Enhanced Protein Production in T. reesei by Co-expression of Selected Genes

Cross-References to Related Applications [01] The present application claims benefit of and priority to U.S. Provisional Application Ser. No. 60/859,412, entitled " Enhanced Protein Production in T. reesei by Co-expression of Selected Genes ", filed November 15, 2006, incorporated herein by reference in its entirety.

Field of the Invention

[02] The invention relates to novel strains of Trichoderma reesei with improved cellulase production, and uses thereof. Also, described herein are methods of altering protein expression, especially cellulase expression.

Background of the Invention

[03] Enzyme washing is commonly used as a wet process technique to improve textile handle, appearance and other surface characteristics of various textiles (e.g., cottons and cotton blends) during industrial processing procedures. One example of the successful application of enzyme technology in the textile industry is the replacement of traditional stone washing (which is very time consuming and labor intensive) in denim processing by cellulase washing. Hydrolysis of cellulase, a major component of cotton, with cellulase is also useful for the biopolishing of cotton and cotton blend fabrics by cleavage of glycosidic bonds in cellulose molecules. Biopolishing is a technique used to enhance the aesthetic performance of cotton-based textiles. Cellulases are also, for example, in detergents. [04] Additional benefits to using cellulases to treat cotton-containing fabrics include the removal of sizing from the fabric (sizing is a composition used to stiffen fabric so it is easier to handle in the manufacture of, for example, garments) removing fuzz and pills from the surface of the fabric and, as mentioned above, giving a stone-washed appearance and feel to the fabric. Still, improvements in the effectiveness and efficiency of cellulase treatment of fabrics will be beneficial to the garment and textile industries as well as other industries such as in the manufacture of detergents.

[05] Despite intensive research related to the use of cellulases in industrial processes, cellulases known and used in the art have shown significant drawbacks. For example, cellulase

production by microorganisms is often low and, therefore, inefficient from a commercial standpoint. Therefore, what is needed are new strains of microorganisms that improve the efficiency of cellulase production.

Summary of the Invention

[06] The applicants have identified four genes (genes of interest: GOI) whose overexpression in microorganisms (e.g., T. reesei) results in increased cellulase production. The applicants have created novel strains of T. reesei that overexpress at least one of the GOI. These strains have been designated Ssol, Dpml, Xyrl and Snf4, after the identified GOI. [07] Accordingly, the invention features novel strains of T. reesei suitable for the enhanced production of cellulase over the parent strain, methods of producing cellulase from the novel strains of T. reesei of the present invention and the specific nucleotide sequences (SEQ ID NOs: 1, 2, 3, 4 and 10) and amino acid sequences (SEQ ID NOs: 5 - 9) responsible for the improvements in cellulase production, when one or more of these genes is overexpressed (see, Figure 1). In some embodiments the microorganism is transformed with a) a nucleotide sequence selected from SEQ ID NOs: 1, 2, 3, 4, and 10; b) a nucleotide sequence encoding the amino acid sequence selected from SEQ ID NO: 5, 6, 7, 8 and 9; c) a nucleotide sequence encoding the amino acid sequence selected from SEQ ID NOs: 5, 6, 7, 8 and 9; d) a nucleotide sequence having at least 85% sequence identity to a sequence selected from SEQ ID NOs: 1, 2, 3, 4, and 10, wherein said nucleotide sequence encodes a polypeptide having activity selected from Ssol, Dpml, Xyrl and Snf4 activity; e) a nucleotide sequence having at least 25 consecutive nucleotides selected from SEQ ID NOs: 1, 2, 3, 4, and 10: or a complement thereof, f) a nucleotide sequence encoding an amino acid sequence of a polypeptide having at least 85% sequence identity to sequence selected from SEQ ID NOs: 5, 6, 7, 8 and 9, wherein said polypeptide has activity selected from Ssol, Dpml, Xyrl and Snf4 activity; or g) a nucleotide sequence encoding an amino acid sequence of a polypeptide having at least 85% sequence identity sequence selected from SEQ ID NOs: 5, 6, 7, 8 and 9, wherein said polypeptide has activity selected from Ssol, Dpml, Xyrl and Snf4 activity. [08] In an embodiment the invention is directed to a vector comprising a nucleic acid encoding a GOI. In another aspect there is a construct comprising the nucleic acid of encoding the GOI operably linked to a regulatory sequence.

[09] In an embodiment the invention is directed to a host cell transformed with the vector comprising a nucleic acid encoding at least one GOI.

[10] Cellulases are enzymes that hydrolyze cellulose (e.g., β-l,4-D-glucan linkages) and produce as primary products glucose, cellobiose and cellooligosaccharides. The cellulases used in the textile industry are produced by several different microorganisms and comprise several different enzyme classifications including those identified as exo-cellobiohydrolases (CBH), endoglucanases (EG) and β-glucosidases (BG) (M. Schulein, Methods in Enzymology, vol. 160, pp. 235-242 (1988)).

[11] The applicants have identified four nucleotide sequences responsible for the increased production of cellulase by T. reesei strains Ssol, Dpml, Xyrl and Snf4, which are presented in Figure 1, and are SEQ ID NOS: 1, 2, 3, 4, and 10 respectively. Likewise, it is contemplated that the nucleotide sequences of the present invention are used in screening assays for the detection of, e.g., other strains of T. reesei or other microorganisms effective in cellulase production of cellulase or for homologs and sequence variants of the sequences of the present invention. Examples of suitable screening methods include, but are not limited to, Northern blotting, Southern blotting, PCR, yeast two-hybrid analysis, etc., all of which are well known by those practiced in the art.

[12] In certain embodiments, the present invention contemplates a composition comprising a biologically pure culture of Trichoderma reesei strain Ssol, Dpml, Xyrl or Snf4, or a combination thereof. In the context of the present invention the term "a biologically pure culture" or "pure culture" is defined as a culture wherein the predominate microorganism(s) in the culture is (are) the microorganism(s) that were intentionally inoculated into the culture media. In one embodiment, the culture comprises at least 50% of the intentionally inoculated microorganism(s). In another embodiment the culture comprises at least 75% of the intentionally inoculated microorganism(s). In yet another embodiment the culture comprises at least 95% of the intentionally inoculated microorganism(s). The culture need not be 100% free of other organisms providing the other organisms do not substantially interfere with the growth of the T. reesei strains of the present invention.

[13] In another embodiment the invention is directed to a method of producing a transformed host cell comprising the steps of:

(a) transforming a host cell with the vector comprising a nucleic acid encoding at least one GOI;

(b) culturing said transformed host cell in a suitable culture medium under suitable conditions.

[14] In another embodiment, the present invention contemplates a culture of T. reesei strains S sol, Dpml, Xyrl and Snf4, either alone or in combination, where the culture has the capability to produce cellulase enzymes. The ability to culture T. reesei for the production of cellulase enzymes is known by those practiced in the art as is exemplified in the Experimental section, infra, and in U.S Patent Nos. 4,797,361 , 4,762,788 and 4,472,504, which are incorporated herein by reference.

[15] It is an embodiment of the present invention that the novel T. reesei strains of the present invention are used in methods for the production of cellulase. For example, a method is contemplated wherein a suitable sterile growth medium is inoculated with one or more strains of T. reesei selected from the group consisting of T. reesei strains Ssol, Dpml, Xyrl and Snf4, and the inoculated growth medium is incubated under conditions which will permit the growth of said T. reesei strain. The present invention is not limited to any particular growth/culture medium (e.g., LB broth) or any particular culture method (e.g., batch culture, continuous flow culture, etc.). Any complex or defined medium that supports growth and is conductive of cellulase production is suitable. Examples of suitable media and culture methods are disclosed in US Patent No. 7,037,704 to Dunn-Coleman, et al, which is incorporated herein by reference, or media disclosed in Ilmen, M., Saloheimo, A., Onnela, M., and Penttila, M.E., 1997, App Environ Microbiol 63, 1298-1306, which is incorporated herein by reference. It is further contemplated that the sterile growth medium additionally comprises an inducer of cellulase production. Non-limiting examples of suitable inducers are cellulose, lactose, sophorose and glucose/sophorose. In a preferred embodiment the inducer of cellulase production is cellulose. In another embodiment, the inducer of cellulase production is glucose/sophorose (see US-2004- 0121446, which is incorporated herein by reference). [16] It is an embodiment of the present invention that the cellulases in the form of "whole cellulase" produced by the T. reesei strains of the present invention are purified from the culture medium. There are three major components in cellulases: endo-glucanases, exo-glucanases (also known as cellobiohydrolases), and β-glucosidases (also known as cellobiases). A "total" or "whole" cellulase preparation contains mixtures of these three enzyme types. In the first step of cellulose degradation, endo-glucanases cleave internal glucosidic bonds in the cellulose chain producing shorter chains. Exo-glucanases then produce cellobiose in a stepwise manner from the nonreducing end of the cellulose chains and, finally, cellobiases hydrolyze cellobiose to glucose. In yet another embodiment of the present invention, the cellulases that are produced by the T. reesei strains of the present invention are not "whole cellulases."

[17] In yet a further embodiment there is provided a method of altering the expression and/or secretion of a protein of interest comprising the steps of:

(a) culturing a host cell transformed with a vector comprising at least one GOI in a suitable culture medium under suitable conditions to produce the protein of interest; (b) obtaining said produced protein of interest.

In this embodiment, the host cell is also capable of expressing the desired protein either naturally or by having been transformed with an appropriate vector comprising a nucleic acid sequence that encodes the desired protein.

Brief Description of the Drawings

[18] Figures IA-E show the nucleic acid sequences and amino acid sequences of the GOI of

Ssol SEQ ID NOs: 1 & 10, and SEQ ID NO: 5; Xyrl SEQ ID NO: 2 and SEQ ID NO: 6; Dpml

SEQ ID NO: 3 and SEQ ID NO: 7; Snf4, SEQ ID NO: 4 and SEQ ID NOs: 8 & 9; respectively.

[19] Figure 2 shows an exemplary expression vector used for the transformation of spores of pyr- parent strain of T. reesei.

[20] Figure 3 shows the results of protein assays using T. reesei strains Ssol, Dpml, Xyrl and

Snf4.

[21] Figures 4A-D show the results of RNA expression assays using T. reesei strains Ssol,

Dpml, Xyrl and Snf4.

Definition Section

[22] It should be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the content clearly dictates otherwise.

Thus, for example, reference to a composition containing "a compound" includes a mixture of two or more compounds. It should also be noted that the term "or" is generally employed in its sense including "and/or" unless the content clearly dictates otherwise.

[23] A "heterologous promoter," as used herein is a promoter which is not naturally associated with a gene, gene portion or a purified nucleic acid.

[24] A "purified preparation" or a "substantially pure preparation" of a polypeptide, as used herein, means a polypeptide that has been separated from other proteins, lipids, and nucleic acids with which it naturally occurs. Preferably, the polypeptide is also separated from substances, e.g., antibodies or gel matrix, e.g., polyacrylamide, which are used to purify it. Preferably, the polypeptide constitutes at least 10, 20, 50, 70, 80 or 95% dry weight of the purified preparation.

Preferably, the preparation contains: sufficient polypeptide to allow protein sequencing; at least 1, 10, or 100 mg of the polypeptide; at least 1, 10, or 100 mg of the polypeptide. [25] A "purified preparation of cells," as used herein, refers to, in the case of plant or animal cells, an in vitro preparation of cells and not an entire intact plant or animal. In the case of cultured cells or microbial cells, it consists of a preparation of at least 10% and more preferably 50% of the subject cells as a portion of the total number of cells.

[26] A "substantially pure nucleic acid," e.g., a substantially pure DNA, is a nucleic acid which is one or both of: not immediately contiguous with either one or both of the sequences, e.g., coding sequences, with which it is immediately contiguous (i.e., one at the 5' end and one at the 3' end) in the naturally-occurring genome of the organism from which the nucleic acid is derived; or which is substantially free of a nucleic acid sequence with which it occurs in the organism from which the nucleic acid is derived. The term includes, for example, a recombinant DNA which is incorporated into a vector, e.g., into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g. , a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other DNA sequences.

[27] "Homologous," as used herein, refers to the sequence similarity between two polypeptide molecules or between two nucleic acid molecules. When a position in both of the two compared sequences is occupied by the same base or amino acid monomer subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then the molecules are homologous at that position. The percent of homology between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of positions compared x 100. For example, if 6 of 10, of the positions in two sequences are matched or homologous then the two sequences are 60% homologous. By way of example, the DNA sequences ATTGCC and TATGGC share 50% homology. Generally, a comparison is made when two sequences are aligned to give maximum homology.

[28] The terms "peptides," "proteins" and "polypeptides" are used interchangeably herein. [29] The term "protease" means a protein or polypeptide domain of a protein or polypeptide derived from a microorganism, e.g., a fungus, bacterium, or from a plant or animal, and that has the ability to catalyze cleavage of peptide bonds at one or more of various positions of a protein carbohydrate backbone.

[30] The term "cellulase," as defined herein, refers to enzymes that break down cellulose and may be suitable for use in the textile industry for the treatment of cotton and cotton-blend fabrics. They are often produced in large amounts by certain fungi and bacteria. [31] As used herein, the phrases "whole cellulase preparation" and "whole cellulase composition" are used interchangeably and refer to both naturally occurring and non-naturally occurring compositions. A "naturally occurring" composition is one produced by a naturally occurring source and which comprises one or more cellobiohydrolase-type, one or more endoglucanase-type, and one or more β-glucosidase components wherein each of these components is found at the ratio produced by the source. A naturally occurring composition is one that is produced by an organism unmodified with respect to the cellulolytic enzymes such that the ratio of the component enzymes is unaltered from that produced by the native organism. [32] A "non-naturally occurring" cellulose composition encompasses those compositions produced by: (1) combining component cellulolytic enzymes either in a naturally occurring ratio or non-naturally occurring, i.e., altered, ratio; or (2) modifying an organism to overexpress or underexpress one or more cellulolytic enzyme; or (3) modifying an organism such that at least one cellulolytic enzyme is deleted.

[33] "pTREX2g," as used herein, refers to 1) an expression vector that can be transformed into T. reesei. [34] As used herein, "microorganism" refers to a bacterium, a fungus, a virus, a protozoan, and other microbes or microscopic organisms.

[35] As used herein, "derivative" means a protein which is derived from a precursor protein {e.g., the native protein) by addition of one or more amino acids to either or both the C- and N- terminal end, substitution of one or more amino acids at one or a number of different sites in the amino acid sequence, deletion of one or more amino acids at either or both ends of the protein or at one or more sites in the amino acid sequence, or insertion of one or more amino acids at one or more sites in the amino acid sequence. Derivatives of the GOI of the present invention are included within the scope of the present invention.

[36] As used herein, "percent (%) sequence identity" with respect to the amino acid or nucleotides sequences identified herein is defined as the percentage of amino acid residues or nucleotides in a candidate sequence that are identical with the amino acid residues or nucleotides in a sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Methods for performing sequence alignment and determining sequence

identity are known to the skilled artisan, may be performed without undue experimentation, and calculations of identity values may be obtained with definiteness. See, for example, Ausubel et al., eds. (1995) Current Protocols in Molecular Biology, Chapter 19 (Greene Publishing and Wiley-Interscience, New York); and the ALIGN program (Dayhoff (1978) in Atlas of Protein Sequence and Structure 5:Suppl. 3 (National Biomedical Research Foundation, Washington, D. C). A number of algorithms are available for aligning sequences and determining sequence identity and include, for example, the homology alignment algorithm of Needleman et al. (1970) J. MoI. Biol. 48:443; the local homology algorithm of Smith et al. (1981) Adv. Appl. Math. 2:482; the search for similarity method of Pearson et al. (1988) Proc. Natl. Acad. Sci. 85:2444; the Smith- Waterman algorithm (Meth. MoI. Biol. 70:173-187 (1997); and BLASTP, BLASTN, and BLASTX algorithms (see, Altschul et al. (1990) J. MoI. Biol. 215:403-410). Computerized programs using these algorithms are also available, and include, but are not limited to: ALIGN or Megalign (DNASTAR) software, or WU-BLAST-2 (Altschul et al., Meth. Enzym., 266:460- 480 (1996)); or GAP, BESTFIT, BLAST Altschul et al., supra, FASTA, and TFASTA, available in the Genetics Computing Group (GCG) package, Version 8, Madison, Wis., USA; and

CLUSTAL in the PC/Gene program by Intelligenetics, Mountain View, Calif. Those skilled in the art can determine appropriate parameters for measuring alignment, including algorithms needed to achieve maximal alignment over the length of the sequences being compared. Preferably, the sequence identity is determined using the default parameters determined by the program. Specifically, sequence identity can be determined by the Smith- Waterman homology search algorithm (Meth. MoI. Biol. 70:173-187 (1997)) as implemented in MSPRCH program (Oxford Molecular) using an affine gap search with the following search parameters: gap open penalty of 12, and gap extension penalty of 1. Preferably, paired amino acid comparisons can be carried out using the GAP program of the GCG sequence analysis software package of Genetics Computer Group, Inc., Madison, Wis., employing the blosum62 amino acid substitution matrix, with a gap weight of 12 and a length weight of 2. With respect to optimal alignment of two amino acid sequences, the contiguous segment of the variant amino acid sequence may have additional amino acid residues or deleted amino acid residues with respect to the reference amino acid sequence. The contiguous segment used for comparison to the reference amino acid sequence will include at least 20 contiguous amino acid residues, and may be 30, 40, 50, or more amino acid residues. Corrections for increased sequence identity associated with inclusion of gaps in the derivative's amino acid sequence can be made by assigning gap penalties.

[37] As used herein, "expression vector" means a DNA construct including a DNA sequence which is operably linked to a suitable control sequence capable of affecting the replication or expression of the DNA in a suitable host. Such control sequences may include origins of replication or a promoter to affect transcription, an optional operator sequence to control transcription, a sequence encoding suitable ribosome-binding sites on the mRNA, and sequences which control termination of transcription and translation. Different cell types are preferably used with different expression vectors. For example, a preferred promoter for vectors used in Bacillus subtilis is the AprE promoter; a preferred promoter used in E. coli is the Lac promoter, a preferred promoter used in Saccharomyces cerevisiae is PGKl, a preferred promoter used in Aspergillus niger is glaA, and preferred promoters for Trichoderma reesei are reesei cbhl, cbh2, egl, eg2, eg3, eg5, xlnl and xln2 promoters. The vector may be a plasmid, a phage particle, or simply a potential genomic insert. Once transformed into a suitable host, the vector may replicate and function independently of the host genome, or may, under suitable conditions, integrate into the genome itself. In the present specification, plasmid and vector are sometimes used interchangeably. However, the invention is intended to include other forms of expression vectors which serve equivalent functions and which are, or become, known in the art. Thus, a wide variety of host/expression vector combinations may be employed in expressing or replicating the DNA sequences of this invention. Useful expression vectors, for example, may consist of segments of chromosomal, non-chromosomal and synthetic DNA sequences such as various known derivatives of SV40 and known bacterial plasmids, e.g., plasmids from E. coli including col El, pCRl, pBR322, pMb9, pUC 19 and their derivatives, wider host range plasmids, e.g., RP4, phage DNAs e.g., the numerous derivatives of phage .lambda., e.g., NM989, and other DNA phages, e.g., Ml 3 and filamentous single stranded DNA phages, yeast plasmids such as the 2.mu. plasmid or derivatives thereof, vectors useful in eukaryotic cells, such as vectors useful in animal cells and vectors derived from combinations of plasmids and phage DNAs, such as plasmids which have been modified to employ phage DNA or other expression control sequences. Expression techniques using the expression vectors of the present invention are known in the art and are described generally in, for example, Sambrook, et al., MOLECULAR CLONING: A LABORATORY MANUAL, SECOND EDITION, Cold Spring Harbor Press (1989). Often, such expression vectors including the DNA sequences of the invention are transformed into a unicellular host by direct insertion into the genome of a particular species through an integration event (see, e.g., Bennett & Lasure, More Gene Manipulations in Fungi,

Academic Press, San Diego, pp. 70-76 (1991) and articles cited therein describing targeted genomic insertion in fungal hosts).

[38] As used herein, "host strain" or "host cell" means a suitable host for an expression vector including DNA according to the present invention. Host cells useful in the present invention are generally prokaryotic or eukaryotic hosts, including any transformable microorganism in which expression can be achieved. Specifically, host strains may be Bacillus subtilis, Escherichia coli, Trichoderma reesei, Saccharomyces cerevisiae or Aspergillus niger. Host cells are transformed or transfected with vectors constructed using recombinant DNA techniques. [39] As used herein, "functionally attached" or "operably linked" means that a regulatory region, such as a promoter, terminator, secretion signal or enhancer region is attached to or linked to a structural gene and controls the expression of that gene. [40] As used herein, a substance (e.g., a polynucleotide or protein) "derived from" a microorganism means that the substance is native to the microorganism. [41] "Trichoderma" or "Trichoderma sp." refers to any fungal strains which have previously been classified as Trichoderma or which are currently classified as Trichoderma. Preferably the species are Trichoderma longibrachiatum, Trichoderma reesei or Trichoderma viride. [42] The term "equivalent" refers to nucleotide sequences encoding functionally equivalent polypeptides or functionally equivalent polypeptides; Equivalent nucleotide sequences will include sequences that differ by one or more nucleotide substitutions, additions or deletions, such as allelic variants, and include sequences that differ from a native or natural nucleotide due to the degeneracy of the genetic code. The term "equivalent" may also be used for reagents and reactions such as in the phrase "physiological saline or equivalent." [43] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA and immunology, which are within the skill of the art. Such techniques are described in the literature. All publications, patents and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes. See, for example, Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (D. N. Glover ed., 1985); Oligonucleotide Synthesis (M. J. Gait ed., 1984); Mullis et al. U.S. Patent No: 4,683,195; Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A

Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory); Methods In Enzymology, VoIs. 154 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986). Also, information regarding methods of preparation, expression, isolation and use of proteases may be obtained by review of U.S. Pat. No. 6,768,001, which is herein, in its entirety, incorporated by reference. Terms not defined within this document either specifically, by reference or by context are to have definitions common in the art at the time of filing.

[44] As used herein, the term "polymerase chain reaction" ("PCR") refers to the methods of U.S. Patent Nos. 4,683,195, 4,683,202 and 4,965,188, hereby incorporated by reference, which include methods for increasing the concentration of a segment of a target sequence in a mixture of genomic DNA without cloning or purification. This process for amplifying the target sequence consists of introducing a large excess of two oligonucleotide primers to the DNA mixture containing the desired target sequence, followed by a precise sequence of thermal cycling in the presence of a DNA polymerase. [45] The two primers are complementary to their respective strands of the double stranded target sequence. To effect amplification, the mixture is denatured and the primers then annealed to their complementary sequences within the target molecule. Following annealing, the primers are extended with a polymerase so as to form a new pair of complementary strands. The steps of denaturation, primer annealing and polymerase extension can be repeated many times (/. e. , denaturation, annealing and extension constitute one "cycle" ; there can be numerous "cycles") to obtain a high concentration of an amplified segment of the desired target sequence. The length of the amplified segment of the desired target sequence is determined by the relative positions of the primers with respect to each other, and therefore, this length is a controllable parameter. By virtue of the repeating aspect of the process, the method is referred to as the "polymerase chain reaction." Because the desired amplified segments of the target sequence become the predominant sequences (in terms of concentration) in the mixture, they are said to be "PCR amplified."

[46] As used herein, the term "amplification reagents" refers to those reagents (deoxyribonucleotide triphosphates, buffer, etc.), needed for amplification except for primers,

nucleic acid template and the amplification enzyme. Typically, amplification reagents along with other reaction components are placed and contained in a reaction vessel (test tube, microwell, etc.).

[47] With PCR, it is possible to amplify a single copy of a specific target sequence in genomic DNA to a level detectable by several different methodologies {e.g., hybridization with a labeled probe; incorporation of biotinylated primers followed by avidin-enzyme conjugate detection; incorporation of P-labeled deoxynucleotide triphosphates, such as dCTP ordATP, into the amplified segment). In addition to genomic DNA, any oligonucleotide or polynucleotide sequence can be amplified with the appropriate set of primer molecules, hi particular, the amplified segments created by the PCR process itself are, themselves, efficient templates for subsequent PCR amplifications.

[48] As used herein, the terms "PCR product," "PCR fragment" and "amplification product" refer to the resultant mixture of compounds after two or more cycles of the PCR steps of denaturation, annealing and extension are complete. These terms encompass the case where there has been amplification of one or more segments of one or more target sequences.

[49] Assays for assessing Sso, Xyrl, DMPl, and Snf protein activity are well known in the art. See, e.g., U.S. Pat. Nos. 6,342,656 , 6,972,193, U.S. Publication Nos. 20070232520, 20030119002, Rauscher et al, Euk Cell, Vol.5, No.3, pp 447-455 (2006); Gielkens et al, Applied Enviro Micro, Vo. 65, No. 10, pp. 4340-4345 (1999) Kruszewska et al, Applied Enviro Micro, Vo. 65, No. 6, pp. 2382-2387 (1999).

[50] Other features and advantages of the invention will be apparent from the following detailed description, and from the claims.

Detailed Description [51] The invention will now be described in detail by way of reference only using the following definitions and examples. All patents and publications, including all sequences disclosed within such patents and publications, referred to herein are expressly incorporated by reference. [52] Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Singleton, et al, DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 2D ED., John Wiley and Sons, New York (1994), and Hale & Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY (1991) provide one

of skill with a general dictionary of many of the terms used in this invention. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described. Numeric ranges are inclusive of the numbers defining the range. Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively. Practitioners are particularly directed to Sambrook, et al, 1989, and Ausubel, FM, et al, 1993, for definitions and terms of the art. It is to be understood that this invention is not limited to the particular methodology, protocols, and reagents described, as these may vary. [53] Numeric ranges are inclusive of the numbers defining the range.

[54] Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively. [55] The headings provided herein are not limitations of the various aspects or embodiments of the invention which can be had by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification as a whole.

Identification of Genes of Interest (GOI)

[56] One of the objectives of much of genetic research is to identify genes that when overexpressed, result in a phenotype of interest, such as an enhancement of overall gene expression. One way in which the function of individual genes is studied is to use data derived from "Expressed Sequence Tags" (EST) and transcript profiling data. Those genes that appear to have some impact on protein expression, called "genes of interest" (GOI) (see, for example, U.S. Patent No. 7, 029,842 to Duffner, et al, incorporated herein by reference), can then be further tested in large scale experiments to identify those that have the largest impact on overall protein expression. Such techniques are well known in the art.

[57] In the present invention, examination of T. reesei, Expressed Sequence Tag data generated at North Carolina State University (Diener,et al, "Characterization of the protein processing and secretion pathways in a comprehensive set of expressed sequence tags from Trichoderma reesei," FEMS Microbiol Lett. , 230:275-82, 2004; and incorporated herein by reference) generated GOI that had an impact on cellulase protein expression. Thirteen initial GOI were selected which include aepl, cdc42, contig 2035, dpml, mcbl, mssnl, nsfl, sebl, snf4 full, Snf4 short, ssol, trie -5xjl4, and xyrl. Of these initial GOI, five were selected testing

in 14 L fermentors to study the effect of overexpression on total protein production: S sol, Dpml, Xyrl, Snf4 short and Snf4 long (full). The techniques used to measure protein expression were based on the Pierce (Rockford, IL) BCA assay (U.S. Patent No. 4,839,295, incorporated herein by reference) and "mRNA quantification" assay (Stordeur, et al, "Cytokine mRNA quantification by real-time PCR" J Immunol Methods, 259:55-64, 2002, incorporated herein by reference), known to those practiced in the art.

Molecular Biology

[58] The techniques of molecular biology are used in the present invention for the purpose of identifying and isolating genes of T. reesei that have increased effectiveness in the production of protein when overexpressed, relative to the patent strain.

[59] In one embodiment this invention provides for the identification of genes of Trichoderma reesei that confer an increase in protein productivity to T. reesei when one or more of these genes is overexpressed. Therefore, this invention relies on routine techniques in the field of recombinant genetics. Basic texts disclosing the general methods of use in this invention include Sambrook, et al, Molecular Cloning, A Laboratory Manual (2nd ed. 1989); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); and Ausubel, et al, eds., Current Protocols in Molecular Biology (1994). [60] If not otherwise mentioned the PCR-reaction performed according to the invention are performed according to standard protocols known in the art.

[61] The process of amplification as carried out in polymerase chain reaction (PCR) technologies is described in Dieffenbach CW and GS Dveksler (1995, PCR Primer, a Laboratory Manual, Cold Spring Harbor Press, Plainview N.Y.). A nucleic acid sequence of at least about 10 nucleotides and as many as about 60 nucleotides, preferably about 12 to 30 nucleotides, and more preferably about 20-25 nucleotides can be used as a probe or PCR primer.

[62] The term "Isolation of PCR fragment" is intended to cover as broad as simply an aliquot containing the PCR fragment. However preferably the PCR fragment is isolated to an extend which remove surplus of primers, nucleotides templates etc. [63] In one embodiment of the present invention, four genes were cloned using standard molecular cloning techniques. Figure 2 shows an example of the expression vector used. The expression vector used in the present invention was pTrex2g (Clontech, Mountain View, CA; Vazquez MP, Levin MJ, "Functional analysis of the intergenic regions of TcP2 gene loci allowed the construction of an improved Trypanosoma cruzi expression vector" Gene 239:217-

225, 1999; incorporated herein by reference) but one practiced in the art will understand that other vectors and other plasmid origins of replication are known in the art and are also effective for these purposes. Those skilled in the art are also aware that a natural plasmid origin of replication can be modified by replacement, substitution, addition or elimination of one or more nucleotides without changing its function or can be replaced with other effective plasmid origins of replication. The practice of the invention encompasses and is not constrained by such alterations to or replacement of the plasmid origins of replication or by the use of other plasmids, origins of replication or transfection methods known in the art at the time of this invention or by their equivalents. [64] The expression vector/construct typically contains a transcription unit or expression cassette that contains all the additional elements required for the expression of the heterologous sequence. A typical expression cassette thus contains a promoter operably linked to the heterologous nucleic acid sequence and signals required for efficient polyadenylation of the transcript, ribosome binding sites, and translation termination. Additional elements of the cassette may include enhancers and, if genomic DNA is used as the structural gene, introns with functional splice donor and acceptor sites.

[65] The practice of the invention is not constrained by the choice of promoter in the genetic construct. However, exemplary promoters are the Trichoderma reesei cbhl, cbh2, egl, eg2, eg3, eg5, xlnl and xln2 promoters. [66] In addition to a promoter sequence, the expression cassette should also contain a transcription termination region downstream of the structural gene to provide for efficient termination. The termination region may be obtained from the same gene as the promoter sequence or may be obtained from different genes. [67] Although any fungal terminator is likely to be functional in the present invention, preferred terminators include: the terminator from Aspergillus nidulans trpC gene (Yelton, M. et al. (1984) PNAS USA 81:1470-1474, Mullaney, EJ. et al. (1985) MGG 199:37-45), the Aspergillus awamori ox Aspergillus niger glucoamylase genes (Nunberg, J.H. et al. (1984) MoI. Cell Biol. 4:2306, Boel, E. et al.(1984) EMBO J. 3:1581-1585) and the Mucor miehei carboxyl protease gene (EPO Publication No. 0 215 594). [68] The particular expression vector used to transport the genetic information into the cell is not particularly critical. Any of the conventional vectors used for expression in eukaryotic or prokaryotic cells may be used. Standard, suitable expression vectors include any commercially available bacterial expression vector (see, for example, those available from Promega, Madison,

WI), bacteriophages and Ml 3, as well as plasmids such as pBR322 based plasmids, pSKF, pET23D and fusion expression systems such as MBP, GST, and LacZ. Epitope tags can also be added to recombinant proteins to provide convenient methods of isolation, e.g., c-myc. AU of these vectors and methods of use are known to those practiced in the art. [69] The elements that are typically included in expression vectors also include a replicon, a gene encoding antibiotic resistance to permit selection of bacteria that harbor recombinant plasmids, and unique restriction sites in nonessential regions of the plasmid to allow insertion of heterologous sequences. The particular antibiotic resistance gene chosen is not critical; any of the many resistance genes known in the art are suitable. The prokaryotic sequences are preferably chosen such that they do not interfere with the replication or integration of the DNA in Trichoderma reesei.

[70] The methods of transformation of the present invention may result in the stable integration of all or part of the transformation vector into the genome of the filamentous fungus. However, transformation resulting in the maintenance of a self-replicating extra-chromosomal transformation vector is also contemplated.

[71] Many standard transfection methods can be used to produce Trichoderma reesei cell lines that express large quantities of the heterologous protein. Some of the published methods for the introduction of DNA constructs into cellulase-producing strains of Trichoderma include Lorito, Hayes, DiPietro and Harman, 1993, Curr. Genet. 24: 349-356; Goldman, VanMontagu and Herrera-Estrella, 1990, Curr. Genet. 17:169-174; Penttila, Nevalainen, Ratto, Salminen and Knowles, 1987, Gene 6: 155-164, for Aspergillus Yelton, Hamer and Timberlake, 1984, Proc. Natl. Acad. Sci. USA 81 : 1470-1474, for Fusarium Bajar, Podila and Kolattukudy, 1991, Proc. Natl. Acad. Sci. USA 88: 8202-8212, for Streptomyces Hopwood et al., 1985, The John Innes Foundation, Norwich, UK and for Bacillus Brigidi, DeRossi, Bertarini, Riccardi and Matteuzzi, 1990, FEMS Microbiol. Lett. 55: 135-138.

[72] However, any of the well-known procedures for introducing foreign nucleotide sequences into host cells may be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, biolistics (see, for example, the Exemplification section, below), liposomes, microinjection, plasma vectors, viral vectors and any of the other well known methods for introducing cloned genomic DNA, cDNA, synthetic DNA or other foreign genetic material into a host cell (see, e.g., Sambrook et al., supra). Also of use is the Agrobacterium-mediated transfection method described in U.S. Patent No. 6,255,115. It is only

necessary that the particular genetic engineering procedure used be capable of successfully introducing at least one gene into the host cell capable of expressing the heterologous gene. [73] After the expression vector is introduced into the cells, the transfected cells are cultured under conditions favoring expression of genes under control of protease gene promoter sequences. Large batches of transformed cells can be cultured as described in Example 2, infra. Finally, product is recovered from the culture using standard techniques. [74] Preferred culture conditions for a given filamentous fungus may be found in the scientific literature and/or from the source of the fungi such as the American Type Culture Collection (ATCC; "http://www.atcc.org/"). After fungal growth has been established, the cells are exposed to conditions effective to cause or permit the expression of the protein of interest, e.g., cellulases. Generally, cells are cultured in a standard medium containing physiological salts and nutrients, such as described in Pourquie, J. et al., Biochemistry and Genetics of Cellulose Degradation, eds. Aubert, J. P. et al., Academic Press, pp. 71-86, 1988 and Ilmen, M. et al., Appl. Environ. Microbiol. 63:1298-1306, 1997, except that 10OmM piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES; Calbiochem) was included to maintain the pH at 5.5.

[75] Thus, the invention herein provides for the expression and enhanced secretion of desired polypeptides whose expression is under control of gene promoter sequences including naturally occurring protease genes, fusion DNA sequences, and various heterologous constructs. The invention also provides processes for expressing and secreting high levels of such desired polypeptides.

Protein of Interest or Desired Protein

[76] The terms "protein of interest" and "desired protein" and "desired polypeptide" may be used interchangeably herein. The present invention is particularly useful in enhancing the intracellular and/or extracellular production of proteins. The protein may be homologous or heterologous. Proteins that may produced by the instant invention include, but are not limited to, hormones, enzymes, growth factors, cytokines, antibodies and the like. [77] Hormones include, but are not limited to, follicle-stimulating hormone, luteinizing hormone, corticotropin-releasing factor, somatostatin, gonadotropin hormone, vasopressin, oxytocin, erythropoietin, insulin and the like.

[78] Growth factors are proteins that bind to receptors on the cell surface, with the primary result of activating cellular proliferation and/or differentiation. Growth factors include, but are

not limited to, platelet-derived growth factor, epidermal growth factor, nerve growth factor, fibroblast growth factors, insulin-like growth factors, transforming growth factors and the like. [79] Cytokines are a unique family of growth factors. Secreted primarily from leukocytes, cytokines stimulate both the humoral and cellular immune responses, as well as the activation of phagocytic cells. Cytokines include, but are not limited to, colony stimulating factors, the interleukins (IL-I (α and β), IL-2 through IL-13) and the interferons (α, β and γ). [80] Human Interleukin-3 (IL-3) is a 15 kDa protein containing 133 amino acid residues. IL-3 is a species specific colony stimulating factor which stimulates colony formation of megakaryocytes, neutrophils, and macrophages from bone marrow cultures. [81] Antibodies include, but are not limited to, immunoglobulins from any species from which it is desirable to produce large quantities. It is especially preferred that the antibodies are human antibodies. Immunoglobulins may be from any class, i.e., G, A, M, E or D. [82] Additionally, a "protein of interest" or "polypeptide of interest" refers to the protein to be expressed and secreted by the host cell. The protein of interest may be any protein that up until now has been considered for expression in prokaryotes. In one embodiment, the protein of interest which is expressed and secreted include proteins comprising a signal peptide. The protein of interest may be either homologous or heterologous to the host. Thus, a protein of interest may be a secreted polypeptide particularly an enzyme which is selected from amylolytic enzymes, proteolytic enzymes, cellulolytic enzymes, oxido-reductase enzymes and plant wall degrading enzymes. Examples of these enzymes include amylases, proteases, xylanases, lipases, laccases, phenol oxidases, oxidases, cutinases, cellulases, hemicellulases, esterases, perioxidases, catalases, glucose oxidases, phytases, pectinases, glucosidases, isomerases, transferases, galactosidases and chitinases. The secreted polypeptide may also be a hormone, a growth factor, a receptor, vaccine, antibody or the like. In an embodiment the secreted polypeptide is a cellulolytic enzyme.

[83] Also provided herein are compositions comprising a biologically pure culture of Tήchoderma reesei having been transformed with nucleotide sequences. [84] In some embodiments, the compositions comprise a biologically pure culture of Tήchoderma reesei having been transformed with a nucleotide sequence selected from the group consisting of: a) the nucleotide sequence of SEQ ID NO: 1 ; b) the nucleotide sequence of SEQ ID NO: 10; c) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 5; d) a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 1, wherein said nucleotide sequence encodes a polypeptide having Sso activity; e) a nucleotide sequence having

at least 25 consecutive nucleotides of SEQ ID NO: 1; or a complement thereof, f) a nucleotide sequence having at least 25 consecutive nucleotides of SEQ ID NO: 10; or a complement thereof, g) a nucleotide sequence encoding an amino acid sequence of a polypeptide having at least 85% sequence identity to SEQ ID NO: 5, wherein said polypeptide has Sso activity. [85] In some embodiments, the compositions comprise a biologically pure culture of

Trichoderma reesei having been transformed with a nucleotide sequence selected from the group consisting of: a) the nucleotide sequence of SEQ ID NO: 2; b) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 6; d) a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 2, wherein said nucleotide sequence encodes a polypeptide having Xyrl activity; e) a nucleotide sequence having at least 25 consecutive nucleotides of SEQ ID NO: 2; or a complement thereof, g) a nucleotide sequence encoding an amino acid sequence of a polypeptide having at least 85% sequence identity to SEQ ID NO: 6, wherein said polypeptide has Xyr 1 activity. [86] In some embodiments, the compositions comprise a biologically pure culture of Trichoderma reesei having been transformed with a nucleotide sequence selected from the group consisting of: a) the nucleotide sequence of SEQ ID NO: 3; b) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 7; d) a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 3, wherein said nucleotide sequence encodes a polypeptide having Xyrl activity; e) a nucleotide sequence having at least 25 consecutive nucleotides of SEQ ID NO: 3; or a complement thereof, g) a nucleotide sequence encoding an amino acid sequence of a polypeptide having at least 85% sequence identity to SEQ ID NO: 7, wherein said polypeptide has Xyr 1 activity.

[87] In some embodiments, the compositions comprise a biologically pure culture of Trichoderma reesei having been transformed with a nucleotide sequence selected from the group consisting of: a) the nucleotide sequence of SEQ ID NO: 4; b) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 8; c) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 9; d) a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 4, wherein said nucleotide sequence encodes a polypeptide having Snf4 activity; e) a nucleotide sequence having at least 25 consecutive nucleotides of SEQ ID NO: 4; or a complement thereof, f) a nucleotide sequence encoding an amino acid sequence of a polypeptide having at least 85% sequence identity to SEQ ID NO: 8, wherein said polypeptide has Snf4 activity; and g) a nucleotide sequence encoding an amino acid sequence of a polypeptide having at least 85% sequence identity to SEQ ID NO: 9, wherein said polypeptide has Snf4 activity.

[88] Also provided herein are methods for the production of cellulase enzymes. In some embodiments, the method comprises inoculating a suitable sterile growth medium with one or more strains of T. reesei that have been transformed with a nucleotide sequence selected from the group consisting of: a) the nucleotide sequence of SEQ ID NO: 1; b) the nucleotide sequence of SEQ ID NO: 10; c) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 5; d) a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 1, wherein said nucleotide sequence encodes a polypeptide having S so activity; e) a nucleotide sequence having at least 25 consecutive nucleotides of SEQ ID NO: 1; or a complement thereof, f) a nucleotide sequence having at least 25 consecutive nucleotides of SEQ ID NO: 10; or a complement thereof, g) a nucleotide sequence encoding an amino acid sequence of a polypeptide having at least 85% sequence identity to SEQ ID NO: 5, wherein said polypeptide has Sso activity; and incubating the inoculated growth medium under conditions which will permit the growth of said T. reesei strain. [89] In some embodiments, the method comprises inoculating a suitable sterile growth medium with one or more strains of T. reesei that have been transformed with a nucleotide sequence selected from the group consisting of: a) the nucleotide sequence of SEQ ID NO: 2; b) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 6; d) a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 2, wherein said nucleotide sequence encodes a polypeptide having Xyrl activity; e) a nucleotide sequence having at least 25 consecutive nucleotides of SEQ ID NO: 2; or a complement thereof, g) a nucleotide sequence encoding an amino acid sequence of a polypeptide having at least 85% sequence identity to SEQ ID NO: 6, wherein said polypeptide has Xyr 1 activity, and incubating the inoculated growth medium under conditions which will permit the growth of said T. reesei strain. [90] In some embodiments, the method comprises inoculating a suitable sterile growth medium with one or more strains of T. reesei that have been transformed with a nucleotide sequence selected from the group consisting of: a) the nucleotide sequence of SEQ ID NO: 3; b) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 7; d) a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 3, wherein said nucleotide sequence encodes a polypeptide having Xyrl activity; e) a nucleotide sequence having at least 25 consecutive nucleotides of SEQ ID NO: 3; or a complement thereof, g) a nucleotide sequence encoding an amino acid sequence of a polypeptide having at least 85% sequence identity to SEQ ID NO: 7, wherein said polypeptide has Xyr 1 activity, and incubating the inoculated growth medium under conditions which will permit the growth of said T. reesei strain.

[91] In some embodiments, the method comprises inoculating a suitable sterile growth medium with one or more strains of T. reesei that have been transformed with a nucleotide sequence selected from the group consisting of: a) the nucleotide sequence of SEQ ID NO: 4; b) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 8; c) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 9; d) a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 4, wherein said nucleotide sequence encodes a polypeptide having Snf4 activity; e) a nucleotide sequence having at least 25 consecutive nucleotides of SEQ ID NO: 4; or a complement thereof, f) a nucleotide sequence encoding an amino acid sequence of a polypeptide having at least 85% sequence identity to SEQ ID NO: 8, wherein said polypeptide has Snf4 activity; and g) a nucleotide sequence encoding an amino acid sequence of a polypeptide having at least 85% sequence identity to SEQ ID NO: 9, wherein said polypeptide has Snf4 activity, and incubating the inoculated growth medium under conditions which will permit the growth of said T. reesei strain Other Embodiments [92] It will be apparent to those skilled in the art to which this invention pertains that other embodiments of the present invention may be performed based on the teachings contained herein. It is intended that such embodiments are contemplated to be included within the scope of the present invention.

Industrial Applications of the Invention [93] The present invention has many practical applications in industry, as is contemplated herein, this description is intended to be exemplary, and non-inclusive. The T. reesei strains of the present invention are more effective in cellulase production over the parent strain and, as such, are useful in the efficient production of cellulases that are useful in various industries as exemplified below. [94] In several embodiments, cellulase produced by the T. reesei strains of the present invention have contemplated use in ethanol production, baking, fruit juice production, brewing, distilling, wine making, leather, oils and fats, paper and pulp and the animal feed production. [95] In other embodiments, the present invention has contemplated is the active "biological" component of detergents and cleaning products. Here, cellulases are used to break down various stains and other acquired contaminants. Embodiments of the invention include testing the compatibility of enzymes with detergent ingredients by doing stability studies and testing them in a variety of formulations.

[96] In another embodiment, the cellulases produced by the Treesei strains of the present invention have contemplated use in the textile industry, mainly in the finishing of fabrics and garments. Major applications include: Desizing, removal of size, (that is, removal of stiff elements of fiber), from threads in fabrics after weaving. For example, the cellulases produced by the present invention can be used in bio-polishing, a process to reduce or eliminate pilling tendency and to give fabrics a smoother and glossier appearance, and in bio-stoning, a process that can replace traditional pumice stones used in stonewashing of denim to achieve a worn look. [97] In yet another embodiment, the present invention has contemplated enzymatic uses for the liquefaction and saccharification of starch into glucose and isomerisation into fructose. The cellulases produced by the present invention may be used to convert large volumes of corn and other grains into sweeteners, like high fructose corn syrup and maltose syrup.

Exemplification [98] The present invention is described in further detain in the following examples which are not in any way intended to limit the scope of the invention as claimed. The attached Figures are meant to be considered as integral parts of the specification and description of the invention. All references cited are herein specifically incorporated by reference for all that is described therein. The following examples are offered to illustrate, but not to limit the claimed invention. [99] In the experimental disclosure which follows, the following abbreviations apply: eq (equivalents); U (units); M (Molar); μM (micromolar); N (Normal); mol (moles); mmol (millimoles); μmol (micromoles); nmol (nanomoles); g (grams); mg (milligrams); kg (kilograms); μg (micrograms); L (liters); ml (milliliters); μl (microliters); cm (centimeters); mm (millimeters); μm (micrometers); nm (nanometers); ⁰ C (degrees Centigrade); h (hours); min (minutes); sec (seconds); msec (milliseconds).

Example 1

Transcript Profiling Data

[100] This Example explains how transcript profiling data was used to identify the genes of interest (GOI). This procedure allowed the identification of genes that, when overexpressed in T. reesei, resulted in enhanced production of total protein. Methods for identifying "genes of interest" are known to those practiced in the art as is evident by publications in the literature and patent database. See, for example, Weld, et al, "Approaches to Functional Genomics in

Filamentous Fungi," Cell Research, 16:31-44, 2006 and U.S. Patent No. 7,029,842 to Duffner, et al, both of which are incorporated herein by reference.

[101] Transcript profiling is a technique in which thousands of different DNA probes are arranged in microarrays, with each DNA representing a different gene or part of a gene (see, for example, Foreman, et al, "Transcriptional Regulation of Biomass-degrading Enzymes in the Filamentous Fungus Trichoderma reesei" J. Biol. Chem., 278:31988-31997, 2003; Shimkets, et al, "Gene expression analysis by transcript profiling coupled to a gene database query" Nat. Biotech. 17:798-803, 1999; both incorporated herein by reference). Among other things, the microarrays can be used to characterize the transcriptome of a cell. That is, transcript profiling allows for the simultaneously quantification of all, or a large proportion of the different mRNA species present in the cell at a certain point in time. A single microarray experiment under a specific condition can provide extensive information on the expression of several genes at once. The data used in this present work was generated at North Carolina State University (Diener,et al, "Characterization of the protein processing and secretion pathways in a comprehensive set of expressed sequence tags from Trichoderma reesei " FEMS Microbiol Lett. , 230:275-82, 2004; and incorporated herein by reference).

Example 2 Strain Construction [102] The four GOI identified by transcript profiling were isolated from the T. reesei genomic DNA using a PCR reaction and primers specific for each of the four genes. The PCR reaction consisted of the following conditions:

PCR reaction: 5 ul 1OX buffer

2 ul of 1O mM dNTPs

3 ul DMSO

1 ul Herculase 1 ul forward primer 1 ul reverse primer

1 ul genomic DNA (approx. 100 ng) 36 ul MiIIiQ H ₂ O

Cycles:

1) 94 C - 60 sec

T) 94 C - 30 sec 3) 58 C - 30 sec

4) 72 C - 45 sec

5) 72 C - 5 min

6) 4 C - indefinite

Typical conditions are used for PCR, for example, steps 2, 3 and 4 repeated 29 times; steps 1 , 5 and 6 are done once.

[103] The Ssol ORF was amplified from T. reesei genomic DNA obtained from wildtype strain, QM6A, using the FastDNA kit from Q-BIOgene. The primers used in the PCR reaction were forward primer: 5'- CACCATGTCGAGCGGGCAGAATC [SEQ ID NO: 10] and the reverse primer: 5'- CTAGTTCTTGTTTGTCAAAGCC [SEQ ID NO: 11]. The PCR product was amplified using Herculase polymerase (Stratagene, La Jolla, CA).

[104] The Dpml ORF was amplified from S. cerevisiae genomic DNA, obtained from wildtype strain ATCC 4126, using the FastDNA kit from Q-BIOgene. The primers used in the PCR reaction were forward primer: 5'- CACCTACACGCACCCACAATGAGC [SEQ ID NO: 12] and the reverse primer: 5'- CGTTACCATTCACTTCCTT [SEQ ID NO: 13]. The PCR product was amplified using Herculase polymerase (Stratagene).

[105] The Xyrl ORF was amplified from T. reesei genomic DNA obtained from wildtype strain, QM6A, using the FastDNA kit from Q-BIOgene. The primers used in the PCR reaction were forward primer: 5' CACCATGTTGTCCAATCCTCTCC [SEQ ID NO: 14] and the reverse primer: 5'- TTAGAGGGCCAGACCGGTTC [SEQ ID NO: 15]. The PCR product was amplified using Herculase polymerase (Stratagene).

[106] The Snf4, short ORF was amplified from T. reesei genomic DNA obtained from wildtype strain, QM6A, using the FastDNA kit from Q-BIOgene. The primers used in the PCR reaction were forward primer: 5'- CACCATGGCCGATGCGCCGCCAGA [SEQ ID NO: 16] and the reverse primer: 5'- TTACGCGGC ATCGTCCTCTTC [SEQ ID NO: 17]. The PCR product was amplified using Herculase polymerase (Stratagene).

[107] The PCR products of the above mentioned genes were purified using Qiagen PCR Purification Kit. The purified products were then cloned into TOPO pENTRY (Invitrogen) vectors and transformed into TOPlO E. coli cells (Invitrogen, Carlsbad, CA). Mini preps of the transformants were carried out using Qiagen (Valencia, CA) Spin Mini Prep Kit. The TOPO pENTRY clones containing insert DNA were sequenced with M13F and M13R primers. The

clones contained the correct sequence were recombined with either Gateway Destination vector pTrex2g (see, for example, Figure 2) using the LR clonase kit (Invitrogen, Carlsbad, CA).

Example 3 Fungal Transformation Procedures

[108] The final pExpression constructs of pTrex3g with the corresponding genes resulting from the PCR reactions described in Example 2 were transformed into spores of pyr- strain of T. reesei. DNA-coated tungsten particles were prepared for use in a biolistic transformation procedure as follows.

T. reesei Biolistic Transformation

[109] Coating DNA onto particles for T. reesei biolistic transformation: 60 mg MlO tungsten particles were added to 1 ml ethanol (70% or 100%) in a microcentrifuge tube. It should be noted that a Tekmar "Treff" low DNA binding tube may also be used. This mixture was allowed to soak for 15 minutes, followed by centrifugation for 15' at 15,000 rpm. The supernatant was then decanted and the pellet washed three times with sterile dH2O. The majority of the dH2O was removed after the final wash. The pellet was then resuspended in ImI of a 50% glycerol

(v/v, sterile) solution. This may be stored for 1-2 weeks at room temperature. Longer storage may lead to oxidation of the particle surface. [110] To a microcentrifuge tube, a 25 ul aliquot of this particle suspension was added (the process of removing the 25 ul aliquots should be performed while continuously vortexing the mixture in order to maintain the suspension).

[Ill] To this mixture, the following components were added (while continuously vortexing) in the following order:

Step 1: Add 0.5-5 ul of the DNA stock solution (lug/ul) Step 2: Add 25 ul 2.5M CaC12 Step 3: Add 10 ul 0.1 M spermidine The DNA stock solution mentioned above should be purified using a standard purification method such as Qiagen column purification.

[112] The mixture was allowed to react and coat the particles for 5-15 minutes during continuous vortexing, and was used as soon as possible to avoid tungsten degradation of the DNA. The mixture was then pulse centrifuged for approximately three seconds (harder pelleting then needed will lead to agglomeration of particles). The supernatant was then removed and the

pellet was washed with approx 200 ul of 70% ethanol (v/v) followed by a pulse centrifugation and removal of the supernatant. The pellet was again washed with 200 ul of 100% ethanol, followed by another pulse centrifugation. The supernatant was removed and the pellet was then resuspended in 24 μl 100% ethanol and mixed by pipetting a couple of times. The microcentrifuge tube was then dipped into an ultrasonic cleaner, for approximately 15 seconds. While tube was in the ultrasonic cleaner, remove 8 ul aliquots onto macrocarrier disks by placing the aliquots in the exact center of the disks while the disks are in the desiccator. Immediately after placing the aliquot onto the disk in the desiccator, the disks were kept in the desiccator until thoroughly dry and kept there until immediately before use. Exposure to humidity after drying may dramatically reduce the transformation rate.

Transformation Procedure:

Transformation Mixture

Sterile dH2O 100% ethanol 70% ethanol 50% glycerol (v/v)

2.5 M CaCl ₂ (can store aliquots at 4 ⁰ C) (3.675 g CaCl ₂ 2H ₂ O, bring volume to 10 ml) 0.1 M spermidine (free base) (14.5 ul in 1 ml dH ₂ 0) This mixture may be aliquoted and stored at -80°C for up to 3 months.

[113] A spore suspension is made up to at least 10 spores/ml, ideally 5x10 spores/ml [114] The spore suspensions were aliquoted to the center of the plate (e.g., 6 cm in diameter) to be transformed in 100-200 μl aliquots resulting in approximately 10-50 million spores per plate. The transformation was performed on plates made with Vogels media (however, any suitable other media may be used that permits growth and transformation). After the biolistic transformation, the plates were placed in a 28°C incubator for 5 days. After which, the transformants were transferred onto new Vogels media plates, and placed in the 28°C incubator.

Example 4 Screening T. reesei (GOI) transformants

[115] For the inoculation phase (pre-culture) approximately 6 cm ² of each sporulated culture was transferred to 50 ml minimal media in a 250 ml dented bottom flasks. This was then incubated for 2-3 days at 28°C, 150 rpm. The inoculum grew as mycelia rather than pellets.

[116] For the production phase 2 ml of pre-culture was transferred to 50 ml medium in a 250 ml dented bottom, silicon-coated, flasks. The flasks were then weighed and incubated for 7 days at 28 ⁰ C, 150 rpm. At this point the cultures showed a filamentous growth. [117] Samples and analysis was performed as follows. The flasks were weighed and sterile water was added to the original production phase weight (discussed above). To measure total protein, 2.5 ml of a well-shaken culture is transferred with a wide mouth pipette to 10 ml of 50 mM Sodium Acetate, pH 5.0 in a 15 ml Greiner centrifuge tube and placed at 4 ⁰ C until use. The samples were then centrifuged for 10 minutes at 4700 rpm and 4°C. 100 μl cold supernatant was added to 100 μl ice cold TCA 20% in a 2 ml Eppendorf tube and incubated on ice for at least 30 minutes. This was then centrifuged for 10 minutes at 13,000 rpm, followed by removal of the supernatant. The dry pellet was then dried by draining the tubes upside down for 10-20 minutes. The pellet was then resuspended in 100 μl 0.1N NaOH.

[118] A Pierce BCA assay was carried out by transferring 25 μl of each standard and sample in duplicate into a 96 well multititer plate. 200 μl of Working Reagent (25 ml reagent A + 50 μl reagent B; products of Pierce, Rockford, IL) was then added to each well and the multititer plate was sealed. This is mixed for 30 seconds by using a plate shaker and incubating for 30 minute at 37 ⁰ C. This was then quickly cooled to room temperature. The OD562 (optical density at 562 nm) was measured using a plate reader. Results, shown in Figure 3, demonstrate that the novel strains of the present invention have increased cellulase production over the parent strain. Production increases ranged from 1% to a high of 21%.

[119] To measure RNA, the following procedure was carried out within five minutes of taking the cultures out of the incubator and processing was as quick as possible to avoid RNA degradation. 15 ml of a well-shaken culture was transferred with a wide mouth pipette to a Miracloth™ filter (Calbiochem, San Diego, CA). This was stored at -80°C until processed further.

[120] The mycelia were harvested by pouring the samples one at a time through Miracloth™ funnels and allowing most of the media to run through into collection bottle or into a labeled 50 ml conical tube to save supernatant for protein analysis. [121] The Miracloth™ was then pulled out of funnel and pressure is gently applied to remove remaining liquid. Paper towels were used to draw out excess liquid. At this point, the mycelia were almost completely dry. The Miracloth™ was then opened and the mycelia were broken into smaller chunks that can easily fit into a 2 ml cryo-tubes. Forceps were then used to quickly

remove chunks of mycelia into two labeled cryo-tubes per sample with at least 0.7cm volume of mycelia per tube. The tubes were quickly capped and frozen directly in liquid nitrogen. [122] To measure percent packed cell volume (PCV), 10 ml culture was transferred to a 15 ml conical centrifuge tube and centrifuged for 10 min at 3000 rpm. Estimate PCV and divide this by the liquid volume. The results of the RNA assays are shown in Figures 4(a-d).

[123] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.