FIELD OF THE INVENTION

The invention relates to a combination therapy for the treatment of vascular or respiratory diseases.

BACKGROUND OF THE INVENTION

Vascular disease is a pathological state of large and medium sized muscular arteries and is triggered by endothelial cell dysfunction. Because of factors like pathogens, oxidized LDL particles and other inflammatory stimuli, endothelial cells become activated. This leads to changes in their characteristics: endothelial cells start to excrete cytokines and chemokines and express adhesion molecules on their surface. This in turn results in recruitment of white blood cells (monocytes and lymphocytes), which can infiltrate the blood vessel wall. Stimulation of the smooth muscle cell layer with cytokines produced by endothelial cells and recruited white blood cells causes smooth muscle cells to proliferate and migrate towards the blood vessel lumen. This process causes thickening of the vessel wall, forming a plaque consisting of proliferating smooth muscle cells, macrophages and various types of lymphocytes. This plaque results in obstructed blood flow leading to diminished amounts of oxygen and nutrients that reach the target organ. In the final stages, the plaque may also rupture causing the formation of clots, and as a result, strokes.

Respiratory disease encompasses pathological conditions affecting the organs and tissues that make gas exchange possible in higher organisms, and includes conditions of the upper respiratory tract, trachea, bronchi, bronchioles, alveoli, pleura and pleural cavity, and the nerves and muscles of breathing. Respiratory diseases range from mild and self-limiting, such as the common cold, to life-threatening entities like bacterial pneumonia, pulmonary embolism, and lung cancer. Pulmonary arterial hypertension (PAH) is a rare progressive disease defined by elevated pulmonary arterial pressure, often causing death from right heart failure. The pathology is characterized by increased muscularization and obliteration of small pulmonary arteries. Heterozygous germ-line mutations in the BMPR2 gene, encoding l the bone morphogenetic protein type II receptor (BMPR-II), underlie approximately 70% of heritable (HPAH) and 20% of idiopathic (IPAH) cases. Most BMPR2 mutations cause haploinsufficiency and importantly, pulmonary vascular BMPR-II levels are reduced in non-genetic forms of PAH in animals and humans.

Despite BMPR2 mutations being the commonest genetic cause for PAH, the penetrance of mutations in carriers is only 20-30%, suggesting that additional factors are required for disease initiation and progression. One of the factors implicated as a trigger for the disease is inflammation (see for example Sutendra et al., 201 1 , J. Mol. Biol. 89: 771 ; Kim et al., 2013, Arterioscler. Thromb. Vase. Biol. 33: 1350; Kwon et al., 2013, Korean J. Pediatr. 56: 1 16; Wang et al., 2013, Vase. Pharmacol. 58: 71 ; Zhang et al., 2016, Int. J. Rheum. Dis. 19: 192). PAH patients exhibit heightened circulating levels of inflammatory cytokines, including for example tumor necrosis factor a (TNFa), IL-1 β, IL-6 and IL-8, that correlate with poor survival. However, Henriques-Coelho et al. (2013, Rev. Port. Cardiol. 27: 341 ) reported that administration of etanercept, an anti- TNFa antibody, to rats with monocrotaline-induced pulmonary hypertension, did not lead to a significant improvement in pulmonary hypertension symptoms.

WO2016/005756 (which is hereby incorporated by reference in its entirety) discloses a composition for treating a vascular or respiratory disease such as PAH, comprising a polypeptide selected from bone morphogenetic protein 10 (BMP10), or a bone morphogenetic protein 9 (BMP9) variant lacking osteogenic activity. A review of the use of recombinant BMP ligands and other approaches targeting BMPR-II in the treatment of PAH is provided in Ormiston et al., 2015, Global Cardiolology Science and Practice 47: 1 .

The present invention is directed to improved methods and compositions for treating a vascular or respiratory disease such as PAH.

SUMMARY OF THE INVENTION

According to one aspect of the invention, there is provided a pharmaceutical composition comprising: (1 ) a polypeptide selected from bone morphogenetic protein 10 (BMP10), including the prodomain bound form of BMP10 (pro.BMPI O), and a bone morphogenetic protein 9 (BMP9) variant lacking osteogenic activity; and (2) a TNFa inhibitor. In another aspect of the invention there is provided a pharmaceutical composition as defined herein for use in the treatment of a vascular disease or a respiratory disease, wherein the polypeptide and the TNFa inhibitor are prepared to be administered to a patient in need thereof simultaneously, contemporaneously or concomitantly. Also provided is method of treating a vascular disease or a respiratory disease in a patient in need thereof, the method comprising administering to the patient an effective amount of a polypeptide as defined herein, in combination with an effective amount of a TNFa inhibitor as defined herein. In the invention, the TNFa inhibitor may be administered: (a) prior to administration of the polypeptide as defined herein; (b) in doses alternating with administration of the polypeptide as defined herein; and/or (c) in reducing doses together or alternating with administration of the polypeptide as defined herein. The vascular disease may be selected from: pulmonary hypertension; pulmonary arterial hypertension (PAH); hereditary haemorrhagic telangiectasia (HHT, also known as Osler-Weber-Rendu syndrome); atherosclerosis; and hepatopulmonary syndrome.

The respiratory disease may be selected from: obstructive lung diseases such as chronic obstructive pulmonary disease (COPD), chronic bronchitis and emphysema; pulmonary vascular diseases such as pulmonary edema and pulmonary hemorrhage; respiratory failure and respiratory distress syndrome, such as acute lung injury and acute respiratory distress syndrome; and interstitial lung diseases, such as idiopathic pulmonary fibrosis.

Further provided according to the invention is a package comprising:

a) a first pharmaceutical composition comprising a polypeptide as defined herein; b) a second pharmaceutical composition comprising a TNFa inhibitor as defined herein; and

c) instructions for use of the first and second pharmaceutical compositions together to treat a subject afflicted with a vascular disease or a respiratory disease, such as PAH.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 . TNFa reduces full length BMPR-II protein expression and induces BMPR-II cleavage in human PASMCs. (A and B) BMPR2 mRNA expression in human dPASMCs (A) and PAECs (B) treated with IL-1 β (1 ng/ml), IL-6 (25 ng/ml), IL-8 (25 ng/ml) or TNFa (1 ng/ml) for 24 h (n = 3; ^* P<0.05 Student's ί-test). Y-axis shows BMPR2 mRNA fold change (relative to 0.1 % in A and relative to 2% in B). (C and D) Representative immunoblots (n=3 experiments) for BMPR-II in TNFa-treated (1 ng/ml) dPASMCs (C) and PAECs (D). (E) Representative confocal images of TNFa staining in lung sections from control, idiopathic and heritable PAH subjects. Scale bars, 100 μηι. (F) Assessment of right ventricular systolic pressure (RVSP) in Bmpr2 ^+/+ , SP- C/Tnf/Bmpr2 ⁺ , Bmpr2 ^+/~ and SP-C/Tnf/Bmpr2 ^+/~ mice (n = 4 per group). Y-axis shows RVSP (mmHg). (G) Representative immunoblots of lung BMPR-II expression in Bmpr2 ^+/+ and SP-C/Tnf/Bmpr2 ^+/+ mice (n = 4). (H) Representative immunoblots (n=3 experiments) of BMPR-II, ADAM 10 and ADAM 17 in siRNA-transfected dPASMCs with or without 24 h TNFa (1 ng/ml) treatment (DH1 - DharmaFect alone, siCP - siRNA control). (I) ELISA measurement of soluble BMPR-II (sBMPR-ll) in media from TNFa- treated (1 ng/ml, 24 h) dPASMCs expressing wild-type and mutant 5'-myc-tagged BMPR-II constructs (n = 3). Y-axis shows sBMPR-ll (ng/ml). One-way ANOVA with post-hoc Tukey's HSD analysis used in F and I. ^* P≤ 0.05, ^*** P≤ 0.001 . Error bars represent mean + s.e.m. Lower molecular mass BMPR-II is indicated by an arrow in C, G and H.

Figure 2. TNFa reduces BMPR-II protein and mRNA expression via NF-KB//?£LA (A and B) Representative immunoblots (n=3 experiments) of BMPR-II in human dPASMCs (A) and PAECs (B) treated with IL-1 β (1 ng/ml), IL-6 (25 ng/ml), IL-8 (25 ng/ml) and TNFa (1 ng/ml) for 24 h. The data shown are representative of three experiments. (C and D) BMPR2 mRNA expression in (C) human dPASMCs and (D) PAECs treated with TNFa (1 ng/ml) for 1 , 4, 8 or 24 h {n = 3; Student's ί-test). Y-axis shows BMPR2 mRNA fold change (relative to 0.1 % in C and relative to 2% in D). (E) BMPR2 mRNA expression in human control dPASMCs and PAECs transfected with DharmaFectl alone (DH1 ), s RELA or non-targeting siRNA control (siCP). Y-axis shows BMPR2 mRNA fold change (relative to Control siCP). Cells were treated with TNFa (1 ng/ml) for 24 h (n = 3; Student's f-test). ^* P≤ 0.05, ^** P≤ 0.01 , ^*** P≤ 0.001 . Error bars represent mean + s.e.m. Lower molecular mass BMPR-II is indicated by arrow in A. Figure 3. TNFa specifically reduces BMPR-II protein expression and induces a lower molecular mass band in SMCs. (A) Representative immunoblots (n=3 experiments) of BMPR-II in human control dPASMCs transfected with DharmaFectl alone (DH1 ), s BMPR2 or non-targeting siRNA control (siCP). Cells were treated with TNFa (1 ng/ml) for 24 h. (B) Representative immunoblots (n=3 experiments) of BMPR- II in mouse and rat PASMCs treated with TNFa (1 ng/ml) for 24 h. (C) Representative immunoblots (n=3 experiments) of BMPR-II in human control proximal and aortic PASMCs treated with TNFa (1 ng/ml) for 24 h. Lower molecular mass BMPR-II is indicated by an arrow. Figure 4. Lung specific expression of TNFa induces pulmonary hypertension at 8-9 weeks of age. Bmpr2 ^+/+ , SP-C/Tnf x Bmpr2 ^+/+ , Bmpr2 ^+/ - and SP-C/Tnfx Bmpr2 ^+/+ (n = 4 of each) transgenic mice were assessed at 8-9 weeks old. (A) Assessment of right ventricular hypertrophy (Fulton index). Y-axis shows Fulton index (RV/(LV+S)). (B) Quantification of the numbers of non-, partially and fully muscularized arteries as a percentage of total alveolar wall and duct arteries (n = 6 for all groups). Y-axis shows % Vessels. (C) Assessment of pulmonary arterial wall thickness as a percentage of luminal diameter (n = 6 for all groups). Y-axis shows % wall thickness for all vessels. (D) Bmpr2 mRNA expression in mouse lungs and livers. Y-axis shows Bmpr2 mRNA Relative Expression. (E) Representative immunoblot of BMPR-II expression in livers from Bmpr2 ^+/+ and SP-C/Tnf x Bmpr2 ^+/+ (n = 4). (F) Bmp6 and (G) Bmp2 mRNA expression in mouse lungs and livers. Y-axis in F shows Bmp6 mRNA Relative Expression. Y-axis in G shows Bmpr2 mRNA Relative Expression. One-way ANOVA with post-hoc Tukey's HSD analysis for multiple comparisons used in A, C, D, F and G. ^* P≤ 0.05, ^** P≤ 0.01 , ^*** P≤ 0.001 . Error bars represent mean + s.e.m.

Figure 5. Release of sBMPR-ll can be inhibited by a pan-metalloprotease inhibitor. (A) Representative immunoblot (n=3 experiments) of immunoprecipitated sBMPR-ll in conditioned media from control human dPASMCs transfected with 5'-myc- tagged BMPR-II and treated with TNFa (1 ng/ml) for 24 h. Samples were deglycosylated with PNGaseF. Myc expression was assessed using immunoblotting. To ensure equal loading 0.1 % FBS was loaded and assessed by Coomassie blue. (B) ELISA assessment of sBMPR-ll release from control human dPASMCs treated with TNFa (1 ng/ml) for 24 h (n = 3; Student's f-test). Y-axis shows sBMPR-ll (ng/ml). (C) Representative immunoblot of BMPR-II expression of control human dPASMCs pre- treated with batimastat (BB94) (10 ng/ml) for 30 min prior 24 h TNFa (1 ng/ml) treatment. (D) Representative immunoblots (n=3 experiments) of BMPR-II, myc and immunoprecipitated sBMPR-ll in conditioned media from control human dPASMCs transfected with 5'-myc-tagged BMPR-II and pre-treated with batimastat (BB94) (10 ng/ml) for 30 min prior to 24 h TNFa (1 ng/ml) treatment. Blots were reprobed for a- tubulin to ensure equal loading. ^*** P≤ 0.001 . Error bars represent mean + s.e.m. Lower molecular mass BMPR-II is indicated by an arrow in C and D. Figure 6. TNFa induces ADAM10 and ADAM17 expression and reduces BMPR-II protein expression and induces a lower molecular mass band in SMCs. (A and B)

ADAM10, ADAM12, ADAM15, ADAM17, MMP14, MMP15, MMP16, MMP17 and MMP24 mRNA expression in human control dPASMCs (A) and PAECs (B) treated with TNFa (1 ng/ml) for 24 h. (n = 4; Student's f-test). Y-axis shows mRNA fold change (relative to 0.1 %). (C) Representative immunoblots of ADAM 10 and ADAM 17 expression in lungs from 8 week old Bmpr2 ^{+ +} (n = 3) and SP-C/Tnf/Bmpr^ (n = 3) transgenic mice. (D) Schematic of pharmacological and siRNA inhibition of ADAM10 and 17. (E) Representative immunoblots (n=3 experiments) of BMPR-II, myc and immunoprecipitated sBMPR-ll in conditioned media from control human dPASMCs transfected with 5'-myc-tagged BMPR-II and pre-treated with GI254023X (10 μΜ), D1 (A12) (50 nM) or TAPI-1 (10 μΜ) for 30 min prior to 24 h TNFa (1 ng/ml) treatment. ^* P≤ 0.05, ^** P≤ 0.01 . Error bars represent mean + s.e.m. Lower molecular mass BMPR-II is indicated by an arrow in E. Figure 7. Soluble BMPR-II acts as a ligand trap. (A) Schematic of BMPR-II (SP - signal peptide; ECD - ectodomain; TM - transmembrane; ICD - intracellular cytoplasmic domain). Valines (in bold) in the 5'-myc-BMPR-ll WT transmembrane domain sequence (SEQ ID NO: 8) were converted to alanine (in bold) generating the V158A (SEQ ID NO: 9), V160A (SEQ ID NO: 10), V163A (SEQ ID NO: 1 1 ) and V166A (SEQ ID NO: 12) constructs (marked with " ^* "). (B) Representative immunoblots (n=3 experiments) of BMPR-II, myc and immunoprecipitated sBMPR-ll from 24 h TNFa- treated (1 ng/ml) control human dPASMCs transfected with 5'-myc-BMPR-ll constructs. (C and D) Luciferase assessment of ligand trap activity in C2C12-BRE cells. (C) Cells were treated with a commercial BMPR-II ectodomain (BMPR-II ECD) and BMP2 or BMP4 (10 ng/ml) for 1 h (n = 3). Y-axis shows Luciferase activity (RLU/ g protein). (D) Cells were treated with BMP2 or BMP4 (10 ng/ml) diluted in media from 24 h TNFa-treated (1 ng/ml) control dPASMCs transfected with 5'-myc- BMPR-II constructs (n = 3). Y-axis shows Luciferase activity (RLU^g protein). (E and F) Proliferation of human proximal PASMCs. (E) PASMCs were treated with BMP2 or BMP4 (10 ng/ml) ± BMPR-II-ECD (25 μς/ηιΙ) and counted (n = 3; Student's f-test, ^** P≤ 0.01 , ^*** P ≤ 0.001 compared with 5% FBS; ^### P ≤ 0.001 compared with 5% FBS+TNFa). (F) PASMCs were treated with BMP2 or BMP4 (10 ng/ml) ± TNFa (1 ng/ml) and counted (n = 3; Student's f-test, ^** P≤ 0.01 , ^*** P≤ 0.001 compared with 5% FBS; ###P≤ 0.001 compared with 5% FBS + TNFa). Y-axis in E and F shows Cell number (x10 ³ ). One-way ANOVA with post-hoc Tukey's HSD analysis used in C and D. ^{** ###} P≤ 0.001 . Error bars represent mean + s.e.m. Lower molecular mass BMPR-II is indicated by an arrow in B.

Figure 8. TNFa alters BMP2 and BMP6 signaling dynamics and influences PASMC proliferation. (A) BMPR2 mRNA expression in TNFa-treated (1 ng/ml, 24 h) human control and HPAH dPASMCs (n = 3; Student's f-test). Y-axis shows BMPR2 mRNA fold change (relative to serum control). (B and C) Signaling in dPASMCs with or without TNFa (1 ng/ml) for 23 h prior to 1 h BMP2 (10 ng/ml) or BMP6 (10 ng/ml) stimulation. (B) Representative immunoblots of phospho-Smad 1/5, Smad 1 and ID1 (n=3 control and HPAH lines). (C) ID1 mRNA expression (n = 3). Y-axis shows ID1 mRNA fold change (relative to 0.1 %). (D) Proliferation of human control and HPAH dPASMCs at 6 days after BMP2 (10 ng/ml), BMP4 (10 ng/ml) or BMP6 (10, 25 or 50 ng/ml) treatment (n = 3). (E) Proliferation of human control and HPAH dPASMCs at 6 days after TNFa (1 ng/ml) and/or BMP6 (10 or 50 ng/ml) treatment (n = 3 control and HPAH cell lines). Y-axis in D and E shows Cell proliferation (%) (normalised to 5% FBS). (F) Proliferation of human control dPASMCs on day 6 after s BMPR2 transfection and TNFa (1 ng/ml) and/or BMP6 (50 ng/ml) treatment as indicated (n = 3, DH1 - DharmaFect alone, siCP - siRNA control). (G) Proliferation of HPAH dPASMCs expressing full-length wild-type and kinase-dead D485G mutant BMPR-II adenovirus on day 6 after TNFa (1 ng/ml) and/or BMP6 (50 ng/ml) treatment (n = 3). Y- axis in F and G shows Cell proliferation (%) (normalised to siCP 5% FBS). One-way ANOVA with post-hoc Tukey's HSD analysis in C, D, E, F and G. ^* P≤ 0.05, ^** P≤ 0.01 , ^*** P≤ 0.001 . Error bars represent mean + s.e.m.

Figure 9. TNFa alters BMP2 and BMP6 signaling dynamics. (A) Representative immunoblots of BMPR-II expression in control and HPAH dPASMCs stimulated with TNFa (1 ng/ml) for 24 h (n=3 control and HPAH cell lines). (B) Immunoblotting of phospho-Smad 1 /5, total Smad 1 and ID1 expression in control and HPAH dPASMCs co-stimulated with TNFa (1 ng/ml) and/or BMP2 or BMP6 (both 10 ng/ml) for 1 h (n=3 control and HPAH cell lines). (C) ID1 mRNA expression in control and HPAH dPASMCs co-stimulated with TNFa (1 ng/ml) and/or BMP2 or BMP6 (both 10 ng/ml) for 1 h (n = 3; one-way ANOVA with post-hoc Tukey's HSD analysis for multiple comparisons). Y-axis shows ID1 mRNA fold change (relative to 0.1 %). ^** p < 0.01 . Error bars represent mean + s.e.m. Lower molecular mass BMPR-II is indicated by an arrow in A.

Figure 10. BMP2 and BMP6 are the most abundant expressed ligands in vascular cells. (A and B) Relative transcript abundance of BMP2, BMP4, BMP6, BMP7 and BMP9, normalized to B2M and ACTB as detailed in the methods, in human aortic (AECs), immortalized microvascular (HMEC1 ), umbilical vein (HUVEC), microvascular lung (HMVLEC) and pulmonary artery (PAEC) endothelial cells and smooth muscle cells (dPASMCs) (n=3 independent experiments. Y-axis in A and B shows Relative Transcript Abundance. (C - E) mRNA expression of BMP2 (C), BMP6 (D), BMP4, BMP7 and BMP9 (E) in control human dPASMCs and PAECs treated with TNFa (1 ng/ml) for 24 h (n = 5; Student's f-test). Y-axis in C shows BMP2 mRNA (relative to 0.1 %). Y-axis in D shows BMP6 mRNA (relative to 0.1 %). Y-axis in E shows BMP mRNA (relative to 0.1 %). (F and G) BMP2 and BMP6 mRNA expression in control human dPASMCs and PAECs transfected with s RELA with or without 24 h TNFa (1 ng/ml) treatment (n = 3; one-way ANOVA; DH1 - DharmaFectl , siCP - non-targeting siRNA). Y-axis in F shows BMP2 mRNA fold change (relative to Control siCP). Y-axis in G shows BMP6 mRNA fold change (relative to Control siCP). (H and I) BMP2 and BMP6 mRNA expression in control and HPAH dPASMCs stimulated with or without TNFa (1 ng/ml) for 24 h (n = 3; one-way ANOVA with post-hoc Tukey's HSD analysis for multiple comparisons). Y-axis in H shows BMP2 mRNA fold change (relative to serum control). Y-axis in I shows BMP6 mRNA fold change (relative to serum control). ^* P≤ 0.05, ^** P≤ 0.01 , ^*** P≤ 0.001 . Error bars represent mean + s.e.m.

Figure 11. LDN193189 inhibits enhanced BMP6 signaling by TNFa in PASMCs but does not affect the induction of interleukins. (A) C2C12-BRE mouse myoblasts were treated with TNFa (1 ng/ml), BMP2 (10 ng/ml) or BMP6 (10 ng/ml) in the presence or absence of BMP2 mAb (1 μg/ml) or BMP6 mAb (1 μg/ml) for 24 h prior to measuring luciferase activity (n = 3; repeated measures ANOVA). Y-axis shows Luciferase activity (RLU/mg protein). (B) C2C12-BRE mouse myoblasts were treated with TNFa (1 ng/ml) and LDN193189 (250 nM) for 16 h prior to measuring luciferase activity (n = 3; repeated measures ANOVA with post-hoc Tukey's test). Y-axis shows Luciferase activity (RLU/mg protein). (C and D) ID1 and IL8 mRNA expression in control human dPASMCs treated with LDN193189 (250 nM) and/or TNFa (1 ng/ml) for 16 h (n = 5; one-way ANOVA with post-hoc Tukey's HSD analysis). Y-axis in C shows ID1 mRNA fold change (relative to 0.1 %). Y-axis in D shows IL8 mRNA fold change (relative to 0.1 %). ^*** P≤ 0.001 . Error bars represent mean + s.e.m.

Figure 12. ALK2 and ACTR-IIA are required for BMP6 mediated HPAH PASMC proliferation and altered signaling. (A and B) Proliferation of human control (A) and HPAH (B) dPASMCs at 6 days after TNFa (1 ng/ml) and/or BMP6 (50 ng/ml) treatment in the presence of LDN-193189 (250 nM) (n = 3 control and HPAH cell lines). Y-axis in A and B shows Cell proliferation (%) (normalised to control). (C and D) Proliferation of human control (C) or HPAH (D) dPASMCs on day 6 following s ALK2 transfection and TNFa (1 ng/ml) and/or BMP6 (50 ng/ml) treatment (n = 3 control and HPAH cell lines). Y-axis in C and D shows Cell proliferation (%) (normalised to siCP 5% FBS). (E and F) Human HPAH dPASMCs following s ACVR2A transfection and treatment with TNFa (1 ng/ml) and/or BMP2 (10ng/ml) or BMP6 (10 ng/ml) for 24 h. (E) Representative (n-=3 HPAH cell lines) immunoblots of phospho-Smad 1 /5, total Smad 1 and ID1 expression. (F) ID1 mRNA expression (n = 3). Y-axis shows ID1 mRNA fold change (relative to 0.1 %). (G) HPAH dPASMC proliferation on day 6 following s ACVR2A transfection and treatment with TNFa (1 ng/ml) and/or BMP6 (50 ng/ml) (n = 3 HPAH cell lines). Y-axis shows Cell proliferation (%) (normalised to siCP 5% FBS). One-way ANOVA with post-hoc Tukey's HSD analysis used in A, B, C, D, F and G. ^* P≤ 0.05, ^** P≤ 0.01 , ^*** P≤ 0.001 . Error bars and mean + s.e.m. (DH1 - DharmaFect; siCP - non-targeting siRNA)

Figure 13. TNFa induces ACVR2A expression in HPAH PASMCs. (A) ACVR2A mRNA expression in control and HPAH dPASMCs stimulated with TNFa (1 ng/ml) for 24 h (n = 3; Student's f-test). Y-axis shows ACVR2A mRNA fold change (relative to 0.1 % control). (B) ALK2, ALK3 and ALK6 mRNA expression in human dPASMCs from disease-free controls and HPAH patients stimulated with TNFa (1 ng/ml) for 24 h. Y- axis shows mRNA fold change (relative to ALK2 0.1 %). ^*** P≤ 0.001 . Error bars represent mean + s.e.m.

Figure 14. TNFa alters NOTCH expression. (A) Immunoblotting for NOTCH1 , NOTCH2 and NOTCH3 expression in control and HPAH dPASMCs treated with TNFa (1 ng/ml) and/or BMP2 or BMP6 (both 10 ng/ml) for 1 h. Representative experiment of three control and HPAH dPASMCs. (B and C) Densitometry of NOTCH-ICD immunoblots relative to a-tubulin levels, (n = 3; one-way ANOVA with post-hoc Tukey's HSD analysis for multiple comparisons). Y-axis in B and C shows Protein expression (relative to β-actin). ^*** p < 0.001 . Error bars represent mean + s.e.m. Figure 15. NOTCH and its targets are altered by TNFa in HPAH PASMCs. (A-F) mRNA expression of NOTCH1 (A), NOTCH2 (B), NOTCH3 (C), HEY1 (D), HEY 2 (E) and HES1 (F) in control and HPAH dPASMCs stimulated with TNFa (1 ng/ml) and/or BMP2 or BMP6 (both 10 ng/ml) for 1 h. Y-axis in A shows NOTCH1 mRNA fold change (relative to 0.1 %). Y-axis in B shows NOTCH2 mRNA fold change (relative to 0.1 %). Y- axis in C shows NOTCH3 mRNA fold change (relative to control 0.1 %). Y-axis in D shows HEY1 mRNA fold change (relative to 0.1 %). Y-axis in E shows HEY2 mRNA fold change (relative to control 0.1 %). Y-axis in F shows HES1 mRNA fold change (relative to 0.1 %). ^* P≤ 0.05, ^** P≤ 0.01 , ^*** P≤ 0.001 . Error bars represent mean + s.e.m.

Figure 16. HEY1 and HEY2 are targets of NOTCH2; HES1 is a target of NOTCH3.

(A - C) mRNA expression of HEY1 (A), HEY2 (B) and HES1 (C) in human HPAH dPASMCs transfected with s NOTCH2 and treated with TNFa (1 ng/ml) and/or BMP6 (10 ng/ml) for 1 h (n = 3). (D - F) mRNA expression of HEY1 (D), HEY2 (E) and HES1. Y-axis in A and D shows HEY1 mRNA fold change (relative to 0.1 % siCP). Y-axis in B and E shows HEY 2 mRNA fold change (relative to 0.1 % siCP). (F) in human HPAH dPASMCs transfected with s NOTCH3 and treated with TNFa (1 ng/ml) and/or BMP6 (10 ng/ml) for 1 h (n = 3). Y-axis in C and F shows HES1 mRNA fold change (relative to 0.1 % siCP). (G) Immunoblot of NOTCH2 and NOTCH3 expression of human HPAH dPASMCs transfected with s NOTCH2 or s NOTCH3. One-way ANOVA with post-hoc Tukey's HSD analysis for multiple comparisons used in A, B and F. ^* P≤ 0.05, ^** P≤ 0.01 , ^*** p≤ 0.001 . Error bars represent mean + s.e.m. (DH1 - DharmaFectl ; siCP - non-targeting control.)

Figure 17. TNFa alters NOTCH expression. (A) Representative immunoblots of NOTCH1 , NOTCH2 and NOTCH3 in human control dPASMCs following s\BMPR2 transfection and 1 h TNFa (1 ng/ml) and/or BMP6 (10 ng/ml) treatment (n=3 experiments). (B) Representative immunoblots of NOTCH1 , NOTCH2 and NOTCH3 in human HPAH dPASMCs following s ACVR2A transfection and 1 h TNFa (1 ng/ml) and/or BMP6 (10 ng/ml) treatment (n=3 experiments). (C and D) Notch2 (C) and Notch3 (D) mRNA expression in lungs from Bmpr2 ^+/+ , SP-C/Tnf/Bmpr2 ^+/+ , Bmpr2 ^+/~ and SP-C/Tnf/Bmpr2 ^+/~ (n = 4 per group) mice. Y-axis in C shows Notch2 mRNA Relative Expression. Y-axis in D shows Notch3 mRNA Relative Expression. (E) Representative images of immunohistochemical staining for NOTCH2, NOTCH3 and aSMA in lung sections from control and HPAH subjects. Scale bars, 100 μηι. (F and G) Human HPAH dPASMCs proliferation on day 6 following s\NOTCH2 (F) or s\NOTCH3 (G) transfection and TNFa (1 ng/ml) and/or BMP6 (50 ng/ml) treatment (n = 3 cell lines). (H and I) Proliferation of human control dPASMCs on day 6 following s NOTCH2 (H) or s NOTCH3 (I) transfection and TNFa (1 ng/ml) and/or BMP6 (50 ng/ml) treatment (n = 3 cell lines). Y-axis in F, G, H and I shows Cell proliferation (%) (normalised to siCP). One-way ANOVA with post-hoc Tukey's HSD analysis used in C, D, F and I. ^* P≤ 0.05, ^** P≤ 0.01 , ^*** P≤ 0.001 . Error bars represent mean + s.e.m. (DH1 - DharmaFect; siCP - non-targeting siRNA)

Figure 18. TNFa differentially alters NOTCH expression in BMPR2 deficiency compared to the normal state. (A - C) mRNA expression of NOTCH1 (A), NOTCH2 (B) and NOTCH3 (C) in human control dPASMCs transfected with s BMPR2 and/or s ACVR2A followed by treatment with TNFa (1 ng/ml) and/or BMP6 (10 ng/ml) for 1 h (n = 3; n = 4 for NOTCH3; DH1 - DharmaFectl ; siCP - non-targeting control). Y-axis in A shows NOTCH1 mRNA fold change (relative to 0.1 % siCP). Y-axis in B shows NOTCH2 mRNA fold change (relative to siCP 0.1 %). Y-axis in C shows NOTCH3 mRNA fold change (relative to siCP 0.1 %). (D) Immunoblots of Notch2 and Notch3 expression in lungs and livers from 8-9 week old Bmpr2 ^+/+ , SP-C/Tnf/Bmpr2 ^+/+ , Bmpr2 ^+/~ and SP-C/Tnf/Bmpr2 ^+/~ transgenic mice (n = 3 per group). (E and F) Notch2 and Notch3 mRNA expression in livers from 8-9 week old Bmpr2 ^+/+ , SP- C/Tnf/Bmpr2 ^+/+ , Bmpr2 ^+/~ and SP-C/Tnf/Bmpr2 ^+/~ transgenic mice (n = 4). Y-axis in E shows Notch2 mRNA Relative Expression. Y-axis in F shows Notch3 mRNA Relative Expression. One-way ANOVA with post-hoc Tukey's HSD analysis for multiple comparisons used in B, C, E and F. ^* P≤ 0.05, ^** P≤ 0.01 , ^*** P≤ 0.001 . Error bars represent mean + s.e.m.

Figure 19. DAPT inhibits TNFa influence on PASMC proliferation. (A and B) Day 6 assessment of human HPAH (A) and control (B) dPASMCs proliferation following treatment pre-treatment with DAPT (5 μΜ) for 30 min before subsequent TNFa (1 ng/ml) and/or BMP6 (50 ng/ml) treatment for 24 h (n = 3; Student's f-test). Y-axis in A and B shows Cell proliferation (%) normalised to vehicle control. (C) Day 6 assessment of human HPAH dPASMC proliferation after transfection with s HEY1 and/or s HEY2 and treatment every 48 h with TNFa (1 ng/ml) and/or BMP6 (50 ng/ml) (n = 3; one-way ANOVA with post-hoc Tukey's HSD analysis; (DH1 - DharmaFectl ; siCP - non- targeting control). Y-axis in C shows Cell proliferation (%) (normalised to siCP 5% FBS). ^* P≤ 0.05, ^** P≤ 0.01 , ^*** P≤ 0.001 . Error bars represent mean + s.e.m.

Figure 20. SRC kinases are activated by TNFa and BMP6, and can regulate Notch. (A) Schematic depicting SRC phosphorylation. (B) Representative phospho- SRC Tyr527, Tyr416 and total SRC immunoblots (SRCs) of control and HPAH dPASMCs (n=3 lines) treated with TNFa (1 ng/ml) and/or BMP2 (10 ng/ml) or BMP6 (10 ng/ml) for 30 min. (C) Representative immunoblots for SRCs in control dPASMCs following s BMPR2 transfection and 30 min TNFa (1 ng/ml) and/or BMP6 (10 ng/ml) treatment (n=3 experiments). (D) Representative immunoblots for SRCs in HPAH dPASMCs following s ACVR2A transfection and 30 min TNFa (1 ng/ml) and/or BMP6 (10 ng/ml) treatment (n=3 lines). (E and F) NOTCH2 and NOTCH3 mRNA expression in human HPAH dPASMCs following transfection with siFVTV, si YES or s SRC and 30min TNFa (1 ng/ml) or BMP6 (10 ng/ml) treatment (n = 3). Y-axis in E shows NOTCH2 mRNA Relative Expression. Y-axis in F shows NOTCH3 mRNA Relative Expression. (G) Proliferation of human HPAH dPASMCs on day 6 following siFVTV, si YES or s SRC transfection and TNFa (1 ng/ml) and/or BMP6 (50 ng/ml) treatment (n = 3). (H) Proliferation of human control dPASMCs on day 6 following siFVTV, si VES or s SRC transfection and TNFa (1 ng/ml) and/or BMP6 (50 ng/ml) treatment (n = 3). Y- axis in G and H shows Cell proliferation (normalised to siCP). One-way ANOVA with post-hoc Tukey's HSD analysis used in E, F, G and H. ^* P≤ 0.05, ^** P≤ 0.01 , ^*** P≤ 0.001 . Error bars represent mean + s.e.m. (DH1 - DharmaFect; siCP - non-targeting siRNA) Figure 21. Inhibition of SRC kinases reverses TNFa and BMP6 regulation of NOTCH. (A - C) mRNA expression of NOTCH1 (A), NOTCH2 (B) and NOTCH3 (C) in human HPAH dPASMCs pre-incubated with SRC-I (1 μΜ) or PP2 (250 nM) in DMSO for 1 h before stimulation with TNFa (1 ng/ml) and/or BMP6 (10 ng/ml) for 1 h (n = 3; one-way ANOVA). (D and E) NOTCH1 mRNA expression in control (D) and HPAH (E) human dPASMCs following transfection with siFVTV, si YES or siSPC and 30 min treatment with TNFa (1 ng/ml) and/or BMP6 (10 ng/ml) (n = 3; one-way ANOVA with post-hoc Tukey's HSD analysis; DH1 - DharmaFectl ; siCP - non-targeting control). Y- axis in A and D shows NOTCH1 mRNA fold change (relative to control 0.1 %). Y-axis in B shows NOTCH2 mRNA fold change (relative to control 0.1 %). Y-axis in C shows NOTCH3 mRNA fold change (relative to control 0.1 %). Y-axis in E shows NOTCH1 mRNA fold change (relative to siCP 0.1 %). ^* P≤ 0.05, ^** P≤ 0.01 , ^*** P≤ 0.001 . Error bars represent mean + s.e.m.

Figure 22. The anti-TNFa therapeutic, etanercept, reverses established pulmonary hypertension in the Sugen-hypoxia model. Rats were given vehicle and maintained in normoxia (Control, n = 6) or SU-5416 (20 mg/kg, s.c.) followed by 3 weeks of hypoxia (10% 02), 5 weeks of normoxia and then 3 weeks of biweekly treatment with saline vehicle (S/H, n = 9) or etanercept (S/H+Etan, n = 9; 2.5 mg/kg, i.p.). (A and B) Assessment of RVSP (A) and right ventricular hypertrophy (Fulton index) (B). Y-axis in A shows RVSP (mmHg). Y-axis in B shows Fulton Index (RV/(LV+S)) (C) Quantification of non-, partially and fully muscularized arteries as a percentage of total alveolar wall and duct arteries (n = 6 for control, n = 9 for other groups; Student's f-test for non-muscularized vessels). Y-axis shows % Vessels. (D) BMPR2, ACVR2A and ALK2 mRNA expression in lungs from control, S/H and S/H+Etan rats (n = 6). Y-axis shows mRNA fold change (relative to control). Lung expression of protein (E) for BMPR-II, phospho-Smad 1/5, Smad 1 , Notch2, Notch3, Cleaved caspase3, total Caspase3 and aSMA expression in control, S/H and S/H+Etan rats (n = 3); or mRNA for (F) Notch2 and (G) Notch3 (n = 6). Y-axis in F shows Notch2 mRNA fold change (relative to control). Y-axis in G shows Notch3 mRNA fold change (relative to control). (H) Representative immunohistochemical images of Notch2, Notch3 and aSMA in control and S/H rat lung sections. Scale bars, 100 μηι. One-way ANOVA with post-hoc Tukey's HSD analysis used in A, B, D, F and G. #P≤ 0.05, ^* 7##P≤ 0.01 , ^*** P≤ 0.001 . Error bars represent mean + s.e.m.

Figure 23. The anti-TNFa therapeutic, etanercept, reverses established pulmonary hypertension in the Sugen-hypoxia model. (A) Rats were given vehicle injections and maintained in normoxia (Control, n = 6) or challenged with SU-5416 (20 mg/kg, s.c.) and 3 weeks of hypoxia (10% 02) before 5 weeks of normoxia and 3 weeks of biweekly treatment with saline vehicle (S/H, n = 9) or etanercept (S/H+Etan, n = 9; 2.5 mg/kg, i.p.). (B) Assessment of pulmonary arterial wall thickness as a percentage of luminal diameter. Y-axis shows % wall thickness for all vessels. (C - G) mRNA expression of Bmp6 {C), Tnf {D), Notchl (E), Hey1 and Hey2 { ) and Hes1 (G) in lungs from control, S/H and S/H+Etan rats (n = 6). Y-axis in C shows Bmp6 mRNA fold change (relative to control). Y-axis in D shows Tnf mRNA fold change (relative to control). Y-axis in E shows Notch l mRNA fold change (relative to control). Y-axis in F shows mRNA fold change (relative to control). Y-axis in G shows Hes1 mRNA fold change (relative to control). One-way ANOVA with post-hoc Tukey's HSD analysis for multiple comparisons. S/H = Sugen-hypoxia, S/H+Etan = Sugen-hypoxia + Etanercept #P≤ 0.05, ^* 7##P≤ 0.01 , ^** 7###P≤ 0.001 . Error bars represent mean + s.e.m. Figure 24. Immunoblot analysis of siRNA-mediated reduction of BMPR-II. (A and

B) Control human dPASMCs were transfected with BMPR2 siRNA (siBMPR2) or control siRNA (siCP) using DharmaFECTI™ (DH1 ) followed by treatment with BMP6 (10 ng/ml) in 0.1 % FBS for 1 , 4 or 24 hours. (B) Protein lysates were immunoblotted for phospho-Smad 1/5 and total Smad 1 followed by reprobing for a-tubulin to ensure equal loading. Data are representative of three separate experiments. (B) Immunoblotting for BMPR-II to confirm the loss of protein in siBMPR2-transfected PASMCs. Blots were reprobed for α-tubulin to ensure equal loading. Data are representative of three separate experiments. (C) Immunoblotting for cleaved/transmembrane intracellular NTM (NTM) regions for NOTCH1 , NOTCH2 and NOTCH3 expression in control disease-free and HPAH dPASMCs (n=3 different lines for each). Blots were reprobed for α-tubulin to ensure equal loading. (D) Densitometry of NTM regions from blots in panel A. The data represent the ratio of the NOTCH NTM band density normalised to the α-tubulin density for each sample. DETAILED DESCRIPTION OF THE INVENTION

According to one aspect of the invention, there is provided a pharmaceutical composition comprising: (1 ) a polypeptide selected from bone morphogenetic protein 10 (BMP10) and a bone morphogenetic protein 9 (BMP9) variant lacking osteogenic activity; and (2) a TNFa inhibitor.

The present invention involves a combination of a TNFa inhibitor in combination with a bone morphogenetic protein which maintains endothelial cell signalling activity (for example, as which may be evidenced by the induction of ID1 , ID2 and/or BMPR-II gene expression) but which lacks osteogenic activity (for example as which may be measured by alkaline phosphatase (ALP) activity in the mouse myoblast cell line C2C12). For example, BMP10 and the BMP9 variants herein not only maintain endothelial cell signalling activity but are synergistically devoid of osteogenic activity. Thus, native BMP10 and the BMP9 variants as described herein represent a more desirable agonist than native BMP9 for treating, in combination with a TNFa inhibitor, vascular disease or a respiratory disease, in particular PAH, by virtue of lacking the ability to promote bone formation. Evidence is presented in WO2016/005756 for the use of a therapeutic polypeptide which is either BMP10 or a BMP9 variant lacking osteogenic activity for the treatment of a vascular or respiratory disease such as PAH. The present application discloses for the first time that TNFa drives the development of PAH by repressing BMPRII transcription and activity. Furthermore, we disclose that anti-TNFa immunotherapy can reverse the disease progression and restore normal signaling in affected pathways. The present invention relates to a composition which combines the therapeutic polypeptide disclosed in WO2016/005756 with a TNFa inhibitor, as well as medical uses of this composition for the treatment of PAH and other vascular and respiratory diseases.

It is suggested that the pharmaceutical composition and methods of the invention involving the use of a therapeutic polypeptide which is BMP10 or a BMP9 variant lacking osteogenic activity, as disclosed in WO2016/005756, and a TNFa inhibitor is more effective, and has wider applicability in different patient groups, than use of either active ingredient alone.

References herein to "BMP10" and "bone morphogenetic protein 10" encompass a human polypeptide belonging to the TGF-β superfamily of proteins which is encoded by the BMP10 gene (having the sequence shown in SEQ ID NO: 1 ) and which has the 424 amino acid sequence shown in SEQ ID NO: 2, wherein amino acid residues 1 to 21 comprise the signal peptide, amino acid residues 22 to 316 comprise the propeptide, and amino acid residues 317 to 424 comprise mature BMP10. Specific amino acids within BMP10 are numbered herein with reference to the full length sequence.

References herein to "a BMP9 variant" and "bone morphogenetic protein 9 variant" encompass a human polypeptide belonging to the TGF-β superfamily of proteins which is encoded by the BMP9 gene (having the sequence shown in SEQ ID NO: 3) and which has a variant of the 429 amino acid sequence shown in SEQ ID NO: 4 wherein amino acid residues 1 to 22 comprise the signal peptide, amino acid residues 23 to 319 comprise the propeptide and amino acid residues 320 to 429 comprise mature BMP9. BMP9 variants maintain endothelial cell signalling activity but lack osteogenic activity. Specific amino acids within BMP9 are numbered herein with reference to the full length sequence.

References to "variant" include a genetic variation in the native, non-mutant or wild type sequence of BMP9. Examples of such genetic variations include mutations selected from: substitutions, deletions, insertions and the like.

More generally, as used herein the term "polypeptide" refers to a polymer of amino acids. The term does not refer to a specific length of the polymer, so peptides, oligopeptides and proteins are included within the definition of polypeptide. The term "polypeptide" may include polypeptides with post-expression modifications, for example, glycosylations, acetylations, phosphorylations and the like. Included within the definition of "polypeptide" are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids), polypeptides with substituted linkages, as well as other modifications known in the art both naturally occurring and non-naturally occurring.

References to "lacking osteogenic activity" or "lack osteogenic activity" as used herein may refer to a BMP9 variant comprising one or more, mutations of the sequence of SEQ ID NO: 4 which results in elimination, minimization and/or suppression of osteogenic activity (for example, which may be measured by alkaline phosphatase (ALP) activity in the mouse myoblast cell line C2C12). BMP9 variants included are those which maintain endothelial specific signaling (i.e. those which have at least 0.75 fold ID1 induction compared to wild type BMP9, as measured by ID1 gene expression in HMEC-1 cells) and which have a lower value of osteogenic activity (i.e. less than 0.5 fold compared to wild type BMP9, as measured by ALP activity in the mouse myoblast cell line C2C12). Suitable BMP9 variants are those which maintain endothelial specific signaling (i.e. those which have at least 0.75 fold ID1 induction compared to wild type BMP9, as measured by ID1 gene expression in HMEC-1 cells) and negligible osteogenic activity (i.e. less than 0.1 fold compared to wild type BMP9, as measured by ALP activity in the mouse myoblast cell line C2C12).

Also encompassed are BMP9 variants which have increased endothelial specific signaling (i.e. those which have higher levels of ID1 induction compared to wild type BMP9, as measured by ID1 gene expression in HMEC-1 cells) and negligible osteogenic activity (i.e. less than 0.1 fold compared to wild type BMP9, as measured by ALP activity in the mouse myoblast cell line C2C12).

The polypeptide may be BMP10. As shown in WO2016/005756, BMP10 is as potent as BMP9 in inducing ID1 , ID2 and BMPR-II gene expression (see Figures 3A to 3C of WO2016/005756). Furthermore, BMP10 has been shown in WO2016/005756 to exhibit the same anti-apoptotic activity as BMP9 in protecting hPAECs against TNFa-CHX induced apoptosis (see Figure 3D of WO2016/005756). Crucially, however, BMP10 did not induce any ALP activity at the highest concentration tested (see Figure 3F of WO2016/005756) unlike BMP9. The polypeptide may be BMP10 comprising the amino acid sequence of SEQ ID NO: 2.

The polypeptide may be BMP10 encoded by the nucleotide sequence of SEQ ID NO: 1 .

The polypeptide may be the prodomain bound form of BMP10 (pro.BMPI O). Data are provided in WO2016/005756 which demonstrate that the pro.BMPI O complex is very stable (see Figures 4B and 4C of WO2016/005756) and is likely to be a suitable form of BMP10 for the treatment of vascular and respiratory diseases, such as PAH.

The pro.BMPI O may comprise a propeptide sequence having the amino acid sequence of residues 22-316 of SEQ ID NO: 2 non-covalently bound to a mature BMP10 sequence having the amino acid sequence of residues 317-424 of SEQ ID NO: 2.

The pro.BMPI O may comprise a tetramer containing two of the above-mentioned propeptide sequences and two of the above-mentioned mature BMP10 sequences.

The polypeptide may be a BMP9 variant lacking osteogenic activity.

The polypeptide may be a variant of the prodomain bound form of BMP9 (pro.BMP9) lacking osteogenic activity.

The variant of pro.BMP9 may comprise a variant of: the propeptide sequence having the amino acid sequence of residues 23-319 of SEQ ID NO: 4 non-covalently bound to a mature BMP9 sequence having the amino acid sequence of residues 320-429 of SEQ ID NO: 4.

The variant of pro.BMP9 may comprise a tetramer containing two of the above- mentioned propeptide sequences and two of the above-mentioned mature BMP9 sequences.

The BMP9 variant lacking osteogenic activity may comprise a substitution, deletion or insertion mutant of the amino acid sequence of SEQ ID NO: 4.

The BMP9 variant lacking osteogenic activity may comprise a substitution mutant of the amino acid sequence of SEQ ID NO: 4.

The substitution mutant of the amino acid sequence of SEQ ID NO: 4 may comprise one or more (i.e. single, double, triple mutants etc.) of the following substitutions: H326A, D342A, S343A, W344A, I346A, K349A, F362A, D366A, K372A, I375A, L379A, H381 A, L382A, K383A, K390A, S402A, L404A, K406A, D408A, V41 1A, T413A, L414A, Y416A and Y418A. The BMP9 variant lacking osteogenic activity may be selected from one of the following BMP9 variants of SEQ ID NO: 4: H326A, D342A, S343A, W344A, I346A, K349A, F362A, D366A, K372A, I375A, L379A, H381A, L382A, K383A, K390A, S402A, L404A, K406A, D408A, V41 1 A, T413A, L414A, Y416A and Y418A. The substitution mutant of the amino acid sequence of SEQ ID NO: 4 may comprise one or more (i.e. single, double, triple mutants etc.) of the following substitutions: H326A, S343A, K349A, F362A, D366A, I375A, L379A, L382A, K390A, S402A, D408A, Y416A and Y418A. The BMP9 variant lacking osteogenic activity may be selected from one of the following BMP9 variants of SEQ ID NO: 4: H326A, S343A, K349A, F362A, D366A, I375A, L379A, L382A, K390A, S402A, D408A, Y416A and Y418A. Data are provided in WO2016/005756 which demonstrate that these mutant sequences maintain the beneficial effect of endothelial specific signaling and having greatly reduced osteogenic signaling (as evidenced by at least 0.75 fold ID1 induction and less than 0.5 fold ALP activity when compared to wild type BMP9; see Figure 5 of WO2016/005756).

The substitution mutant of the amino acid sequence of SEQ ID NO: 4 may comprise one or more (i.e. single, double, triple mutants etc.) of the following substitutions: F362A, D366A, I375A, L379A, S402A, D408A, Y416A and Y418A.

The BMP9 variant lacking osteogenic activity may be selected from one of the following BMP9 variants of SEQ ID NO: 4: F362A, D366A, I375A, L379A, S402A, D408A, Y416A and Y418A. Data are provided in WO2016/005756 which demonstrate that these mutant sequences maintain the beneficial effect of endothelial specific signaling but lack osteogenic signaling (as evidenced by at least 0.75 fold ID1 induction and negligible (i.e. less than 0.1 fold) ALP activity when compared to wild type BMP9; see Figure 5 in WO2016/005756). The substitution mutant of the amino acid sequence of SEQ ID NO: 4 may comprise one or both (i.e. a single or double mutant) of the following substitutions: D366A or D408A.

The BMP9 variant lacking osteogenic activity may be selected from one of the following BMP9 variants of SEQ ID NO: 4: D366A or D408A. Data are provided in WO2016/005756 which demonstrate that these mutant sequences maintain the beneficial effect of BMP9 but are not able to initiate the osteogenic signaling and hence remove the potential risk of bone formation by administration of BMP9 in vivo (see the results shown in Figure 2 of WO2016/005756). Data are also provided in WO2016/005756 which demonstrate that these mutant sequences have increased endothelial specific signaling but lack osteogenic signaling (as evidenced by a greater than 1 fold ID1 induction and negligible (i.e. less than 0.1 fold) ALP activity when compared to wild type BMP9; see Figure 5 of WO2016/005756).

The BMP9 variant lacking osteogenic activity may be selected from a D408A BMP9 variant of SEQ ID NO: 4. Data are provided in WO2016/005756 which demonstrate that this mutant sequence has been shown to be able to rescue PAEC early apoptosis induced by tumor necrosis factor a (TNFa) and cycloheximide (CHX) (see the results shown in Figure 7 of WO2016/005756).

The BMP9 variant lacking osteogenic activity may be selected from a D366A BMP9 variant comprising the amino acid sequence of SEQ ID NO: 5 or a D408A BMP9 variant comprising the amino acid sequence of SEQ ID NO: 6.

Alternatively, the BMP9 variant lacking osteogenic activity may be selected from a D366A/D408A double mutant BMP9 variant comprising the amino acid sequence of SEQ ID NO: 7. Data concerning the biological activity of the D366A/D408A double mutant BMP9 variant comprising the amino acid sequence of SEQ ID NO: 7 can be found in US patent application no. 15/404,265 filed on 12 January 2017 as a continuation-in-part application from US patent application no. 15/324,864 (a US national phase application of WO2016/005756). The double mutant BMP9 variant of SEQ ID NO: 7 has potent endothelial cell signalling activity, comparable with D366A and D408A single mutants and the wild type, but does not show show any osteogenic signalling activity in vitro. The TNFa inhibitor of the composition may be selected from the group consisting of etanercept, infliximab (or "biosimilar inf!iximabs" such as "Inflectra" or "Remsima"), adalimumab, golimumab, certolizumab pegol, thalidomide, a thalidomide derivative (such as lenalidomide), a xanthine derivative (such as pentoxifylline), bupropion, a phosphodiesterase IV inhibitor, a pegylated soluble TNFa Receptor Type I (PEGs TNFa-R1 ), an agent containing a soluble TNFa receptor, and CDP571 (a humanized monoclonal anti-TNFa antibody). In particular, the TNFa inhibitor may be etanercept.

For the pharmaceutical composition of the present invention, the polypeptide and TNFa inhibitor may be in amounts effective in combination to treat a vascular disease or a respiratory disease. For example, the amount of polypeptide may be from about 1 ng to about 2 g. The amount of TNFa inhibitor may be from about 1 ng to about 2 g, for example about 12.5 mg or about 25 mg or about 50 mg.

The amount of TNFa inhibitor for use in the invention is illustrated by the following specific examples:

- for etanercept - Initially: 50 mg once a week or 25 mg twice a week as a self- administered subcutaneous injection. Maintenance: same; - for infliximab - Initially: Given as an intravenous infusion (IV) at a dose of 3-5 mg/kg (according to body weight) at weeks 0, 2, and 6. Maintenance: IV infusions every 4-8 weeks. Dose may be increased to 5-10 mg/kg;

- adalimumab - Initially: 40 mg every other week as a self-administered subcutaneous injection. Maintenance: same;

- golimumab (Simponi®) - Initially: 50 mg once per month as a self-administered subcutaneous injection. Maintenance: same; - golimumab (Simponi Aria®) - Initially: Given as an IV at a dose of 2 mg/kg (according to body weight) at weeks 0 and 4. Maintenance: IV infusions every 8 weeks; and - certolizumab (Cimzia®) - Intially: Given as treatment starts with two (200mg) subcutaneous injections. Two further injections at the same dose, at 2 and 4 weeks later. Maintenance: 200 mg given as a single injection every fortnight.

The pharmaceutical composition of the invention may be sterile.

The invention further provides pharmaceutical compositions, as defined above, including one or more pharmaceutically acceptable excipients and optionally other therapeutic or prophylactic agents. The pharmaceutically acceptable excipient(s) can be selected from, for example, carriers (e.g. a solid, liquid or semi-solid carrier), adjuvants, diluents, fillers or bulking agents, granulating agents, coating agents, release-controlling agents, binding agents, disintegrants, lubricating agents, preservatives, antioxidants, buffering agents, suspending agents, thickening agents, flavoring agents, sweeteners, taste masking agents, stabilizers or any other excipients conventionally used in pharmaceutical compositions. Examples of excipients for various types of pharmaceutical compositions are set out in more detail below.

The term "pharmaceutically acceptable" as used herein pertains to compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of a subject (e.g. human) without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio. Each carrier, excipient, etc. must also be "acceptable" in the sense of being compatible with the other ingredients of the formulation. Pharmaceutical compositions containing the polypeptides and TNFa inhibitor of the invention can be formulated in accordance with known techniques, see for example, Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, PA, USA. The pharmaceutical compositions can be in any form suitable for oral, parenteral, topical, intranasal, intrabronchial, sublingual, ophthalmic, otic, rectal, intra-vaginal, or transdermal administration. Where the compositions are intended for parenteral administration, they can be formulated for intravenous, intramuscular, intraperitoneal, subcutaneous administration or for direct delivery into a target organ or tissue by injection, infusion or other means of delivery. The delivery can be by bolus injection, short term infusion or longer term infusion and can be via passive delivery or through the utilization of a suitable infusion pump or syringe driver.

Pharmaceutical formulations adapted for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats, co-solvents, surface active agents, organic solvent mixtures, cyclodextrin complexation agents, emulsifying agents (for forming and stabilizing emulsion formulations), liposome components for forming liposomes, gellable polymers for forming polymeric gels, lyophilization protectants and combinations of agents for, inter alia, stabilizing the active ingredient in a soluble form and rendering the formulation isotonic with the blood of the intended recipient. Pharmaceutical formulations for parenteral administration may also take the form of aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents (see for example Strickly 2004, Pharmaceutical Research, 21 :201 -230).

A method of making a pharmaceutical composition comprising admixing the composition ingredients as described herein is also encompassed by the invention.

Formulations of the pharmaceutical composition of the invention may be presented in unit-dose or multi-dose containers, for example sealed ampoules, vials and prefilled syringes, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. A formulation can be prepared by lyophilizing a polypeptide and/or TNFa inhibitor of the invention. Lyophilization refers to the procedure of freeze-drying a composition. Freeze-drying and lyophilization are used herein as synonyms.

Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets.

Pharmaceutical compositions of the present invention for parenteral injection can also comprise pharmaceutically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions or emulsions as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use.

Examples of suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), carboxymethylcellulose and suitable mixtures thereof, vegetable oils (such as sunflower oil, safflower oil, corn oil or olive oil), and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of thickening or coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

Compositions of the present invention may also contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. Prevention of the action of microorganisms may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol, sorbic acid, and the like. It may also be desirable to include agents to adjust tonicity such as sugars, sodium chloride, and the like. Prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.

The pharmaceutical composition may be in a form suitable for IV administration, for example by injection or infusion. For intravenous administration, the solution can be dosed as is, or can be injected into an infusion bag (containing a pharmaceutically acceptable excipient, such as 0.9% saline or 5% dextrose), before administration.

The pharmaceutical composition may be in a form suitable for sub-cutaneous (s.c.) administration.

Pharmaceutical dosage forms suitable for oral administration include tablets (coated or uncoated), capsules (hard or soft shell), caplets, pills, lozenges, syrups, solutions, powders, granules, elixirs and suspensions, sublingual tablets, wafers or patches such as buccal patches.

Thus, tablet compositions can contain a unit dosage of active polypeptide and/or TNFa inhibitor together with an inert diluent or carrier such as a sugar or sugar alcohol, e.g.; lactose, sucrose, sorbitol or mannitol; and/or a non-sugar derived diluent such as sodium carbonate, calcium phosphate, calcium carbonate, or a cellulose or derivative thereof such as microcrystalline cellulose (MCC), methyl cellulose, ethyl cellulose, hydroxypropyl methyl cellulose, and starches such as corn starch. Tablets may also contain such standard ingredients as binding and granulating agents such as polyvinylpyrrolidone, disintegrants (e.g. swellable crosslinked polymers such as crosslinked carboxymethylcellulose), lubricating agents (e.g. stearates), preservatives (e.g. parabens), antioxidants (e.g. BHT), buffering agents (for example phosphate or citrate buffers), and effervescent agents such as citrate/bicarbonate mixtures. Such excipients are well known and do not need to be discussed in detail here. Tablets may be designed to release the drug either upon contact with stomach fluids (immediate release tablets) or to release in a controlled manner (controlled release tablets) over a prolonged period of time or with a specific region of the Gl tract.

Capsule formulations may be of the hard gelatin or soft gelatin variety and can contain the active component in solid, semi-solid, or liquid form. Gelatin capsules can be formed from animal gelatin or synthetic or plant derived equivalents thereof. The solid dosage forms (e.g.; tablets, capsules etc.) can be coated or un-coated. Coatings may act either as a protective film (e.g. a polymer, wax or varnish) or as a mechanism for controlling drug release or for aesthetic or identification purposes. The coating (e.g. a Eudragit™ type polymer) can be designed to release the active component at a desired location within the gastro-intestinal tract. Thus, the coating can be selected so as to degrade under certain pH conditions within the gastrointestinal tract, thereby selectively release the polypeptide and/or TNFa inhibitor in the stomach or in the ileum, duodenum, jejunum or colon. Instead of, or in addition to, a coating, the pharmaceutical composition may be presented in a solid matrix comprising a release controlling agent, for example a release delaying agent which may be adapted to release the polypeptide in a controlled manner in the gastrointestinal tract. Alternatively the composition can be presented in a polymer coating e.g. a polymethacrylate polymer coating, which may be adapted to selectively release the polypeptide under conditions of varying acidity or alkalinity in the gastrointestinal tract. Alternatively, the matrix material or release retarding coating can take the form of an erodible polymer (e.g. a maleic anhydride polymer) which is substantially continuously eroded as the dosage form passes through the gastrointestinal tract. In another alternative, the coating can be designed to disintegrate under microbial action in the gut. As a further alternative, the active polypeptide can be formulated in a delivery system that provides osmotic control of the release of the polypeptide. Osmotic release and other delayed release or sustained release formulations (for example formulations based on ion exchange resins) may be prepared in accordance with methods well known to those skilled in the art.

The polypeptides and/or TNFa inhibitor of the invention may be formulated with a carrier and administered in the form of nanoparticles, the increased surface area of the nanoparticles assisting their absorption. In addition, nanoparticles offer the possibility of direct penetration into the cell. Nanoparticle drug delivery systems are described in "Nanoparticle Technology for Drug Delivery", edited by Ram B Gupta and Uday B. Kompella, Informa Healthcare, ISBN 9781574448573, published 13th March 2006. Nanoparticles for drug delivery are also described in J. Control. Release, 2003, 91 : 167-172, and in Sinha et al., 2006, Mol. Cancer Ther. 5: 1909. The pharmaceutical compositions of the invention may typically comprise from approximately 1 % (w/w) to approximately 95% (w/w) active ingredients and from 99% (w/w) to 5% (w/w) of a pharmaceutically acceptable excipient or combination of excipients. The compositions may comprise from approximately 20% (w/w) to approximately 90% (w/w) active ingredients and from 80% (w/w) to 10% of a pharmaceutically acceptable excipient or combination of excipients. The pharmaceutical compositions may comprise from approximately 1 % to approximately 95%, particularly from approximately 20% to approximately 90%, active ingredients. Pharmaceutical compositions according to the invention may be, for example, in unit dose form, such as in the form of ampoules, vials, suppositories, pre-filled syringes, dragees, tablets or capsules.

The pharmaceutically acceptable excipient(s) can be selected according to the desired physical form of the formulation and can, for example, be selected from diluents (e.g. solid diluents such as fillers or bulking agents; and liquid diluents such as solvents and co-solvents), disintegrants, buffering agents, lubricants, flow aids, release controlling (e.g. release retarding or delaying polymers or waxes) agents, binders, granulating agents, pigments, plasticizers, antioxidants, preservatives, flavoring agents, taste masking agents, tonicity adjusting agents and coating agents.

The skilled person will have the expertise to select the appropriate amounts of ingredients for use in formulations of the pharmaceutical composition of the invention. For example tablets and capsules typically contain 0-20% disintegrants, 0-5% lubricants, 0-5% flow aids and/or 0-99% (w/w) fillers/ or bulking agents (depending on drug dose). They may also contain 0-10% (w/w) polymer binders, 0-5% (w/w) antioxidants, 0-5% (w/w) pigments. Slow release tablets would in addition contain 0- 99% (w/w) release-controlling (e.g. delaying) polymers (depending on dose). The film coats of the tablet or capsule typically contain 0-10% (w/w) polymers, 0-3% (w/w) pigments, and/or 0-2% (w/w) plasticizers. Parenteral formulations typically contain 0-20% (w/w) buffers, 0-50% (w/w) cosolvents, and/or 0-99% (w/w) Water for Injection (WFI) (depending on dose and if freeze dried). Formulations for intramuscular depots may also contain 0-99% (w/w) oils. Pharmaceutical compositions for oral administration can be obtained by combining the active ingredients with solid carriers, if desired granulating a resulting mixture, and processing the mixture, if desired or necessary, after the addition of appropriate excipients, into tablets, dragee cores or capsules. It is also possible for them to be incorporated into a polymer or waxy matrix that allow the active ingredients to diffuse or be released in measured amounts.

The polypeptides and/or TNFa inhibitor of the invention can also be formulated as solid dispersions. Solid dispersions are homogeneous extremely fine disperse phases of two or more solids. Solid solutions (molecularly disperse systems), one type of solid dispersion, are well known for use in pharmaceutical technology (see Chiou and Riegelman, 1971 , J. Pharm. Sci., 60, 1281 -1300) and are useful in increasing dissolution rates and increasing the bioavailability of poorly water-soluble drugs.

This invention also provides solid dosage forms comprising the solid solution described above. Solid dosage forms include tablets, capsules, chewable tablets and dispersible or effervescent tablets. Known excipients can be blended with the solid solution to provide the desired dosage form. For example, a capsule can contain the solid solution blended with (a) a disintegrant and a lubricant, or (b) a disintegrant, a lubricant and a surfactant. In addition a capsule can contain a bulking agent, such as lactose or microcrystalline cellulose. A tablet can contain the solid solution blended with at least one disintegrant, a lubricant, a surfactant, a bulking agent and a glidant. A chewable tablet can contain the solid solution blended with a bulking agent, a lubricant, and if desired an additional sweetening agent (such as an artificial sweetener), and suitable flavors. Solid solutions may also be formed by spraying solutions of drug and a suitable polymer onto the surface of inert carriers such as sugar beads ('non-pareils'). These beads can subsequently be filled into capsules or compressed into tablets. The pharmaceutical composition may be presented to a patient in "patient packs" containing an entire course of treatment in a single package, usually a blister pack.

Compositions for topical use and nasal delivery include ointments, creams, sprays, patches, gels, liquid drops and inserts (for example intraocular inserts). Such compositions can be formulated in accordance with known methods.

Examples of formulations for rectal or intra-vaginal administration include pessaries and suppositories which may be, for example, formed from a shaped moldable or waxy material containing the active polypeptide. Solutions of the active polypeptide and/or TNFa inhibitor may also be used for rectal administration.

Compositions for administration by inhalation may take the form of inhalable powder compositions or liquid or powder sprays, and can be administrated in standard form using powder inhaler devices or aerosol dispensing devices. Such devices are well known. For administration by inhalation, the powdered formulations typically comprise the active polypeptide and/or TNFa inhibitor together with an inert solid powdered diluent such as lactose. The polypeptide and/or TNFa inhibitor active ingredients of the invention may be presented in unit dosage form and, as such, will typically contain sufficient polypeptide and/or TNFa inhibitor to provide a desired level of biological activity. For example, a formulation may contain from 1 ng to 2 g of active ingredient, e.g. from 1 ng to 2 mg of active ingredient. Within these ranges, particular sub-ranges of polypeptide and/or TNFa inhibitor are 0.1 mg to 2 g of active ingredient (more usually from 10 mg to 1 g, e.g. 50 mg to 500 mg), or 1 μg to 20 mg (for example, 1 μg to 10 mg, e.g. 0.1 mg to 2 mg of active ingredient).

For oral compositions, a unit dosage form may contain from 1 mg to 2 g, more typically 10 mg to 1 g, for example 50 mg to 1 g, e.g. 100 mg to 1 g, of active polypeptide and/or TNFa inhibitor. The active polypeptide and/or TNFa inhibitor may be administered to a patient in need thereof (for example a human or animal patient) in an amount sufficient to achieve the desired therapeutic effect. Also provided according to the present invention is a pharmaceutical composition as defined herein, for use in the treatment of a vascular disease or a respiratory disease, wherein the polypeptide and the TNFa inhibitor of the composition are prepared to be administered to a patient in need thereof simultaneously, contemporaneously or concomitantly.

Additional provided according to the present invention is the use of a pharmaceutical composition as defined herein in the manufacture of a medicament for the treatment of a vascular disease or a respiratory disease, wherein the polypeptide and the TNFa inhibitor of the composition are prepared to be administered to a patient in need thereof simultaneously, contemporaneously or concomitantly.

Further provided according to the present invention is method of treating a vascular disease or a respiratory disease in a patient in need thereof, the method comprising administering to the patient an effective amount of a polypeptide as defined herein, in combination with an effective amount of a TNFa inhibitor as defined herein.

According to the method, the polypeptide and TNFa inhibitor of the invention may be administered simultaneously, contemporaneously or concomitantly. For example, the TNFa inhibitor may be administered: (a) prior to administration of the polypeptide of the invention; (b) in doses alternating with administration of the polypeptide of the invention (such as on/off dosing); and/or (c) in reducing doses together or alternating with administration of the polypeptide of the invention. To determine optimal levels of administration of the active ingredients of the invention, the effects of the TNFa inhibitor may be assessed in patients by determining the levels of cytokines such as for example TNFa, IL-6, IL8 and/or MCP1 . Lower levels of one or more of these cytokines, for example IL-6, may be associated with improved patient survival.

The vascular disease treated by the composition for use or method may be selected from: pulmonary hypertension; pulmonary arterial hypertension (PAH); hereditary haemorrhagic telangiectasia; atherosclerosis; and hepatopulmonary syndrome. In particular, the vascular disease may be PAH.

The respiratory disease treated by the composition for use or method may be selected from: obstructive lung diseases such as chronic obstructive pulmonary disease (COPD), chronic bronchitis and emphysema; pulmonary vascular diseases such as pulmonary edema and pulmonary hemorrhage; respiratory failure and respiratory distress syndrome, such as acute lung injury and acute respiratory distress syndrome; and interstitial lung diseases, such as idiopathic pulmonary fibrosis.

Gene therapy comprising the BMP10 or BMP9 variant of the invention together with administration of the TNFa inhibitor is also encompassed by the present invention. For example, a vector encoding the BMP10 or BMP9 variant nucleotide sequence may be administered to the host human subject resulting in endogenous expression (such as endogenous expression in the liver) of the BMP10 or BMP9 variant polypeptide for release into the circulation. The TNFa inhibitor may then be administered to the subject with endogenous expression of the BMP10 or BMP9 variant polypeptide.

Thus, according to a further aspect of the invention there is provided a vector comprising a nucleotide sequence encoding BMP10 or a BMP9 variant for use in the treatment together with a TNFa inhibitor of a vascular disease or a respiratory disease (such as PAH). The vector may comprise the nucleotide sequence of SEQ ID NO: 1 .

The vector may be a viral vector, for example a retrovirus, adenovirus, lentivirus, herpes simplex, vaccinia or adeno-associated virus.

Alternatively, the vector may be a non-viral vector. The use of non-viral vectors has a number of advantages over the use of viral vectors, such as ease of large scale production and low immunogenicity in the host. Examples of non-viral gene therapy methods include: injection of naked DNA, electroporation, gene gun, sonoporation, magnetofection and the use of oligonucleotides, lipoplexes, dendrimers, and inorganic nanoparticles.

Additionally provided according to the present invention is a package comprising:

a) a first pharmaceutical composition comprising a polypeptide as defined herein;

b) a second pharmaceutical composition comprising a TNFa inhibitor as defined herein; and

c) instructions for use of the first and second pharmaceutical compositions together to treat a subject afflicted with a vascular disease or a respiratory disease, for example PAH or other disease mentioned herein.

Particular non-limiting examples of the present invention will now be described with reference to drawings.

EXAMPLE 1 - TNFa drives pulmonary hypertension via BMPR-II suppression and NOTCH dysregulation Introduction

BMPR-II forms heteromeric cell surface receptor complexes with activin-like kinase (ALK) type I receptors, mediating BMP2, BMP4 and BMP6 signaling with ALK3 pulmonary artery smooth muscle cells (PASMCs), or mediating endothelial BMP9/10 responses with ALK1 . The activated receptors phosphorylate the canonical SMAD1/5/8 proteins that promote the transcription of genes including the Inhibitor of DNA binding (ID) gene family and NOTCH pathways. BMPs can also signal independently of SMADs, through mitogen activated protein kinases (MAPKs), and proto-oncogene protein tyrosine kinase c-SRC (c-SRC) phosphorylation. We have previously shown reduced BMP4-dependent SMAD1 /5/8 signaling and transcriptional responses in PASMCs from PAH patients, especially those harboring BMPR2 mutations. In contrast to reduced BMP4 signaling, deletion of both BMPR-II alleles in mouse PASMCs, or siRNA-mediated knockdown of BMPR-II in human PASMCs, enhances BMP6 and BMP7-mediated SMAD signaling via recruitment of ACTR-IIA and ALK2. However, siRNA and floxed alleles are artificial methodologies for achieving this critical BMPR-II reduction, so we considered how these very low levels of BMPR-II might occur in vivo. Since TNFa reduces endothelial BMPR-II expression, we contemplated whether TNFa might critically reduce BMPR-II expression in vascular cells harboring BMPR2 mutations and switch BMP signaling to recruit ACTR-IIA and ALK2, with potentially pathological consequences.

In the present example, we demonstrate that TNFa reduces BMPR-II in vascular cells and promotes ADAM 10/17-dependent BMPR-II cleavage in PASMCs, releasing the soluble ectodomain which acts a ligand trap. Furthermore, the combined impact of genetic loss-of-function of BMPR-II with TNFa-mediated suppression of BMPR-II levels in PASMCs drives inappropriate proliferation through c-SRC family members and dysregulated NOTCH2/3 signaling. Similar signaling changes were observed in the lungs of rat and mouse PAH models. Moreover, therapeutic etanercept administration reversed the progression of PAH in the rat Sugen-hypoxia model and inhibited proliferative NOTCH signaling. Thus we provide new insights into the role of inflammation as a trigger for PAH in carriers of BMPR-II mutations and provide a novel mechanism by which a key inflammatory mediator, TNFa, promotes the development of PAH against a background of BMPR-II loss-of-function. This example also provides a basis for the development of anti-TNF strategies for the treatment of PAH and other vascular or respiratory diseases.

Methods

Cell Culture and Treatments. Human pulmonary artery endothelial cells (PAECs) were purchased from Lonza (Basel, Switzerland), maintained in EGM-2 with 2% FBS (Lonza) and were used between passages 4 and 8. For experimental studies, cells were starved overnight in Medium 199 containing 0.1 % FBS and Antibiotic-Antimycotic (A/A; 100 U/mL penicillin, 100 mg/mL streptomycin and 0.25 mg/mL amphotericin B, Invitrogen) and incubated in 2% foetal bovine serum (FBS) containing A/A without growth factors overnight. Cell lines were routinely tested for mycoplasma contamination and only used if negative. Distal human pulmonary arterial smooth muscle cells (dPASMCs) were derived from small vessels (<2mm diameter) lung resection specimens and proximal PASMCs isolated from vessel segments (5-8mm diameter) as described previously (Davies et al., 2012, Am.J. Physiol Lung Cell Mol. Physiol 302:L604-L615). A summary of clinical information of the control and HPAH PASMCs used is provided in Table 1 .

Table 1 : Pulmonary arterial smooth muscle cell clinical information

Human PASMCs were maintained in Dulbecco's Modified Eagle Media (DMEM) supplemented with 10% FBS and A/A (DMEM/10%). Rat PASMCs were isolated from small pulmonary arteries, as described previously (Phillips et al., 2005, Am J Physiol Lung Cell Mol Physiol 288:L103-1 15). Mouse PASMCs were isolated from small pulmonary arteries, as described previously (Long et al., 2006, Circ.Res. 98:818-827). Human aortic smooth muscle cells, isolated from patients under local ethics approval, were kindly provided by Dr Murray Clarke (University of Cambridge, UK). All smooth muscle cell lines were used between passages 4 and 8.

C2C12-BRE cells were cultured in DMEM/10% containing 2 mM L-glutamine and 700 Mg/ml G418) (Herrera & Inman, 2009, BMC.Cell Biol. 10:20). Smooth muscle cells and C2C12-BRE cells were quiesced in DMEM containing 0.1 % FBS and A/A (DMEM/0.1 %) overnight prior to treatments. Recombinant human TNFa, BMP2, BMP4, BMP6, IL-1 β, IL-6 and IL-8 were purchased from R&D Systems (Oxfordshire, UK). Recombinant mouse TNFa was purchased from PeproTech (NJ, USA). Cells were treated with TNFa (1 ng/mL) for 24 h, unless otherwise indicated. Cells were stimulated with BMP2, BMP4 or BMP6 (10 ng/mL unless otherwise stated) or co-stimulated with TNFa and BMP ligand as indicated. The metalloprotease inhibitor batimastat (BB94) (10 ng/mL) was a kind gift from Dr. Murray Clarke (University of Cambridge, UK). ADAM 10 inhibitor GI254023X (10 μΜ) was a kind gift from Prof. Andreas Ludwig (RWTH AACHEN, Germany). The anti-ADAM17 antibody, D1 (A12) (50 nM) was a kind gift from Prof. Gillian Murphy (Cancer Research UK Research Institute, Cambridge, UK). ADAM10/17 inhibitor TAPI-1 (10 μΜ) was purchased from Enzo Life Sciences (Devon, UK). The BMP signaling inhibitor, LDN193189, was a kind gift from Dr. Paul Yu (Brigham and Women's Hospital, Boston, MA). The γ-secretase inhibitor, DAPT, was from Sigma. Unless otherwise stated, cells were pretreated with inhibitors for 30 minutes before TNFa stimulation and then added to cells for a total of 24 h. For immunoneutralization studies, treatments were preincubated with ^g/ml monoclonal anti-BMP2 or anti-BMP6 (R&D Systems) for 1 h prior to adding to cells. CelS proliferation. For assessment of PASMC proliferation, cells were seeded at 15,000 cells/well in 24-well plates and left to adhere overnight. After 48 h, cells were washed with DMEM/0.1 % and then serum-restricted in EBM-2 containing 0.1 % FBS and A/A for 16h. Cells were then exposed to the stated treatments in DMEM containing 5% FBS and A/A (DMEM/5%) and treatments were replenished every 48 h. At the relevant time points (Days 0, 2, 4 and 6 or Day 6 only), ceils were trypsinized and counted on a hemocytometer using trypan blue exclusion to assess cell viability.

Expression Plasmids and Reagents. The pcDNA3 expression plasmid encoding 5'- myc-tagged BMPR-II wild type was prepared as previously described (Rudarakanchana et al., 2002, Hum. Mol. Genet. 1 1 :1517-1525). Mutant myc-tagged BMPR-II V158A, V160A, V163A and V166A plasmids were created using the QuikChange™ Site-Directed Mutagenesis kit (Agilent Technologies, Cheshire, UK) according to the manufacturer's instructions (see Table 2). The presence of each mutation was verified by sequencing.

Table 2. Mutagenesis primers for myc-tagged BMPR-II valine-alanine plasmids.

Adenoviral Transduction. The synthesis of the AdCMVBMPR2myc and kinase-dead AdCMVBMPR2(D485G)myc, replication incompetent serotype 5 adenoviral vectors and production and titration of viral particles was described previously (Southwood et al., 2008, J.Pathol. 214:85-95). Cells were infected with 50 plaque-forming units (pfu) per cell for 4 h in serum-free DMEM and this was then replaced with DM EM/ 10% for 16 h. Prior to treatment cells were serum-restricted in DMEM/0.1 % for 16 h and then treated with ligands in DMEM/5%, with replenishment of ligands every 48 h. Cells were trypsinized and counted on day 6.

Plasmid Transfections. Plasmids were prepared using the PureLink™ maxiprep kit (Invitrogen, Renfrewshire, UK), according to the manufacturer's instructions. Prior to transfection, PASMCs were incubated with Opti-MEM-I for 2 h. Cells were transiently transfected with 4 μg of expression plasmid using 2 μΙ Lipofectamine™ 2000 reagent (Invitrogen) in Opti-MEM-I. Cells were incubated with transfection mixes for 4 h, followed by replacement with DMEM/10% for 48 h prior to quiescence and treatment as indicated. Transfection efficiency was confirmed via BMPR-II and Myc tag immunoblotting. siRNA Transfections. Prior to transfection, PASMCs were incubated with Opti-MEM-I serum-free medium (Life Technologies) for 3 h before adding 10 nM siRNA lipoplexed with DharmaFECTI™ (Dharmacon, MA, USA) siRNA/Dharmafect complexes were allowed to form for 20 minutes at room temperature before being added to the cells. Cells were then incubated with the complexes for 4 h at 37 ^° C before returning to DMEM/10% overnight. Knockdown efficiency was confirmed by immunoblotting. The siRNAs used were: ON-TARGETP/us™ siGENOME™ Smartpool oligos for (>x% values represent knockdown at RNA level): ACVR2A (>73%), ADAM10, ADAM17, ALK2 (>84%), BMPR2 (>75%), RELA (>82%, encoding NF-κΒ p65) or a non-targeting control pool (siCP) (Thermo Fisher, Waltham, MA) or oligos targeting FYN (>64%), HEY1 (>63%), HEY 2 (>63%), NOTCH2 (>50%), NOTCH3 (>75%), SRC (>62%) or YES (>68%) from Sigma-Aldrich. For proliferation experiments, we confirmed that the level of knockdown was similar at Days 2,4 and 6 for each target.

Immunoblotting. Frozen liver and lung tissue were homogenized in lysis buffer (250 mM Tris-HCI, pH 6.8, 4% SDS, 20% v/v glycerol, EDTA-free protease inhibitor cocktail (Roche, West Sussex, UK)) sonicated and centrifuged for 15 minutes at 15,000 x g. PAECs and PASMCs were snap-frozen on an ethanol-dry ice bath in lysis buffer (125 mM Tris (pH 7.4), 2% SDS, 10% glycerol, and EDTA-free protease inhibitor cocktail). Cell lysates (20-100 μg protein) were separated by SDS-PAGE and proteins transferred to polyvinylidene fluoride membranes by semidry blotting (GE Healthcare, Buckinghamshire, UK). Membranes were then blocked and probed with rabbit polyclonal antibodies toward total Smadl , phosphorylated SRC(Y527) (all Cell Signaling Technology, Danvers, MA), ADAM10, ADAM 17 (Abeam, Cambridgeshire, UK); rabbit monoclonal antibodies toward phosphorylated Smad1/5, caspase-3, cleaved caspase-3, NOTCH1 , NOTCH2, NOTCH3, phospho-SRC(Y416) and SRC (Cell Signaling Technology, Danvers, MA), ID1 (CalBioreagents, San Mateo, CA); or mouse monoclonal antibodies toward BMPR-II (BD Transduction Laboratories, Franklin Lakes, NJ) or c-Myc (Santa Cruz Biotechnology, TX, USA). After washing, blots were incubated with secondary anti-mouse/rabbit horseradish peroxidase antibody (Dako, Glostrup, Denmark) for 1 h at room temperature. As a loading control, all blots were re-probed with a monoclonal antibody toward either a-tubulin (Sigma) or β-actin (Sigma). Densitometry was performed using imaged software. Membranes were developed using enhanced chemiluminescence (GE Healthcare).

Deglycosylation. Protein was deglycosylated using PNGase F according to the manufacturer's instructions (New England Biolabs). Approximately 60-80 μg of protein was deglycosylated and then fractionated by SDS-PAGE.

Immunoprecipitation. Conditioned media were taken from transfected PASMCs prior to lysis. Media were centrifuged at 2,000 x g (4°C) to remove cellular debris and stored in 1 ml aliquots at -80°C. For immunoprecipitation, 1 ml culture media were incubated with a mouse monoclonal toward BMPR-II (R&D Systems, Oxford, UK) overnight on a rotary mixer at 4°C. Antibody:protein complexes were isolated by incubation with protein-G sepharose beads (Sigma-Aldrich) for 4 h on a rotary mixer at 4°C. Beads were washed three times in PBS/Triton X-100 (0.1 %) (Sigma-Aldrich) and resuspended in 2X loading buffer containing 62.5 mm Tris-HCL, pH 6.8, 10% (v/v) glycerol, 2% (w/v) SDS, 5% (v/v) β-mercaptoethanol, 0.003% (w/v) bromophenol blue. To detach complexes from the beads, samples were boiled at 99°C for 5 minutes and centrifuged at 2,500 x g for 2 minutes at 4°C. Samples were separated by SDS-PAGE and immunoblotted for myc tag as previously described. sBMPR-ll ELISA. Conditioned media, taken from PASMCs stimulated with TNFa, were centrifuged at 2,000 x g (4°C) to remove cellular debris and stored in 1 ml aliquots at - 80°C. BMPR-II ECD was measured using an in-house ELISA. ELISA was performed as previously described (Farahi et al., 2007, J.Immunol. 179:1264-1273) with the following modifications. Briefly, flat-bottom high binding 96-well ELISA plates (Greiner, South Lanarkshire, UK) were coated with 1 μg/ml mouse monoclonal anti-human BMPR-II antibody (R&D Systems) for 2 h at room temperature. After washing, plates were blocked with 1 % BSA (Sigma-Aldrich) in PBS-T for 1 h at room temperature. Aliquots of standards (His-tagged BMPR-II-ECD, Sino Biologicals, Beijing, P. R. China) and conditioned media with the relevant controls were added and incubated in a humidified chamber overnight at 4°C. After washes, polyclonal rabbit anti-human BMPR-II antibody (Santa Cruz Biotechnology), diluted to 0.5 vg/mL in 1 % BSA/PBS-T, was added and incubated for 3 h at room temperature. Plates were washed as described and goat anti-rabbit alkaline phosphatase conjugate whole molecule IgG (Sigma-Aldrich) was added at a 1 :1000 dilution in 1 % BSA/PBS-T, and incubated for a further 2 h at room temperature. Plates were developed and read at 405 nm in an automated plate reader (3550, Bio-Rad). Results were analyzed using Microplate Manager software (Bio-Rad). The lower level sensitivity of this assay was 750 pg/ml. sBMPR-ll Ligand Binding Assay. C2C12-BRE cells were treated with BMP2 or BMP4 (at 1 and 10 ng/ml) in the presence or absence of commercially available glycosylated His-tagged BMPR-II-ECD (Sino Biologicals, Beijing, P. R. China) or conditioned media from transfected PASMCs stimulated with TNFa. Luciferase activity in the cells was assessed using a luciferase reporter assay kit (Roche).

RNA Preparation and Quantitative RT-PCR. Total RNA was extracted using the RNeasy Mini Kit with DNAse digestion (Qiagen, West Sussex, UK). cDNA was prepared from ~1 μg of RNA using the High Capacity Reverse Transcriptase kit (Applied Biosystems, California, USA), according to the manufacturer's instructions. All qPCR reactions were prepared in MicroAmp® optical 96-well reaction plates (Applied Biosystems) using 50 ng/μΙ cDNA with SYBR®Green Jumpstart™ Taq Readymix™ (Sigma-Aldrich), ROX reference dye (Invitrogen) and custom sense and anti-sense primers (all 200 nM). Primers for human: ACTB (encoding β-actin), ADAM10, ADAM12, ADAM15, ADAM17, ALK3, BMPR2, HES1, HEY1, HEY2, ID1, MMP14, MMP15, MMP16, MMP17, MMP24, NOTCH3; mouse Acvr2a (encoding Actr-lla), Alk2, Bmpr2, Notch i, Notch2, Notch3 were all designed using Primer3 (http://primer3.sourceforge.net/) (Tables 3-5). QuantiTect primers for: human ACVR2A (encoding ACTR-IIA), ALK2, ALK3, ALK6, BMP2, BMP4, BMP6, BMP7, BMP9, IL8, NOTCH1, NOTCH 2; mouse Bmp2, Bmp6; and rat Bmpr2, Notchi, Notch2, Notch3, Tnf Reactions were amplified on a StepOnePlus™ Real-Time PCR system (Applied Biosystems).

Relative expression of each target gene was identified using the comparative 2-(AACt) method. Target gene expression was normalized to ACTB/Actb and the difference in the amount of product produced was expressed as a fold change. The relative abundance of BMP ligands was calculated, on the assumption of equal copy number, by calculating the expression of each BMP gene relative to ACTB after normalization to B2M.

Table 3. Quantitative RT-PCR primers for human

MMP24 TCGCTGGTTCTGGCGTCTGC GGGTACCCAGGCTCCACCGT (SEQ ID NO: 57) (SEQ ID NO: 58)

SRC TCCACCGGGACCTTCGTGCA AATTTGGCACCTTGCCGCGC

(SEQ ID NO: 59) (SEQ ID NO: 60)

YES GCGGCCGGAGGACAGATTTGAT ACGGACATGGTGACACTGTAGTG

(SEQ ID NO: 61 ) GG (SEQ ID NO: 62)

Table 4. Quantitative RT-PCR primers for mouse

Table 5. Quantitative RT-PCR primers

Rodent models of PAH.

For all animal work, group sizes were determined using estimates of variance and minimum detectable diiierences between groups that were based on our past experience with rodent models of PAH. Animals were randomized using an assigned animal identification number, allowing investigators performing all cardiopulmonary phenotyping procedures and histological analyses to be blinded to animal genotype and treatment group. SP-C/Tnf Mouse Model

Sperm from transgenic SP-C/TNFa mice (express a mouse Tnf cDNA driven by the human Surfactant Protein-C promoter) bred on a C56/BI6 background was kindly provided by Associate Professor Masaki Fujita (Fukuoka University, Japan). Mice were generated through in vitro fertilisation and bred through 2 generations of C57/BI6 Jax prior to crossing male SP-C/Tnf mice with female Bmpr^ ^' mice on an established C57/BI6 Jax background. Offpsring were aged to 8-9 weeks and then assessed for pulmonary haemodynamics.

Mice were anesthetized with 0.5mg/kg fentanyl and 25mg/kg fluanisone (Hypnorm®, VetaPharma Ltd, Leeds, UK) and 12.5mg/kg midazolam (Hypnovel®), and right ventricular pressures and volumes were recorded using a Millar PVR-1045 catheter (Millar Instruments, Houston, TX). Mice were then sacrificed and the hearts, lungs and livers were harvested. Right ventricular hypertrophy (RVH) was assessed by removing the heart and dissecting the right ventricle (RV) free wall from the left ventricle plus septum (LV+S) and weighing separately. The degree of right ventricular hypertrophy was determined from the ratio RV/LV+S. The right lung was snap frozen in liquid nitrogen. The left lung was inflated with a 1 :1 mixture of saline and O.C.T. compound (Sakura, Zoeterwoude, Netherlands) and fixed with 4% paraformaldehyde in PBS before dehydration and paraffin embedding.

Sugen 5416-hypoxia rat model.

Male Sprague Dawley rats (-150 to 200 g, Charles River) were given a single i.p. injection of Sugen 5416 (SU-5416; 20 mg/kg, Tocris, Bristol, UK) in vehicle (0.5% carboxyi methylce!luiose sodium, 0.4% poiysorbate 80, 0.9% benzyl alcohol, all Sigma), placed immediately into a 10% Oa chamber and maintained in hypoxia for 3 weeks, followed by 5 weeks in a normoxic environment to develop pulmonary hypertension. At the 8-week timepoint, rats were randomized into 2 groups. One group received i.p. injections of 2.5 mg/kg Etanercept (Enbrel® Pfizer) diluted in Dulbecco's Phosphate-buffered saline (D8537, Sigma-Aldrich) and the second group received vehicle alone. For hemodynamic assessment, rats were anesthetized with xylazine {4.8 mg/kg) and ketamine (7 mg/kg), body weight recorded and right and left ventricular function were assessed using a Millar SPR--869 pressure-volume catheter. Tissue harvesting and RVH determination were carried out as described above for mice.

Assessment of Pulmonary Vascular Muscu!arssation in Mouse and Rat Tissues For assessment of pulmonary arteriolar muscuiarization, sections of fixed mouse or rat lung tissue (5 μνη in thickness) were labeled with monoclonal mouse-anti- mouse/rat/human smooth muscle a-acfin (clone 1 A4, Dako, Glostrup, Denmark), followed by polyclonal goat anti- mouse HRP. The Dako ARK™ kit {Dako, Glostrup, Denmark) was used to detect staining of the mouse primary antibody in mouse lung tissue in accordance with the manufacturer's instructions. Briefly, the primary smooth muscle a-actin antibody was labeled with a modified biotinylated anti-mouse before application to the specimen. The primary antibody and biotinylation reagent were mixed in solution, resulting in binding of biotinylated secondary antibody to the primary antibody. The blocking reagent, containing normal mouse serum, was then added to the mixture to bind residual biotinylation reagent not bound to the primary antibody, minimizing the potential interaction of the biotinylated anti-mouse secondary reagent with endogenous immunoglobulin present in the specimen. T he biotin-iabeled primary antibody was then applied to the specimen followed by incubation with streptavidin- peroxidase and reaction with diaminobenzidine {DAB)-hydrogen peroxide as substrate-chromogen.

Assessment of pulmonary arteriolar muscuiarization involved the identification of alveolar ducts and the subsequent categorization of the accompanying intraacinar artery as non- , partially or fully muscularized, as judged by the degree of immunostaining for smooth muscle a-actin. A minimum of 20 vessels with diameters ranging from 25 to 75 μρπ were counted from nonseriai lung sections and categorized as either fully, partially or non-muscularized. Statistical significance was assessed by comparing the percentage of fully muscularized vessels between groups. Evaluation of wall thickness involved the identification of small arteries (<1 00 μηι) proximal to the terminal epithelial bronchioles. Using image J, the diameter and thickness of the artery was measured after immunostaining for smooth muscle a-actin. Thickness measurements were taken in four different positions of the artery. A minimum of 10 arteries were assessed in each lung section.

Assessment of muscularization and wall thickness were performed in a blinded fashion by a single researcher, to reduce operator variability, who was not aware of the group allocations of the samples being analysed. OTCH2 and NOTCH2 Immunohistochemistry in Human and Rat Lung Tissues NOTCH2 and NOTCH3 localisation and expression in human and rat lung sections was performed by staining fixed tissue sections with using rabbit anti-NOTCH2 (cat #ab1 18824, Abeam, Cambridge, UK) or rabbit anti-NOTCH3 (D1 1 B8, Cell Signaling Technology, Danvers, MA) and labelled using immunoperoxidase (Vectastain Elite, Vector Laboratories) and 3,3'-DAB to create a brown coloured reaction product.

TNFa !mmunofluarescent staining in Human Lung Tissue

Immunostaining for TNFa was performed as previously described (Al-Lamki et al., 2005, FASEB J 19:1637-1645). In brief, formalin fixed paraffin-embedded sections of human lung tissue were subjected to heat mediated antigen retrieval using citrate buffer, pH6.0 and incubated at 4°C overnight with 1 :50 dilution in blocking buffer of rabbit polyclonal anti-TNFa (IgG; cat no: ab8871 Abeam, Cambridge, UK) and 1 :250 dilution of mouse monoclonal anti-human Smooth Muscle Actin (lgG2a, clone: 1 A4; cat no: M0851 , Dakocytomation, Ely, UK). After 5 min (x3) washes, sections were further incubated for 1 h at room temperature with 1 :100 dilutions of secondary antibody in blocking buffer; donkey anti-rabbit Northern Lights IgG-NL ⁴⁹³ and donkey anti-mouse- Northern Lights anti-mouse IgG-NL ⁵⁵⁷ (R&D Systems, Oxford, UK) containing 1 μg/ml Hoechst 33342 (cat no: H3570, Fisher Scientific, Loughborough, UK). Sections were mounted in Vectashield Mounting Media and imaged with Leica SPE confocal laser scanning microscopy (Leica Microsystems (UK) Ltd, Milton Keynes, UK). Controls included use of isotype-specific primary antibody or non-immune serum.

Statistics. All data were analysed using GraphPad Prism and where numbers permitted. Data are presented as mean +/- S.E.M. Data were analysed by one-way ANOVA with post-hoc Tukey's HSD analysis or paired two-tailed Student's f-test where indicated. P<0.05 was considered significant.

Study Approval

All animal work was carried out in accordance with the UK Animals (Scientific Procedures) Act 1986 and approved under Home Office Project License 80/2460.

The collection of human lung resection tissues for pulmonary artery smooth muscle cell isolations was approved by the Papworth Hospital ethical review committee (Ethics Ref 08-H0304-56+5) and informed consent was obtained from all subjects. Results

TNFa reduces BMPR-II expression in vitro and in vivo

Several cytokines, including TNFa, IL-1 β, IL-6 and IL-8 have been implicated in the pathogenesis of PAH. Of these, only TNFa selectively reduced BMPR-II mRNA (BMPR2) and protein in distal PASMCs (dPASMCs) and pulmonary arterial endothelial cells (PAECs) (Fig. 1A-D and Fig. 2A-D), via NF-κΒ p65 (RELA) (Fig. 2E). Furthermore, immunofluorescent staining demonstrated local vascular expression of TNFa in both human IPAH and HPAH that was absent in unaffected controls (Fig. 1 E).

TNFa promotes BMPR-II cleavage and extracellular domain shedding in SMCs via ADAM 10/17

Unexpectedly, in dPASMCs (Fig. 1 C), but not PAECs (Fig. 1 D), the TNFa-mediated reduction of full length BMPR-II levels (140-150 kDa) was associated with accumulation of an intracellular 60kDa product (BMPR-II-ICP), confirmed as a BMPR-II fragment using siRNA (s BMPR2) (Fig. 3A). Furthermore, TNFa also promoted the production of this 60kDa band and reduction of full length BMPR-II in rat and mouse PASMCs, human proximal PASMCs (pPASMCs), and human aortic smooth muscle cells (Fig. 3B,C).

To confirm these observations in vivo, we examined BMPR-II expression in SP-C/Tnf mice, which overexpress mouse TNFa in the lung and developed PAH by 8 weeks of age (Fig. 1 F and Fig 4A-C). SP-C/Tnf mice exhibited reduced BMPR-II mRNA (Bmpr2) and protein and accumulation of BMPR-II-ICP in lung, but not liver (Fig. 1 G and Fig 4D,E).

The presence of the BMPR-II-ICP in PASMCs and SP-C/Tnf \ung suggested TNFa- dependent cleavage of BMPR-II. We confirmed this through immunoprecipitation of a myc-tagged BMPR-II ectodomain from conditioned media from TNFa-treated dPASMCs (Fig. 5A). Furthermore, ELISA of conditioned media from TNFa-treated PASMCs revealed enhanced endogenous soluble BMPR-II (sBMPR-ll) generation (Fig. 5B). Since BMPR-II cleavage has not been reported previously, we determined the proteolytic mechanism of TN Fa-mediated cleavage of BMPR-II in PASMCs. Previous studies demonstrated that matrix metalloproteinase-14 (MMP-14) cleaves the ΤΘΡβ co-receptors, endoglin and betaglycan and A Disintegrin and Metalloprotease-17 (ADAM17) mediates ΤΘΡβ type-l receptor ectodomain shedding. Accordingly, a pan- MMP/ADAM inhibitor, batimastat (BB94), inhibited the TNFa-dependent BMPR-II cleavage and sBMPR-ll generation (Fig. 5C,D). Transcriptional analysis of candidate metalloproteinases revealed that TNFa induced ADAM 10 and ADAM17 in dPASMCs, but not PAECs (Fig. 6A,B) and ADAM 10 and ADAM17 were increased in SP-C/Tnf mouse lung homogenates (Fig. 6C). Interestingly, only dual ADAM10/17 inhibition (Fig 6D,E) or combined siRNAs (Fig. 1 H) prevented BMPR-II cleavage and sBMPR-ll generation from PASMCs, confirming that both ADAM 10 and ADAM17 cleave BMPR-II with dual redundancy.

In silico analysis of published ADAM10/17 cleavage sites suggested selectivity for alanine-valine (Ala-Val) junctions and we identified four valines within the transmembrane domain potentially permitting sBMPR-ll generation (Fig. 7A). Mutagenesis of each valine residue demonstrated that the V163A mutation completely prevented BMPR-II cleavage (Fig. 7B) and sBMPR-ll generation (Fig. 1 1).

Many soluble receptor ectodomains function as ligand traps. Accordingly, commercially sourced recombinant BMPR-II ECD (Fig. 7C), or conditioned media from TNFa-treated dPASMCs overexpressing wild-type BMPR-II (Fig. 7D), inhibited BMP2 and BMP4 signaling, whereas media from the cleavage-resistant V163A mutant did not inhibit these responses (Fig. 7D). Of note, BMPR-II ECD neutralized the anti-proliferative effects of BMP2 and BMP4 (Fig. 7E), in a similar manner to treatment with TNFa (Fig. 7F). TNFa alters BMP2 and BMP6 signaling dynamics and influences PASMC proliferation

Having demonstrated that TNFa suppresses BMPR-II expression in vitro and in vivo, we questioned the impact on BMP signaling in the context of an existing BMPR2 mutation. We confirmed that the reduced expression of BMPR2 in dPASMCs from patients with heritable PAH (HPAH) patients is further reduced by TNFa (Fig. 8A and Fig 9A). Previous studies reported that BMPR-II loss using artificial approaches such as siRNA or floxed alleles in PASMCs reduces BMP2 and BMP4 signaling, but reveals gain-of-signaling to BMP6 or BMP7 via ALK2 and ACTR-IIA. As expected, TNFa inhibited BMP2-dependent SMAD1 /5 phosphorylation and ID1 transcription in control dPASMCs, but augmented BMP6 signaling, particularly in HPAH PASMCs (Fig. 8B,C and Fig. 9B,C). Functionally, BMP2, BMP4 and BMP6 inhibited control dPASMC proliferation whereas BMP6 promoted HPAH dPASMC proliferation and TNFa enhanced the BMP6 responses (Fig. 8D,E). The pivotal role of BMPR-II levels in this TNFa/BMP6 response was demonstrated by the switching from anti-proliferative to pro-proliferative responses following s BMPR2 in control dPASMCs (Fig. 8F), and restoration of the anti-proliferative response to BMP6 following overexpression of wild- type BMPR-II in HPAH dPASMCs (Fig. 8G).

In pulmonary vascular cells, BMP2 and BMP6 are relatively highly expressed (Fig. 10A,B). Interestingly, TNFa repressed BMP2, but consistently induced BMP6 expression in dPASMCs and PAECs (Fig. 10C,D), while other BMP ligands were unaltered (Fig. 10E). These transcriptional responses were mediated through NF-KB p65 (RELA) in dPASMCs and PAECS (Fig. 10F,G). Furthermore, BMP6 induction by TNFa was greater in HPAH dPASMCs than control cells whereas BMP2 expression was repressed equally (Fig. 10H,I). Immunoneutralization using anti-BMP6 or LDN193189, an inhibitor of ALK2/3/6 and ACTR-IIA, in C2C12-BRE cells reduced the response to TNFa (Fig. 1 1A,B). Also, LDN193189 inhibited the ID1 response to TNFa in dPASMCs without affecting the IL8 response, confirming the ID1 response is indirectly via BMP receptors and not via canonical NF-κΒ signaling (Fig. 1 1 C,D). Collectively, these data demonstrate that TNFa reduces BMPR2 and BMP2 expression, but increases BMP6 expression in pulmonary vascular cells.

To confirm the in vivo relevance of the above, we crossed the SP-C/Tnf mouse with a Bmpr2 ^+/~ mouse that does not develop significant PAH at baseline. Consistent with our hypothesis, SP-C/Tnf/Bmpr2 ^+/~ mice developed more severe PAH (Fig. 1 F) and right ventricular hypertrophy (Fig. 4A) compared with SPC/Tnf/Bmpr2 ^+/+ mice. Furthermore, the combined genetic background in SP-C/Tnf/Bmpr2 ^+/~ mice caused additional repression of Bmpr2 and enhanced Bmp6 expression (Fig. 4D,F) compared with SPC/Tnf/Bmpr2 ^+/+ mice. Lung TNFa overexpression also promoted pulmonary arteriolar muscularization (Fig. 4B,C) and repressed Bmp2 (Fig. 4G), albeit to similar extents in SP-C/Tnf/Bmpr2 ^+/+ and SP-C/Tnf/Bmpr2 ^+/ - mice.

ALK2 and ACTR-IIA are required for BMP6-mediated HPAH PASMC proliferation We next determined the receptors utilized by BMP6 to promote PASMC proliferation. Both LDN-193189 (Fig. 12A,B) and ALK2 siRNA (Fig. 12C,D) abolished the antiproliferative response to BMP6 in control PASMCs and the pro-proliferative response in HPAH PASMCs. Furthermore, ACTR-IIA siRNA (s ACVR2A) eliminated the enhanced TNFa/BMP6-dependent SMAD1/5 phosphorylation (Fig. 12E), ID1 induction (Fig. 12F) and proliferative responses (Fig. 12G) of HPAH PASMCs. TNFa enhanced ACVR2A expression in HPAH PASMCs without altering ALK2, ALK3 or ALK6 expression (Fig. 13A,B). From these observations, we conclude that ALK2 mediates BMP6 signaling in PASMCs and TNFa-induced loss of BMPR-II permits preferential ACTR-IIA signaling, thus driving HPAH PASMC proliferation.

TNFa alters NOTCH signaling in HPAH PASMCs

The heightened Smad/ID signaling to BMP6/TNFa is unlikely to promote dPASMC proliferation since Smad/ID signaling inhibits PASMC proliferation and reduced pulmonary vascular Smad/ID signaling is consistently reported in PAH in humans and animal models. As NOTCH3 is implicated in PASMC hyperplasia in PAH and TNFa induces the ADAM17-dependent cleavage of NOTCH, we examined NOTCH signaling in HPAH dPASMCs. Unexpectedly, TNFa increased NOTCH1 and NOTCH2 intracellular domain (ICD) generation while reducing NOTCH3-ICD, the full-length NOTCH proteins being too faint to observe (Fig. 14A-C). Accordingly, the transcription of NOTCH2 and its targets, HEY1 and HEY2 was increased, whereas NOTCH3 and its target, HES1, were suppressed (Fig. 15A-F and Fig. 16A-G). As BMP6 enhanced these responses, we questioned whether BMPR-II and ACTR-IIA regulate NOTCH signaling. In control dPASMCs, si BMPR2 enhanced TNFa-induced NOTCH2-ICD generation and NOTCH2 transcription, affecting NOTCH1 less: BMP6 co-incubation accentuated the NOTCH2 response (Fig. 17A and Fig. 18A,B). BMPR2 silencing also promoted the TNFa-dependent reduction of NOTCH3-ICD generation and NOTCH3 transcription, again enhanced by BMP6 (Fig. 17A and Fig. 18C). In control dPASMCs, the TNFa- dependent NOTCH2 induction following s BMPR2 was inhibited by co-silencing with s\ACVR2A (Fig. 18B). Of note, s\ACVR2A reduced BMP6-stimulated NOTCH2 expression regardless of s BMPR2 in control dPASMCs (Fig. 18B). In BMPR2 heterozygous HPAH PASMCs treated with TNFa, s ACVR2A reduced NOTCH2-ICD generation and abrogated NOTCH3-ICD reduction (Fig. 17B). Collectively, these data indicate that TNFa alone, or with BMP6, regulates NOTCH expression in PASMCs via preferential ACTR-IIA signaling in BMPR-ll-deficient cells.

Consistent with our in vitro data Notch2 mRNA expression and ICD levels were increased and Notch3 decreased in the lungs, but not livers, of mice expressing SP- C/Tnf compared to control mice (Fig 17C,D and Fig. 18D-F). Moreover, concentric pulmonary arteriolar lesions in HPAH demonstrated increased medial NOTCH2 immunostaining compared to control vessels, whereas NOTCH3 levels were low in both (Fig. 17E). NOTCH signaling mediates the proliferation of HPAH PASMCs to TNFct/BMP6

We addressed whether NOTCH signaling mediates the proliferative response of HPAH PASMCs to TNFa/BMP6. The γ-secretase inhibitor DAPT, previously reported to inhibit PASMC proliferation through NOTCH3 blockade, both prevented the proliferative responses of HPAH PASMCs to TNFa and BMP6 (Fig. 19A) and inhibited the anti-proliferative BMP6 response in control PASMCs (Fig. 19B). NOTCH2 siRNA reduced this proliferation of HPAH PASMCs to TNFa and BMP6, whereas NOTCH3 siRNA did not (Fig. 17F,G). In control PASMCs, NOTCH3 siRNA attenuated the antiproliferative responses whereas NOTCH2 siRNA had no effect (Fig. 17H,I). Consistent with the NOTCH2-dependent proliferation of HPAH dPASMCs to TNFa and BMP6, either HEY1 or HEY2 knockdown prevented this response (Fig. 19C). Collectively, these data suggest that HPAH is associated with loss of the anti-proliferative NOTCH3 pathway and gain of pro-proliferative NOTCH2 responses via HEY1 and HEY2. c-SRC family kinases activated by TNFa and BMP6 regulate NOTCH

Since, the kinase c-SRC integrates BMP and NOTCH signaling and has been implicated in PAH, we questioned whether the SRC family provided the mechanistic link between these pathways. SRC family activation was assessed through tyrosine- 527 (Y527) dephosphorylation and tyrosine 416 (Y416) phosphorylation (Fig. 20A). HPAH PASMCs exhibited SRC family activation to TNFa alone, or with BMP6, whereas control PASMCs did not (Fig. 20B). Importantly, s BMPR2 transfection in control dPASMCs recapitulated the SRC activation to TNFa and BMP6 seen in HPAH PASMCs (Fig. 20C). Conversely, s ACVR2A abolished SRC activation in HPAH PASMCs (Fig. 20D). Furthermore, the use of a pan SRC inhibitor in HPAH PASMCs abrogated the transcriptional induction of NOTCH1 and NOTCH2 and repression of NOTCH3 by TNFa (Fig. 21A-C). Collectively, these data suggest that TNFa, and to a lesser extent BMP6, activate SRC kinases to regulate NOTCH1-3 in PASMCs.

SRC antibodies detect multiple family members, including FYN and YES, so we determined the contributions of individual members to the NOTCH responses in HPAH PASMCs, particularly as SRC and FYN can interact with BMPR-II and ACTR-IIA, respectively. In HPAH PASMCs, siRNA targeting FYN prevented the TNFa-dependent NOTCH1 and NOTCH2 induction and NOTCH3 repression (Fig. 20E,F and Fig 21 D) whereas either FYN or YES mediated the repression of NOTCH3 by BMP6 (Fig. 20F). FYN or YES siRNAs also abolished the proliferative response to TNFa or BMP6 alone, or in combination (Fig. 20G). In control PASMCs, loss of YES or SRC reduced serum- dependent proliferation but minimally impacted on the BMP6 and TNFa responses (Fig. 20H). TNFa antagonism ameliorates experimental PAH and reverses aberrant TNF/BMP signaling

Having demonstrated that TNFa subverts BMP signaling and drives PASMC proliferation via c-SRC and NOTCH2, we examined this in the rat sugen-hypoxia (S/H) model of PAH (Fig. 23A). We also explored the impact of the anti-TNFa therapeutic, etanercept (soluble TNFR-II conjugated to human IgG-Fc) on established PAH. Exposure of rats to S/H induced robust PAH (Fig. 22A,B) associated with pulmonary vascular remodeling (Fig. 22C and Fig. 23B). Etanercept reversed the progression of PAH, reducing RVSP, right ventricular hypertrophy and muscularization of alveolar duct-associated arterioles (Fig 22A-C), without altering left ventricular function (Table 6). The development of PAH in the S/H model was associated with BMP and NOTCH signaling changes consistent with our in vitro data. Bmpr2 expression and Smad1 /5 signaling were reduced (Fig 22D,E) and Acvr2a, Alk2, Bmp6 and Tnf expression were all increased (Fig. 22D and Fig. 23C,D). Also, Notch2, Hey1 and Hey2 expression and medial Notch2 staining were increased in S/H rats (Fig. 22E,F,H and Fig. 23F) whereas Notch3 and Hes1 were reduced (Fig. 22E,G and Fig. 23G). Furthermore, we observed increased caspase-3 cleavage (endothelial apoptosis) and alpha smooth muscle actin expression (muscularization) (Fig. 22E). In S/H animals treated with etanercept, the reversal of PAH progression was associated with restored BMPR-II, phospho-Smad1/5 and Notch3 expression (Fig. 22D,E,G) and a reduction of the pathological increases in Acvr2a, Alk2, Bmp6, Tnf, Notch2, Hey1, Hey2, cleaved caspase-3 and alpha-smooth muscle actin (Fig. 22D-F and Fig. 23C,D,F). These observations support our contention that increased TNFa signaling in PAH causes an imbalance of BMP and NOTCH signaling that can be redressed through therapeutic targeting of the TNFa pathway.

Consistent with a previous report showing that the enhanced BMP7-dependent Smadd response due to BMPR-II loss was transient (Yu et al., 2008, J. Biol. Chem. 283: 3877), we confirmed that siRNA-mediated loss of BMPR-II in control PASMCs led to an enhanced BMP6-dependent Smad1/5 phosphorylation at 1 hour that was not observed at 4 hours or 24 hours (FIG. 24A,B).

Comparison of the basal protein levels of the cleaved/transmembrane intracellular (NTM) regions of NOTCH 1 , NOTCH2 and NOTCH3 indicated no difference in their expression between control and HPAH PASMCs (FIG. 24C,D).

Discussion

The mechanisms by which loss-of-function BMPR2 mutations underlie severe PAH with low penetrance have remained elusive. Here, we provide novel mechanistic insights into a critical interaction whereby TNFa drives the development of PAH by repressing vascular BMPR-II transcription and promoting BMPR-II cleavage in PASMCs. This impact of severe BMPR-II reduction combined with enhanced BMP6 signaling via ALK2/ACTR-IIA and c-SRC family members, promotes PASMC proliferation through aberrant NOTCH2/3 signaling. Furthermore we confirm these alterations in the hypertensive lungs of PAH patients and preclinical rodent PAH models. The observation that etanercept treatment in preclinical PAH normalized BMPR-II levels, restored normal NOTCH signaling and reversed the progression of PAH provides a justification to explore the clinical use of anti-TNFa approaches in PAH patients.

Inflammatory cytokines are associated with the pathogenesis of PAH and our demonstration that TNFa suppressed BMPR-II in pulmonary vascular cells confirms reports in osteoblasts and aortic endothelial cells. Furthermore, TNFa exacerbates the genetic BMPR2 haploinsufficiency in HPAH PASMCs causing the substantial reduction of BMPR-II levels that allow BMP6 to switch signaling to the alternative type II receptor, ACTR-IIA. Also, TNFa increased BMP6 expression in PASMCs and hPAECs and induced ACTR-IIA expression in HPAH PASMCs. The resulting BMP6/ALK2/ACTR-IIA utilization induced paradoxical increases in transient Smad1/5 responses, characteristic of BMP receptor complex switching. Since PAH is associated with reduced Smad signaling, this transient Smad response was unlikely to promote heightened PASMC proliferation, so other candidate pathways were considered.

Emerging evidence implicates NOTCH in the pathogenesis of PAH. NOTCH inhibition by soluble JAGGED1 attenuates PAH in hypoxic and MCT-PAH rat models. Our data suggest that, on the background of BMPR-II haploinsufficiency, inappropriate NOTCH2 responses to TNFa stimulate PASMC proliferation. NOTCH2 is abundantly expressed in vascular SMCs and NOTCH2 deletion reduces SMC number and causes embryonic lethality. The NOTCH3 reduction we observed was surprising given previous reports of NOTCH3 promoting PAH. However, these previous studies used DAPT as the therapeutic intervention in PAH models, which blocks NOTCH2 and NOTCH3 cleavage. DAPT inhibited the proliferative responses of our HPAH PASMCs, so NOTCH2 blockade may be relevant to these previous reports. We observed low baseline NOTCH3 staining in the pulmonary arterial media, so further reduction in PAH was less obvious than the robust increase in NOTCH2 staining. Our data imply that NOTCH2, via HEY1 /HEY2, enhances HPAH cell proliferation, while NOTCH3 appears critical in suppressing PASMC proliferation. We explored the role of SRC family kinases in linking the TNFa, BMP and NOTCH pathways. As BMPR-II sequesters c-SRC and renders it inactive following BMP stimulation, we contemplated that BMPR-II reduction increases the availability of SRC kinases to interact with ACTR-IIA or TNFa receptors. In this context, we identified FYN as a key regulator of the aberrant NOTCH2 signaling and proliferation to TNFa and a dual role for FYN and YES in the proliferative response to TNFa and BMP6. To date, only one report has identified an interaction of FYN and ACTR-IIA in neuronal cells, so our study is the first to identify the roles of specific SRC members in the HPAH PASMC proliferative response, reminiscent of the constitutive activation of these proto- oncogenes in carcinogenesis.

We have found that TNFa induces BMP6 and exacerbates the reduced BMPR-II expression in HPAH PASMCs, enabling BMP6 to recruit the ALK2/ACTR-IIA receptor complex. TNFa promotes excessive PASMC proliferation via activation of FYN and the NOTCH2-HEY1 /2 axis, while simultaneously suppressing the antiproliferative NOTCH3-HES1 axis. Collectively, these findings provide a mechanism by which inflammatory TNFa signaling, promotes pulmonary vascular remodeling in the setting of BMPR-II deficiency. Such mechanisms may be responsible for disease penetrance in patients carrying mutations in BMPR-II. Moreover, our findings provide a basis for the testing of anti-TNFa approaches in treatment of PAH and other vascular and respiratory diseases, and in the prevention of disease in at-risk cohorts.

Summary

Heterozygous germ-line mutations in the bone morphogenetic protein type-ll receptor (BMPR-II) gene underlie heritable pulmonary arterial hypertension (HPAH). Although inflammation promotes PAH, the mechanisms by which inflammation and BMPR-II dysfunction conspire to cause disease remain unknown. Here we identify that TNFa selectively reduces BMPR-II transcription and mediates post-translational BMPR-II cleavage via the sheddases, ADAM10 and ADAM17 in pulmonary artery smooth muscle cells (PASMCs). This TNFa-mediated suppression of BMPR-II, particularly in the setting of BMPR-II haploinsufficiency, subverts BMP signaling leading to BMP6- mediated PASMC proliferation via preferential activation of an ALK2/ACTR-IIA signaling axis. Furthermore, TNFa, acting via SRC family kinases, increased pro- proliferative NOTCH2 signaling in HPAH PASMCs with reduced BMPR-II expression. We confirmed this signaling switch in rodent models of PAH and demonstrated that anti-TNFa immunotherapy reverses disease progression, restoring normal BMP/NOTCH signaling. Collectively, these findings indicate novel mechanisms by which BMP and TNFa signaling contribute to disease, and suggest a tractable approach for therapeutic intervention in PAH and other vascular and respiratory diseases.

EXAMPLE 2- Exemplification in rat Sugen-hypoxia model Introduction

This example describes administration of etanercept and a BMP9 variant or BMP10 to assess effect on PAH in the rat Sugen-hypoxia model.

Methods

Sugen 541 S-hypoxia rat model

Male Sprague Dawley rats (-150 to 200 g, Charles River) are given a single i.p. injection of Sugen 5416 (SU-5416; 20 mg/kg, Tocris, Bristol, UK) in vehicle (0.5% carboxyi methylcellulose sodium, 0.4% poiysorbate 80, 0.9% benzyl alcohol, all Sigma), placed immediately into a 10% 0 ₂ chamber and maintained in hypoxia for 3 weeks, followed by 5 weeks in a normoxic environment to develop pulmonary hypertension. At the 8-week timepoint, rats are randomized into 4 groups. Group 1 receive twice weekly i.p. injections of 2.5 mg/kg Etanercept (Enbrel® Pfizer) diluted in saline. Group 2 receive 600ng/day i.p of a candidate from BMP9 (or a variant thereof or B P10) in saline. Group 3 receive receive twice weekly i.p. injections of 2.5 mg/kg Etanercept (Enbrel© Pfizer) in saline and 600ng/day i.p of a candidate from BMP9 (or a variant thereof or BMP10) in saline. Group 4 receive saline alone. For hemodynamic assessment, rats are anesthetized with isofiuorane, body weight recorded and right and left ventricular function assessed using a Miliar SPR-869 pressure-volume catheter. Rats are then sacrificed and the hearts, lungs and livers harvested. Right ventricular hypertrophy (RVH) is assessed by removing the heart and dissecting the right ventricle (RV) free wall from the left ventricle plus septum (LV+S) and weighing separately. The degree of right ventricular hypertrophy is determined from the ratio RV/LV+S. The right lung is snap frozen in liquid nitrogen. The left lung is inflated with a 1 :1 mixture of saline and O.C.T. compound (Sakura, Zoeterwoude, Netherlands) and fixed with 4% paraformaldehyde in PBS before dehydration and paraffin embedding. Assessment of Pulmonary Vascular Muscu arization

For assessment of pulmonary arteriolar muscularization, sections of fixed rat lung tissue (5 μπι in thickness) are labeled with monoclonal mouse-anti-mouse/rat/human smooth muscle a-actin (clone 1 A4, Dako, Glostrup, Denmark), followed by polyclonal goat anti-mouse HRP. The Dako ARK™ kit {Dako, Glostrup, Denmark) is used to detect staining of the mouse primary antibody in mouse lung tissue in accordance with the manufacturer's instructions. Briefly, the primary smooth muscle a-actin antibody is labeled with a modified biotinyiated anti-mouse before application to the specimen. The primary antibody and biotinylation reagent are mixed in solution, resulting in binding of biotinyiated secondary antibody to the primary antibody. The blocking reagent, containing normal mouse serum, is then added to the mixture to bind residual biotinylation reagent not bound to the primary antibody, minimizing the potential interaction of the biotinyiated anti-mouse secondary reagent with endogenous immunoglobulin present in the specimen. The biotin -labeled primary antibody is then applied to the specimen followed by incubation with streptavidin-peroxidase and reaction with diaminobenzidine (DAB)-hydrogen peroxide as substrate-chromogen.

Assessment of pulmonary arteriolar muscularization involves the identification of alveolar ducts and the subsequent categorization of the accompanying intraacinar artery as non-, partially or fully muscuiarized, as judged by the degree of immunostaining for smooth muscle a-actin. A minimum of 20 vessels with diameters ranging from 25 to 75 μηι are counted from nonserial lung sections and categorized as either fully, partially or non-muscuiarized. Statistical significance is assessed by comparing the percentage of fully muscuiarized vessels between groups.

Evaluation of wall thickness involves the identification of small arteries (< 100 μνη) proximal to the terminal epithelial bronchioles. Using image J the diameter and thickness of the artery is measured after immunostaining for smooth muscle a-actin. Thickness measurements are taken in four different positions of the artery. A minimum of 10 arteries are assessed in each lung section.

These assessments of muscularization and wall thickness are performed in a blinded fashion by a single researcher, to reduce operator variability, who is not aware of the group allocations of the samples being analyzed.

Immunoblotting. Frozen liver and lung tissue are homogenized in lysis buffer (250 mM Tris-HCI, pH 6.8, 4% SDS, 20% v/v glycerol, EDTA-free protease inhibitor cocktail (Roche, West Sussex, UK)), sonicated and centrifuged for 15 minutes at 15,000 x g. Lysates (20-100 μg protein) are separated by SDS-PAGE and proteins transferred to polyvinylidene fluoride membranes by semidry blotting (GE Healthcare, Buckinghamshire, UK). Membranes are then blocked and probed with rabbit polyclonal antibodies toward total Smadl , phosphorylated SRC(Y527) (all Cell Signaling Technology, Danvers, MA), ADAM10, ADAM 17 (Abeam, Cambridgeshire, UK); rabbit monoclonal antibodies toward phosphorylated Smad1/5, caspase-3, cleaved caspase- 3, NOTCH1 , NOTCH2, NOTCH3, phospho-SRC(Y416) and SRC (Cell Signaling Technology, Danvers, MA), ID1 (CalBioreagents, San Mateo, CA); or mouse monoclonal antibodies toward BMPR-II (BD Transduction Laboratories, Franklin Lakes, NJ). After washing, blots are incubated with secondary anti-mouse/rabbit horseradish peroxidase antibody (Dako, Glostrup, Denmark) for 1 h at room temperature. As a loading control, all blots are re-probed with a monoclonal antibody toward either a- tubulin (Sigma) or β-actin (Sigma), Densitometry is performed using !mageJ software. Membranes are developed using enhanced chemiluminescence (GE Healthcare).

RNA Preparation and Quantitative RT-PCR. Total RNA is extracted using the RNeasy Mini Kit with DNAse digestion (Qiagen, West Sussex, UK). cDNA is prepared from ~1 μg of RNA using the High Capacity Reverse Transcriptase kit (Applied Biosystems, California, USA), according to the manufacturer's instructions. All qPCR reactions are prepared in MicroAmp® optical 96-well reaction plates (Applied Biosystems) using 50 ng/μΙ cDNA with SYBR®Green Jumpstart™ Taq Readymix™ (Sigma-Aldrich), ROX reference dye (Invitrogen) and custom sense and anti-sense primers (all 200 nM). QuantiTect primers are used for rat Bmpr2, Notch l, Notch2, Notch3 and Tnf. Reactions are amplified on a StepOnePlus™ Real-Time PCR system (Applied Biosystems).

Relative expression of each target gene is assessed using the comparative 2-(AACt) method. Target gene expression is normalized to ACTB/Actb and the difference in the amount of product produced expressed as a fold change. The relative abundance of BMP ligands is calculated, on the assumption of equal copy number, by calculating the expression of each BMP gene relative to ACTB after normalization to B2M. Statistics. All data are analysed using GraphPad Prism. Data are presented as mean +/- S.E.M. Data are analysed by one-way ANOVA with post-hoc Tukey's HSD analysis or paired two-tailed Student's f-test where indicated. P<0.05 is considered significant.

Although the present invention has been described with reference to preferred or exemplary embodiments, those skilled in the art will recognize that various modifications and variations to the same can be accomplished without departing from the spirit and scope of the present invention and that such modifications are clearly contemplated herein. No limitation with respect to the specific embodiments disclosed herein and set forth in the appended claims is intended nor should any be inferred.

All documents cited herein are incorporated by reference in their entirety.