saliva-Based Molecular Testing for SARS-CoV-2 that Bypasses RNA Extraction. bioRxiv 2020.06.18.159434 (2020) doi:10.1101/2020.06.18.159434.

61. E B Randles, B. J. & Physicochim, A. KINETICS OF RAPID ELECTRODE REACTIONS. A few investigations. Ann. Reports Chem 169, (1938).

62. Armbruster, D. A. & Pry, T. Limit of Blank, Limit of Detection and Limit of Quantitation. Clin Biochem Rev 29, S49-S52 (2008).

76

7595282 63. Lee, J.-H. et al. A novel rapid detection for SARS-CoV-2 spike 1 antigens using human angiotensin converting enzyme 2 (ACE2). Biosensors and Bioelectronics 171, 112715 (2021).

64. Torrente-Rodriguez, R. M. et al. SARS-CoV-2 RapidPlex: A Graphene-Based Multiplexed Telemedicine Platform for Rapid and Low-Cost COVID-19 Diagnosis and Monitoring. Matter 3, 1981-1998 (2020).

65. Yousefi, H. et al. Detection of SARS-CoV-2 Viral Particles Using Direct, Reagent-Free Electrochemical Sensing. Journal of the American Chemical Society 143, 1722-1727 (2021).

66. Zakashansky, J. A. et al. Detection of the SARS-CoV-2 spike protein in saliva with Shrinky-Dink© electrodes. Anal. Methods 13, 874-883 (2021).

67. Seo, G. et al. Rapid Detection of COVID-19 Causative Virus (SARS-CoV-2) in Human Nasopharyngeal Swab Specimens Using Field-Effect Transistor-Based Biosensor. ACS Nano 14, 5135-5142 (2020).

68. Mahari, S., Roberts, A., Shahdeo, D. & Gandhi, S. eCovSens-Ultrasensitive Novel In-House Built Printed Circuit Board Based Electrochemical Device for Rapid Detection of nCovid-19 antigen, a spike protein domain 1 of SARS-CoV-2. http://biorxiv.org/lookup/doi/10.1101/2020.04.24.059204 (2020) doi: 10.1101/2020.04.24.059204.

69. Singh, N. K. et al. Hitting the diagnostic sweet spot: Point-of-care SARS- CoV-2 salivary antigen testing with an off-the-shelf glucometer. Biosensors and Bioelectronics 180, 113111 (2021).

70. Mahshid, S. S., Flynn, S. E. & Mahshid, S. The potential application of electrochemical biosensors in the COVID-19 pandemic: A perspective on the rapid diagnostics of SARS-CoV-2. Biosens Bioelectron 176, 112905 (2021).

71. Canada, H. COVID-19 antigen testing devices: Notice on minimum value for sensitivity aem https://www.canada.ca/en/health-canada/services/drugs-health - products/covidl9-industry/medical-devices/testing/antigen.ht ml (2020).

72. Center for Devices and Radiological Health. Policy for Coronavirus Disease- 2019 Tests During the Public Health Emergency (Revised). U.S. Food and Drug

77

7595282 Administration https://www.fda.gov/regulatory-information/search-fda-guidan ce- documents/policy-coronavirus-disease-2019-tests-during-publi c-health-emergency- revised (2020).

73. Office of the Commissioner. Emergency Use Authorization of Medical Products and Related Authorities. U.S. Food and Drug Administration https://www.fda.gov/regulatory-information/search-fda-guidan ce- documents/emergency-use-authorization-medical-products-and-r elated-authorities (2019).

74. Wajnberg, A. et al. Robust neutralizing antibodies to SARS-CoV-2 infection persist for months. Science 370, 1227-1230 (2020).

75. Isho, B. et al. Persistence of serum and saliva antibody responses to SARS- CoV-2 spike antigens in COVID-19 patients. Science Immunology 5, (2020).

76. Human Salivary Proteome Wiki. https://salivaryproteome.nidcr.nih.gov/public/index.php/Main _Page.

77. Ojha, Y. R. Selection and Characterization of ssDNA Aptamers for Salivary Peptide Histatin 3 and Their Application Towards Assay and Point-of-Care Biosensing. (The University of Toledo, 2019).

78

7595282