This application claims benefit of U. S. Provisional Patent Application Serial No. 60/056,754, filed August 20,1997, which is hereby incorporated by reference.

FIELD OF THE INVENTION The present invention relates to a functional bacterial/mammalian cytochrome P450 chimera.

BACKGROUND OF THE INVENTION Cytochrome P450 ("P450") is a term used for a widely distributed group of unique heme proteins which form carbon monoxide complexes with a major absorption band at wavelengths around 450 nm. These proteins are enzymes which carry out oxidations involved in biosynthesis and catabolism of specific cell or body components, and in the metabolism of foreign substances entering organisms.

Oxygenating enzymes such as P450 appear to be fundamental cellular constituents in most forms of aerobic organisms. The activation of molecular oxygen and incorporation of one of its atoms into organic compounds by these enzymes are reactions of vital importance not only for biosynthesis, but also for metabolic activation or inactivation of foreign agents such as drugs, food preservatives and additives, insecticides, carcinogens and environmental pollutants.

In eukaryotic systems P450, and P450 dependent enzymes are known to act on such xenobiotics and pharmaceuticals as phenobarbitol, antipyrine, haloperidol and prednisone. Known substrates of environmental importance include compounds such as DDT, and a variety of polychlorinated biphenyls and polyaromatic hydrocarbons, as well as other halogenated compounds, including halobenzenes and chloroform.

Hexamethylphosphoramide ("HMPA") is a compound that was used heavily by industry in the mid-1970's in the production of aramid fibers and as a general solvent. HMPA is a known carcinogen and has been found to be one of the contaminants at various industrial and chemical waste sites. Studies focusing on the mammalian biodegradation of HMPA are few but it has been found that microsomal P450 isolated from rat liver and nasal mucosa will demethylate HMPA. (Longo et al., Toxicol. Lett. 44: 289 (1988)).

In microbial systems, cytochrome P450 is known to oxidize many of the same xenobiotic substrates as in eukaryotic systems and thus can be targeted as possible indicators for the presence of toxic compounds in the environment. One of the earliest reports of xenobiotic transformation was by the bacterium Streptomyces giseus which is known to contain the gene for the expression of cytochrome P450.

This transformation involved the convention of mannosidostreptomycin to streptomycin. (Sariaslani et al., Developments in Industrial Microbiology 30: 161 (1989)). Since then, these reactions have been observed with compounds ranging from simple molecules such as benzene to complex alkaloids (such as vindoline and dihydrovindolin, codein, steroids, and xenobiotics such as phenylhydrazine, ajmaline and colchine. (Sariaslani et al., Developments in Industrial Microbiology 30: 161 (1989)).

Genetically engineered microorganisms with the ability to express the P450 gene offer several potential advantages. Such microorganisms might be designed to express precisely engineered enzymatic pathways that can more efficiently or rapidly degrade specific chemicals. Development efforts are aimed largely at chemicals that are toxic or recalcitrant to naturally occurring bacterial degradation.

It has also been shown that enzyme-substrate interactions can be a dominant feature of P450 mediated reactions. (Paulsen et al., Methods in Enzymolosy, 272: 337-46 (1996)). To date no three-dimensional structure of a mammalian P450 enzyme is available despite the use of special expression vectors (Sandhu et al.,"Expression of Modified Cytochrome P450 2C10 (2C9) in Escherichia coli, Purification, and Reconstitution of Catalytic Activity,"Arch. Biochem. Biophys., 306: 443-450 (1993); Haining et al.,"Allelic Variants of Human Cytochrome

P4502C9: Baculovirus-mediated Expression, Purification, Structural Characterization, Substrate Stereoselectivity, and Prochiral Selectivity of the Wild- Type and I359L Mutant Forms,"Arch. Biochem. BiophYs., 333: 447-458 (1996); Waterman, M. S.,"Heterologus Expression of Mammalian P450 Enzymes,"Advances Enzymol., 68: 37-66 (1994)) and peptitergents to improve solubility. (Sueyoshi et al., "Molecular Engineering of Microsomal P4502a-4 to a Stable, Water-Soluble Enzyme,"Arch. Biochem. Biophys., 322: 265-271 (1995)). In contrast, the crystal structures of a number of cytosolic bacterial P450s have been determined. These include P450am, P450bm3, P450terp, and P450eryF. (Poulos et al.,"The 2.6-A Crystal Structure of Psudomonas putida Cytochrome P-450,"J. Biol. Chem., 260: 16122- 16130 (1985); Poulos et al.,"High-Resolution Crystal Structure P450cam,"J. Mol.

Biol., 195: 685-700 (1987); Ravichandran et al.,"Crystal Structure of Hemeprotein Domain of P450BM-3, a Prototype for Microsomal P450's,"Science, 261: 731-736 (1993); Hasemann et al.,"Crystal Structure and Refinement of Cytochrome P450te, at 2.3 A Resolution,"J. Mol. Biol., 1169-1185 (1994); Haseman et al.,"Structure and Function of Cytochrome P450: A Comparative Analysis of Three Crystal Structures," Structure, 3: 41-62 (1995); Cupp-Vickery et al.,"Preliminary Crystallographic Analysis of an Enzyme Involved in Erythromycin Biosynthesis: Cytochrome P450eryF,"Proteins, 20: 197-201 (1994)). Since no detailed structural information has been obtained for a mammalian P450 enzyme, all attempts to determine the effect of enzyme-substrate interactions have used the crystal structures from the soluble bacterial P450 enzymes. (Cupp-Vickery et al.,"Preliminary Crystallographic Analysis of an Enzyme Involved in Erythromycin Biosynthesis: Cytochrome P450eryF,"Proteins, 20: 197-201 (1994); Paulsen et al., Methods in Enzvmolosv.

272: 337-46 (1996)). While homology models can be constructed for the membrane-bound mammalian enzymes based on the bacterial enzymes, the very low sequence identities (<20%) mean that any resulting model is of low resolution. In fact, no information directly shows that mammalian and bacterial enzymes are structurally related.

The present invention is directed to overcoming the deficiencies of the prior art by forming a P450 protein which is soluble and active in aqueous liquid.

SUMMARY OF THE INVENTION The present invention is directed to a chimeric DNA molecule which includes a first DNA molecule encoding a portion of a full length bacterial P450 protein and a second DNA molecule fused to the first DNA molecule and encoding a portion of a full length mammalian P450 protein. The chimeric DNA molecule encodes a fusion protein which is active and soluble in aqueous liquid.

Another aspect of the present invention relates to a fusion protein which includes a portion of a bacterial P450 protein and a portion of a mammalian P450 protein fused to the portion of a bacterial P450 protein. The fusion protein is active and soluble in aqueous liquid.

In addition, the chimeric DNA molecule of the present invention is useful in the bioremediation of an environmental pollutant. The method involves contacting the environmental pollutant with the fusion protein under conditions effective to effect bioremediation.

In addition, the fusion protein is useful in a process of hydroxylating a compound to be oxidized. This involves contacting the compound to be oxidized with the fusion protein under conditions effective to hydroxylate the compound to be oxidized.

This fusion protein has a number of advantages over the native enzymes. For example, since the protein is soluble, it will lend itself to structural elucidation by X-ray crystallography. This is very important in terms of protein design. In addition, a protein is provided, as well as the potential to design a number of proteins, that can be readily expressed in a soil bacteria that will use the bacterial reductases. This has implications for both bioremediation and the biosynthesis of organic compounds. The fusion protein is an important step forward in allowing the use of the less restrictive mammalian active site architecture, which should allow for the design of more diversely functional proteins. Further, since the chimera uses bacterial enzyme that are present in soil bacteria, it can be expressed in this bacterial vector and the bacteria applied to the soil. This obviates the need for coexpression of mammalian reductases while still retaining the prefered active site geometry of the mammalian enzymes.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 A is a model of the chimeric structure of the present invention.

The blue region is from P450eam and the red region is from CYP2C9. The chimera contains 3 substrate recognition sites from P450eam and 3 from CYP2C9. Figure 1B shows the construction of a fused plasmid of P450eam and CYP2C9.

Figure 2A is a CO-reduced differential spectrum of the fusion protein of the present invention. The preparation used corresponds to lane 2 in Figure 2B.

Figure 2B shows an SDS-polyacrylamide gel electrophoresis of the chimera of the present invention expressed in E. coli. Lanes 1 and 2 show the fusion protein and lane 3 and 4 show P450ca.. wild-type. Lane 1,105,000g supernatant zig protein); lane 2, eluate from a hydroxylaapatite column (1.5 pg protein); lane 3,105,000g supernatant (3 g protein); lane 4, eluate from hydroxylapatite column (2.2 pg protein); lane 5, molecular marker. The gel was stained with Coomassie Brilliant Blue R250.

DETAILED DESCRIPTION OF THE INVENTION The present invention is directed to a chimeric DNA molecule which includes a first DNA molecule encoding a portion of a full length bacterial P450 protein and a second DNA molecule fused to the first DNA molecule and encoding a portion of a full length mammalian P450 protein. The chimeric DNA molecule encodes a fusion protein which is active and soluble aqueous liquid. This chimeric DNA molecule can have the nucleotide sequence corresponding to SEQ. ID. No. 1 as follows: atgacgactg aaaccataca aagcaacgcc aatcttgccc ctctgccacc ccatgtgcca 60 gagcacctgg tattcgactt cgacatgtac aatccgtcga atctgtctgc cggcgtgcag 120 gaggcctggg cagttctgca agaatcaaac gtaccggatc tggtgtggac tcgctgcaac 180 ggcggacact ggatcgccac tcgcggccaa ctgatccgtg aggcctatga agattaccgc 240 cacttttcca gcgagtgccc gttcatccct cgtgaagccg gcgaagccta cgacttcatt 300 cccacctcga tggatccgcc cgagcagcgc cagtttcgtg cgctggccaa ccaagtggtt 360 ggcatgccgg tggtggataa gctggagaac cggatccagg agctggcctg ctcgctgatc 420 gagagcctgc gcccgcaagg acagtgcaac ttcaccgagg actacgccga acccttcccg 480

atacgcatct tcatgctgct cgcaggtcta ccggaagaag atatcccgca cttgaaatac 540 ctaacggatc agatgacccg tccggatggc agcatgacct tcgcagaggc caaggaggcg 600 ctctacgact atctgatacc gatcatcgag caacgcaggc agaagccggg aatgaacaac 660 cctcaggact ttattgattg cttcctgatg aaaatggaga aggaaaagca caaccaacca 720 tctgaattta ctattgaaag cttggaaaac actgcagttg acttgtttgg agctgggaca 780 gagacgacaa gcacaaccct gagatatgct ctccttctcc tgctgaagca cccagaggtc 840 acagctaaag tccaggaaga gattgaacgt gtgattggca gaaaccggag cccctgcatg 900 caagacagga gccacatgcc ctacacagat gctgtggtgc acgaggtcca gagatacatt 960 gaccttctcc ccaccagcct gccccatgca gtgacctgtg acattaaatt cagaaactat 1020 ctcattccca agggcacaac catattaatt tccctgactt ctgtgctaca tgacaacaaa 1080 gaatttccca acccagagat gtttgaccct catcactttc tggatgaagg tggcaatttt 1140 aagaaaagta aatacttcat gcctttctca gcaggaaaac ggatttgtgt gggagaagcc 1200 ctggccggca tggagctgtt tttattcctg acctccattt tacagaactt taacctgaaa 1260 tctctggttg acccaaagaa ccttgacacc actccagttg tcaatggatt tgcctctgtg 1320 ccgcccttct accagctgtg cttcattcct gtctga 1356 The chimeric DNA molecule, corresponding to SEQ. ID. No. 1, encodes a fusion protein which includes a portion of a full length bacterial P450 protein and a portion of a full length mammalian P450 protein fused to the portion of the full length bacterial P450 protein. The fusion protein is active, soluble, and can have the amino acid sequence of SEQ. ID. No. 2 as follows: Asn Leu Ala Pro Leu Pro Pro His Val Pro Glu His Leu Val Phe Asp 1 5 10 15 Phe Asp Met Tyr Asn Pro Ser Asn Leu Ser Ala Gly Val Gln Glu Ala 20 25 30 Trp Ala Val Leu Gln Glu Ser Asn Val Pro Asp Leu Val Trp Thr Arg 35 40 45 Cys Asn Gly Gly His Trp Ile Ala Thr Arg Gly Gln Leu Ile Arg Glu 50 55 60 Ala Tyr Glu Asp Tyr Arg His Phe Ser Ser Glu Cys Pro Phe Ile Pro 65 70 75 80 Arg Glu Ala Gly Glu Ala Tyr Asp Phe Ile Pro Thr Ser Met Asp Pro 85 90 95

Pro Glu Gln Arg Gln Phe Arg Ala Leu Ala Asn Gln Val Val Gly Met 100 105 110 Pro Val Val Asp Lys Leu Glu Asn Arg Ile Gln Glu Leu Ala Cys Ser 115 120 125 Leu Ile Glu Ser Leu Arg Pro Gln Gly Gln Cys Asn Phe Thr Glu Asp 130 135 140 Tyr Ala Glu Pro Phe Pro Ile Arg Ile Phe Met Leu Leu Ala Gly Leu 145 150 155 160 Pro Glu Glu Asp Ile Pro His Leu Lys Tyr Leu Thr Asp Gln Met Thr 165 170 175 Arg Pro Asp Gly Ser Met Thr Phe Ala Glu Ala Lys Glu Ala Leu Tyr 180 185 190 Asp Tyr Leu Ile Pro Ile Ile Glu Gln Arg Arg Gln Lys Pro Gly Asn 195 200 205 Asn Pro Gln Asp Phe Ile Asp Cys Phe Leu Met Lys Met Glu Lys Glu 210 215 220 Lys His Asn Gln Pro Ser Glu Phe Thr Ile Glu Ser Leu Glu Asn Thr 225 230 235 240 Ala Val Asp Leu Phe Gly Ala Gly Thr Glu Thr Thr Ser Thr Thr Leu 245 250 255 Arg Tyr Ala Leu Leu Leu Leu Leu Lys His Pro Glu Val Thr Ala Lys 260 265 270 Val Gln Glu Glu Ile Glu Arg Val Ile Gly Arg Asn Arg Ser Pro Cys 275 280 285 Met Gln Asp Arg Ser His Met Pro Tyr Thr Asp Ala Val Val His Glu 290 295 300 Val Gln Arg Tyr Ile Asp Leu Leu Pro Thr Ser Leu Pro His Ala Val 305 310 315 320 Thr Cys Asp Ile Lys Phe Arg Asn Tyr Leu Ile Pro Lys Gly Thr Thr 325 330 335 Ile Leu Ile Ser Leu Thr Ser Val Leu His Asp Asn Lys Glu Phe Pro 340 345 350 Asn Pro Glu Met Phe Asp Pro His His Phe Leu Asp Glu Gly Gly Asn 355 360 365 Phe Lys Lys Ser Lys Tyr Phe Met Pro Phe Ser Ala Gly Lys Arg Ile 370 375 380 Cys Val Gly Glu Ala Leu Ala Gly Met Glu Leu Phe Leu Phe Leu Thr 385 390 395 400 Ser Ile Leu Gln Asn Phe Asn Leu Lys Ser Leu Val Asp Pro Lys Asn 405 410 415

Leu Asp Thr Thr Pro Val Val Asn Gly Phe Ala Ser Val Pro Pro Phe 420 425 430 Tyr Gln Leu Cys Phe Ile Pro Val His His His His His His 435 440 445 The chimeric DNA molecule contains 10 to 90 percent, preferably about 50 percent, of the first DNA molecule and 90 to 10 percent, preferably 50 percent of the second DNA molecule. It is particularly desirable for the first and second DNA molecules to be fused together at a location where the encoded fusion protein lacks secondary structure. This is where there are no interactions due to hydrogen bonds (e. g., at random coils) in the components of the fusion protein.

The chimeric DNA molecule is prepared from a DNA molecule encoding a full length mammalian P450 protein where a portion of that DNA molecule encoding a full length mammalian P450 protein is replaced with a DNA molecule encoding a homologous portion of a full length bacterial P450 protein. This involves replacing all amino acids prior to a random coil between G-and H-helices in the full length mammalian P450 protein with a homologous portion of the full length bacterial P450 protein.

The fusion protein of the present invention is characterized by being soluble. Since eucaryotic P450 proteins are membrane bound, they are insoluble. By contrast, bacterial P450 proteins are soluble. Thus, in the fusion protein of the present invention, the bacterial P450 protein portion imparts its characteristic solubility to the mammalian P450 protein portion.

Another characteristic of the fusion protein of the present invention is that it is active. P450 activity can be defined as the oxidation of a substrate. The most important of these reactions is the removal of a hydrogen atom and replacing it with a hydroxyl group. This reaction is illustrated, for example, by the following: RCH3 + P450 o RCH2OH where the protein turns a hydrocarbon into an alcohol. Such a reaction is called a hydroxylation reaction. Such reactions are also illustrated in Poulos,"Modeling of

Mammalian P450s on Basis of X-ray Structure,"Methods in Enzymology, 206: 11-30 (1991), which is hereby incorporated by reference.

Suitable mammalian P450 proteins include 1A, 2B, 2C, 2D, and 3A families of cytochrome P450 and CYP2C9. CYP2C9, which is particularly preferred, has an amino acid sequence of SEQ. ID. No. 3 as follows: Met Asp Ser Leu Val Val Leu Val Leu Cys Leu Ser Cys Leu Leu Leu 1 5 10 15 Leu Ser Leu Trp Arg Gln Ser Ser Gly Arg Gly Lys Leu Pro Pro Gly 20 25 30 Pro Thr Pro Leu Pro Val Ile Gly Asn Ile Leu Gln Ile Gly Ile Lys 35 40 45 Asp Ile Ser Lys Ser Leu Thr Asn Leu Ser Lys Val Tyr Gly Pro Val 50 55 60 Phe Thr Leu Tyr Phe Gly Leu Lys Pro Ile Val Val Leu His Gly Tyr 65 70 75 80 Glu Ala Val Lys Glu Ala Leu Ile Asp Leu Gly Glu Glu Phe Ser Gly 85 90 95 Arg Gly Ile Phe Pro Leu Ala Glu Arg Ala Asn Arg Gly Phe Gly Ile 100 105 110 Val Phe Ser Asn Gly Lys Lys Trp Lys Glu Ile Arg Arg Phe Ser Leu 115 120 125 Met Thr Leu Arg Asn Phe Gly Met Gly Lys Arg Ser Ile Glu Asp Arg 130 135 140 Val Gln Glu Glu Ala Arg Cys Leu Val Glu Glu Leu Arg Lys Thr Lys 145 150 155 160 Ala Ser Pro Cys Asp Pro Thr Phe Ile Leu Gly Cys Ala Pro Cys Asn 165 170 175 Val Ile Cys Ser Ile Ile Phe His Lys Arg Phe Asp Tyr Lys Asp Gln 180 185 190 Gln Phe Leu Asn Leu Met Glu Lys Leu Asn Glu Asn Ile Lys Ile Leu 195 200 205 Ser Ser Pro Trp Ile Gln Ile Cys Asn Asn Phe Ser Pro Ile Ile Asp 210 215 220 Tyr Phe Pro Gly Thr His Asn Lys Leu Leu Lys Asn Val Ala Phe Met 225 230 235 240 Lys Ser Tyr Ile Leu Glu Lys Val Lys Glu His Gln Glu Ser Met Asp 245 250 255

Met Asn Asn Pro Gln Asp Phe Ile Asp Cys Phe Leu Met Lys Met Glu 260 265 270 Lys Glu Lys His Asn Gln Pro Ser Glu Phe Thr Ile Glu Ser Leu Glu 275 280 285 Asn Thr Ala Val Asp Leu Phe Gly Ala Gly Thr Glu Thr Thr Ser Thr 290 295 300 Thr Leu Arg Tyr Ala Leu Leu Leu Leu Leu Lys His Pro Glu Val Thr 305 310 315 320 Ala Lys Val Gln Glu Glu Ile Glu Arg Val Ile Gly Arg Asn Arg Ser 325 330 335 Pro Cys Met Gln Asp Arg Ser His Met Pro Tyr Thr Asp Ala Val Val 340 345 350 His Glu Val Gln Arg Tyr Ile Asp Leu Leu Pro Thr Ser Leu Pro His 355 360 365 Ala Val Thr Cys Asp Ile Lys Phe Arg Asn Tyr Leu Ile Pro Lys Gly 370 375 380 Thr Thr Ile Leu Ile Ser Leu Thr Ser Val Leu His Asp Asn Lys Glu 385 390 395 400 Phe Pro Asn Pro Glu Met Phe Asp Pro His His Phe Leu Asp Glu Gly 405 410 415 Gly Asn Phe Lys Lys Ser Lys Tyr Phe Met Pro Phe Ser Ala Gly Lys 420 425 430 Arg Ile Cys Val Gly Glu Ala Leu Ala Gly Met Glu Leu Phe Leu Phe 435 440 445 Leu Thr Ser Ile Leu Gln Asn Phe Asn Leu Lys Ser Leu Val Asp Pro 450 455 460 Lys Asn Leu Asp Thr Thr Pro Val Val Asn Gly Phe Ala Ser Val Pro 465 470 475 480 Pro Phe Tyr Gln Leu Cys Phe Ile Pro Val 485 490 The DNA molecule encoding CYP2C9 has the nucleotide sequence of SEQ. ID. No. 4 as follows: gaaggcttca atggattctc ttgtggtcct tgtgctctgt ctctcatgtt tgcttctcct 60 ttcactctgg agacagagct ctgggagagg aaaactccct cctggcccca ctcctctccc 120 agtgattgga aatatcctac agataggtat taaggacatc agcaaatcct taaccaatct 180 ctcaaaggtc tatggccctg tgttcactct gtattttggc ctgaaaccca tagtggtgct 240

gcatggatat gaagcagtga aggaagccct gattgatctt ggagaggagt tttctggaag 300 aggcattttc ccactggctg aaagagctaa cagaggattt ggaattgttt tcagcaatgg 360 aaagaaatgg aaggagatcc ggcgtttctc cctcatgacg ctgcggaatt ttgggatggg 420 gaagaggagc attgaggacc gtgttcaaga ggaagcccgc tgccttgtgg aggagttgag 480 aaaaaccaag gcctcaccct gtgatcccac tttcatcctg ggctgtgctc cctgcaatgt 540 gatctgctcc attattttcc ataaacgttt tgattataaa gatcagcaat ttcttaactt 600 aatggaaaag ttgaatgaaa acatcaagat tttgagcagc ccctggatcc agatctgcaa 660 taatttttct cctatcattg attacttccc gggaactcac aacaaattac ttaaaaacgt 720 tgcttttatg aaaagttata ttttggaaaa agtaaaagaa caccaagaat caatggacat 780 gaacaaccct caggacttta ttgattgctt cctgatgaaa atggagaagg aaaagcacaa 840 ccaaccatct gaatttacta ttgaaagctt ggaaaacact gcagttgact tgtttggagc 900 tgggacagag acgacaagca caaccctgag atatgctctc cttctcctgc tgaagcaccc 960 agaggtcaca gctaaagtcc aggaagagat tgaacgtgtg attggcagaa accggagccc 1020 ctgcatgcaa gacaggagcc acatgcccta cacagatgct gtggtgcacg aggtccagag 1080 atacattgac cttctcccca ccagcctgcc ccatgcagtg acctgtgaca ttaaattcag 1140 aaactatctc attcccaagg gcacaaccat attaatttcc ctgacttctg tgctacatga 1200 caacaaagaa tttcccaacc cagagatgtt tgaccctcat cactttctgg atgaaggtgg 1260 caattttaag aaaagtaaat acttcatgcc tttctcagca ggaaaacgga tttgtgtggg 1320 agaagccctg gccggcatgg agctgttttt attcctgacc tccattttac agaactttaa 1380 cctgaaatct ctggttgacc caaagaacct tgacaccact ccagttgtca atggatttgc 1440 ctctgtgccg cccttctacc agctgtgctt cattcctgtc tgaagaagag cagatggcct 1500 ggctgctgct gtgcagtccc tgcagctctc tttcctctgg ggcattatcc atctttcact 1560 atctgtaatg ccttttctca cctgtcatct cacattttcc cttccctgaa gatctagtga 1620 acattcgacc tccattacgg agagtttcct atgtttcact gtgcaaatat atctgctatt 1680 ctccatactc tgtaacagtt gcattgactg tcacataatg ctcatactta tctaatgttg 1740 agttattaat atgttattat taaatagaga aatatgattt gtgtattata attcaaaggc 1800 atttcttttc tgcatgttct aaataaaaag cattattatt tgctg 1845 Suitable bacterial P450 proteins include P450cam, P450bm3, P450terp and P450eryF. These proteins are described in Poulos et al.,"The 2.6-A Crystal Structure of Psudomonas putida Cytochrome P-450,"J. Biol. Chem., 260: 16122- 16130 (1985); Poulos et al.,"High-Resolution Crystal Structure P450cam,"J. Mol.

Biol., 195: 685-700 (1987) ; Ravichandran et al.,"Crystal Structure of Hemeprotein

Domain of P450BM-3, a Prototype for Microsomal P450's,"Science, 261: 731-736 (1993); Hasemann et al.,"Crystal Structure and Refinement of Cytochrome P450terp at 2.3 A Resolution,"J. Mol. Biol., 1169-1185 (1994); Haseman et al.,"Structure and Function of Cytochrome P450: A Comparative Analysis of Three Crystal Structures," Structure, 3: 41-62 (1995); Cupp-Vickery et al.,"Preliminary Crystallographic Analysis of an Enzyme Involved in Erythromycin Biosynthesis: Cytochrome P450eryF,"Proteins, 20: 197-201 (1994), which are hereby incorporated by reference.

Of these, P450cam is particularly preferred. P450cam has an amino acid sequence of SEQ. ID. No. 5 as follows: Asn Leu Ala Pro Leu Pro Pro His Val Pro Glu His Leu Val Phe Asp 1 5 lu 15 Phe Asp Met Tyr Asn Pro Ser Asn Leu Ser Ala Gly Val Gln Glu Ala 20 25 30 Trp Ala Val Leu Gln Glu Ser Asn Val Pro Asp Leu Val Trp Thr Arg 35 40 45 Cys Asn Gly Gly His Trp Ile Ala Thr Arg Gly Gln Leu Ile Arg Glu 50 55 60 Ala Tyr Glu Asp Tyr Arg His Phe Ser Ser Glu Cys Pro Phe Ile Pro 65 70 75 80 Arg Glu Ala Gly Glu Ala Tyr Asp Phe Ile Pro Thr Ser Met Asp Pro 85 90 95 Pro Glu Gln Arg Gln Phe Arg Ala Leu Ala Asn Gln Val Val Gly Met 100 105 110 Pro Val Val Asp Lys Leu Glu Asn Arg Ile Gln Glu Leu Ala Cys Ser 115 120 125 Leu Ile Glu Ser Leu Arg Pro Gln Gly Gln Cys Asn Phe Thr Glu Asp 130 135 140 Tyr Ala Glu Pro Phe Pro Ile Arg Ile Phe Met Leu Leu Ala Gly Leu 145 150 155 160 Pro Glu Glu Asp Ile Pro His Leu Lys Tyr Leu Thr Asp Gln Met Thr 165 170 175 Arg Pro Asp Gly Ser Met Thr Phe Ala Glu Ala Lys Glu Ala Leu Tyr 180 185 190 Asp Tyr Leu Ile Pro Ile Ile Glu Gln Arg Arg Gln Lys Pro Gly Thr 195 200 205

Asp Ala Ile Ser Ile Val Ala Asn Gly Gln Val Asn Gly Arg Pro Ile 210 215 220 Thr Ser Asp Glu Ala Lys Arg Met Cys Gly Leu Leu Leu Val Gly Gly 225 230 235 240 Leu Asp Thr Val Val Asn Phe Leu Ser Phe Ser Met Glu Phe Leu Ala 245 250 255 Lys Ser Pro Glu His Arg Gln Glu Leu Ile Glu Arg Pro Glu Arg Ile 260 265 270 Pro Ala Ala Cys Glu Glu Leu Leu Arg Arg Phe Ser Leu Val Ala Asp 275 280 285 Gly Arg Ile Leu Thr Ser Asp Tyr Glu Phe His Gly Val Gln Leu Lys 290 295 300 Lys Gly Asp Gln Ile Leu Leu Pro Gln Met Leu Ser Gly Leu Asp Glu 305 310 315 320 Arg Glu Asn Ala Cys Pro Met His Val Asp Phe Ser Arg Gln Lys Val 325 330 335 Ser His Thr Thr Phe Gly His Gly Ser His Leu Cys Leu Gly Gln His 340 345 350 Leu Ala Arg Arg Glu Ile Ile Val Thr Leu Lys Glu Trp Leu Thr Arg 355 360 365 Ile Pro Asp Phe Ser Ile Ala Pro Gly Ala Gln Ile Gln His Lys Ser 370 375 380 Gly Ile Val Ser Gly Val Gln Ala Leu Pro Leu Val Trp Asp Pro Ala 385 390 395 400 Thr Thr Lys Ala Val 405 The DNA molecule encoding P450eam has the nucleotide sequence of SEQ. ID. No. 6 as follows: ctgcaggatc gttatccgct ggccgatctg atcacccagc gtttttccat cgacgaggcc 60 agcaaggcac ttgaactggt caaggcagga gcactgatca aacccgtgat cgactccact 120 ctttagccaa cccgcgttcc aggagaacaa caacaatgac gactgaaacc atacaaagca 180 acgccaatct tgcccctctg ccaccccatg tgccagagca cctggtattc gacttcgaca 240 tgtacaatcc gtcgaatctg tctgccggcg tgcaggaggc ctgggcagtt ctgcaagaat 300 caaacgtacc ggatctggtg tggactcgct gcaacggcgg acactggatc gccactcgcg 360 gccaactgat ccgtgaggcc tatgaagatt accgccactt ttccagcgag tgcccgttca 420 tccctcgtga agccggcgaa gcctacgact tcattcccac ctcgatggat ccgcccgagc 480

agcgccagtt tcgtgcgctg gccaaccaag tggttggcat gccggtggtg gataagctgg 540 agaaccggat ccaggagctg gcctgctcgc tgatcgagag cctgcgcccg caaggacagt 600 gcaacttcac cgaggactac gccgaaccct tcccgatacg catcttcatg ctgctcgcag 660 gtctaccgga agaagatatc ccgcacttga aatacctaac ggatcagatg acccgtccgg 720 atggcagcat gaccttcgca gaggccaagg aggcgctcta cgactatctg ataccgatca 780 tcgagcaacg caggcagaag ccgggaaccg acgctatcag catcgttgcc aacggccagg 840 tcaatgggcg accgatcacc agtgacgaag ccaagaggat gtgtggcctg ttactggtcg 900 gcggcctgga tacggtggtc aatttcctca gcttcagcat ggagttcctg gccaaaagcc 960 cggagcatcg ccaggagctg atcgagcgtc ccgagcgtat tccagccgct tgcgaggaac 1020 tactccggcg cttctcgctg gttgccgatg gccgcatcct cacctccgat tacgagtttc 1080 atggcgtgca actgaagaaa ggtgaccaga tcctgctacc gcagatgctg tctggcctgg 1140 atgagcgcga aaacgcctgc ccgatgcacg tcgacttcag tcgccaaaag gtttcacaca 1200 ccacctttgg ccacggcagc catctgtgcc ttggccagca cctggcccgc cgggaaatca 1260 tcgtcaccct caaggaatgg ctgaccagga ttcctgactt ctccattgcc ccgggtgccc 1320 agattcagca caagagcggc atcgtcagcg gcgtgcaggc actccctctg gtctgggatc 1380 cggcgactac caaagcggta taaacacatg ggagtgcgtg ctaagtgaac gcaaacgaca 1440 acgtggtcat cgtcggtacc ggactggctg gcgttgaggt cgccttcggc ctgcgcgcca 1500 gcggctggga aggcaatatc cggttggtgg gggatgcgac ggtaattccc catcacctac 1560 caccgctatc caaagctt 1578 The protein or polypeptide of the present invention is preferably produced in purified form by conventional techniques. Typically, the protein or polypeptide of the present invention is secreted into the growth medium of recombinant E. coli. To isolate the protein, the E. coli host cell carrying a recombinant plasmid is propagated, homogenized, and the homogenate is centrifuged to remove bacterial debris. The supernatant is then subjected to sequential ammonium sulfate precipitation. The fraction containing the protein of the present invention is subjected to gel filtration in an appropriately sized dextran or polyacrylamide column to separate the proteins. If necessary, the protein fraction may be further purified by HPLC. Alternatively, the protein is purified by metal chelate affinity chromatography (Imai et al.,"Expression and Purification of Functional Human 17a-hydroxylase/17,20-lyase (P450CI7) in Escherichia coli,"Proc.

Natl. Acad. Sci. USA, 268: 19681-19689 (1993); Kempf"Truncated Human P450 2D6: Expression in Excherichia coli, Ni2+-chelate Affinity Purification, and Characterization of Solibility and Aggregation,"Arch. Biochem. Biophys., 321: 277- 288 (1995), which are hereby incorporated by reference).

Mutations or variants of the above fusion protein are encompassed by the present invention.

Variants may be modified by, for example, the deletion or addition of amino acids that have minimal influence on the properties, secondary structure and hydropathic nature of the polypeptide. For example, a polypeptide may be conjugated to a signal (or leader) sequence at the N-terminal end of the protein which co- translationally or post-translationally directs transfer of the protein. The polypeptide may also be conjugated to a linker or other sequence for ease of synthesis, purification, or identification of the polypeptide.

The DNA molecule encoding the cytochrome P450 polypeptide can be incorporated in cells using conventional recombinant DNA technology. Generally, this involves inserting the DNA molecule into an expression system to which the DNA molecule is heterologous (i. e. not normally present). The heterologous DNA molecule is inserted into the expression system or vector in proper sense orientation and correct reading frame. The vector contains the necessary elements for the transcription and translation of the inserted protein-coding sequences.

U. S. Patent No. 4,237,224 to Cohen and Boyer, which is hereby incorporated by reference, describes the production of expression systems in the form of recombinant plasmids using restriction enzyme cleavage and ligation with DNA ligase. These recombinant plasmids are then introduced by means of transformation and replicated in unicellular cultures including procaryotic organisms and eucaryotic cells grown in tissue culture.

Recombinant genes may also be introduced into viruses, such as vaccina virus. Recombinant viruses can be generated by transfection of plasmids into cells infected with virus.

Suitable vectors include, but are not limited to, the following viral vectors such as lambda vector system gtl 1, gt WES. tB, Charon 4, and plasmid vectors such as pBR322, pBR325, pACYC177, pACYC184, pUC8, pUC9, pUC18, pUC19,

pLG339, pR290, pKC37, pKC101, SV 40, pBluescript II SK +/-or KS +/- (see "Stratagene Cloning Systems"Catalog (1993) from Stratagene, La Jolla, Calif, which is hereby incorporated by reference), pQE, pIH821, pGEX, pET series (see F. W.

Studier et. al., "Use of T7 RNA Polymerase to Direct Expression of Cloned Genes," Gene Expression Technology Vol. 185 (1990), which is hereby incorporated by reference), and any derivatives thereof. Recombinant molecules can be introduced into cells via transformation, particularly transduction, conjugation, mobilization, or electroporation. The DNA sequences are cloned into the vector using standard cloning procedures in the art, as described by Maniatis et al., Molecular Cloning: A Laboratorv Manual, Cold Springs Laboratory, Cold Springs Harbor, New York (1982), which is hereby incorporated by reference.

A variety of host-vector systems may be utilized to express the protein- encoding sequence (s). Primarily, the vector system must be compatible with the host cell used. Host-vector systems include but are not limited to the following: bacteria transformed with bacteriophage DNA, plasmid DNA, or cosmid DNA; microorganisms such as yeast containing yeast vectors; mammalian cell systems infected with virus (e. g., vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e. g., baculovirus); and plant cells infected by bacteria. The expression elements of these vectors vary in their strength and specificities. Depending upon the host-vector system utilized, any one of a number of suitable transcription and translation elements can be used.

Different genetic signals and processing events control many levels of gene expression (e. g., DNA transcription and messenger RNA ("mRNA") translation).

Transcription of DNA is dependent upon the presence of a promotor which is a DNA sequence that directs the binding of RNA polymerase and thereby promotes mRNA synthesis. The DNA sequences of eucaryotic promotors differ from those of procaryotic promotors. Furthermore, eucaryotic promotors and accompanying genetic signals may not be recognized in or may not function in a procaryotic system, and, further, procaryotic promotors are not recognized and do not function in eucaryotic cells.

Similarly, translation of mRNA in procaryotes depends upon the presence of the proper procaryotic signals which differ from those of eucaryotes.

Efficient translation of mRNA in procaryotes requires a ribosome binding site called the Shine-Dalgarno ("SD") sequence on the mRNA. This sequence is a short nucleotide sequence of mRNA that is located before the start codon, usually AUG, which encodes the amino-terminal methionine of the protein. The SD sequences are complementary to the 3'-end of the 16S rRNA (ribosomal RNA) and probably promote binding of mRNA to ribosomes by duplexing with the rRNA to allow correct positioning of the ribosome. For a review on maximizing gene expression see Roberts and Lauer, Methods in Enzymology, 68: 473 (1979), which is hereby incorporated by reference.

Promotors vary in their"strength" (i. e. their ability to promote transcription). For the purposes of expressing a cloned gene, it is desirable to use strong promotors in order to obtain a high level of transcription and, hence, expression of the gene. Depending upon the host cell system utilized, any one of a number of suitable promotors may be used. For instance, when cloning in E. coli, its bacteriophages, or plasmids, promotors such as the T7 phage promoter, lac promotor, trp promotor, recA promotor, ribosomal RNA promotor, the PR and PL promotors of coliphage lambda and others, including but not limited, to lacUV5, ompF, bla, Ipp, and the like, may be used to direct high levels of transcription of adjacent DNA segments. Additionally, a hybrid trp-lacUV5 (tac) promotor or other E. coli promotors produced by recombinant DNA or other synthetic DNA techniques may be used to provide for transcription of the inserted gene.

Bacterial host cell strains and expression vectors may be chosen which inhibit the action of the promotor unless specifically induced. In certain operons, the addition of specific inducers is necessary for efficient transcription of the inserted DNA. For example, the lac operon is induced by the addition of lactose or IPTG (isopropylthio-beta-D-galactoside). A variety of other operons, such as trp, pro, etc., are under different controls.

Specific initiation signals are also required for efficient gene transcription and translation in procaryotic cells. These transcription and translation initiation signals may vary in"strength"as measured by the quantity of gene specific

messenger RNA and protein synthesized, respectively. The DNA expression vector, which contains a promotor, may also contain any combination of various"strong" transcription and/or translation initiation signals. For instance, efficient translation in E. coli requires a Shine-Dalgarno ("SD") sequence about 7-9 bases 5'to the initiation codon (ATG) to provide a ribosome binding site. Thus, any SD-ATG combination that can be utilized by host cell ribosomes may be employed. Such combinations include but are not limited to the SD-ATG combination from the cro gene or the N gene of coliphage lambda, or from the E. coli tryptophan E, D, C, B or A genes.

Additionally, any SD-ATG combination produced by recombinant DNA or other techniques involving incorporation of synthetic nucleotides may be used.

Once the isolated DNA molecule encoding cytochrome P450 polypeptide has been cloned into an expression system, it is ready to be incorporated into a host cell. Such incorporation can be carried out by the various forms of transformation noted above, depending upon the vector/host cell system. Suitable host cells include, but are not limited to, bacteria, virus, yeast, mammalian cells, insect, and the like.

DNA molecules and nucleotide sequences which are derived from the disclosed DNA molecules as described above may also be defined as DNA sequences which hybridize under stringent conditions to the DNA sequences disclosed, or fragments thereof.

Suitable DNA molecules are those that hybridize to the chimeric DNA molecule under stringent conditions. An example of suitable high stringency conditions is when hybridization is carried out at 65°C for 20 hours in a medium containing 1M NaCl, 50 mM Tris-HCI, pH 7.4,10 mM EDTA, 0.1% sodium dodecyl sulfate, 0.2% ficoll, 0.2% polyvinylpyrrolidone, 0.2% bovine serum albumin, 50 llm g/ml E. coli DNA.

In preferred embodiments of the present invention, stringent conditions may be defined as those under which DNA molecules with more than 25% sequence variation (also termed"mismatch") will not hybridize. Such conditions are referred to herein as conditions of 75% stringency (since hybridization will occur only between molecules with 75% homology or greater). In a more preferred embodiment, stringent conditions are those under which DNA molecules with more than 15%

mismatch will not hybridize (conditions of 85% stringency), and more preferably still, stringent conditions are those under which DNA sequences with more than 10% mismatch will not hybridize (conditions of 90% stringency). In a most preferred embodiment, stringent conditions are those under which DNA sequences with more than 6% mismatch will not hybridize (conditions of 94% stringency).

In yet another aspect of the present invention, the fusion protein can be applied to an environmental pollutant, such as an insecticide or other halogenated hydrocarbon spills, as part of a method of bioremediation. In fact, P450 enzymes can oxidize almost any compound that has a carbon-hydrogen bond and, thus, are useful for almost any environmental contaminant. Generally, microorganisms are extremely useful as agents for clean-up of environmental problems. Development of suitable microorganisms involves either selecting microorganisms with a bioremediation trait or by introducing a gene into microbes to engender them with that ability. By introducing the chimeric DNA molecule into an appropriate vector, it is possible to achieve bioremediation of environmental pollutants. Suitable vectors are non- pathogenic bacteria.

Another aspect of the present invention is using the fusion protein in a process of hydroxylating a compound to be oxidized. Typical compounds to be oxidized include hydrocarbons or any compound having a carbon-hydrogen bond. As discussed above, this involves contacting the compound to be oxidized with the fusion protein under conditions effective to hydroxylate the compound to be oxidized. The fusion protein can be provided by introducing the chimeric DNA molecule into an appropriate vector to express the fusion protein. Suitable vectors include pcW or pkk233-2.

Typicaly, hydroxylation occurs at from about 30 to about 50°C, with 37°C being preferred, with a potassium phosphate buffer and KCl (pH 7.4). The reaction can be monitored by the addition of dichloromethane and assaying by gas chromatography/mass spectrometry.

EXAMPLES The following examples illustrate, but are not intended to limit, the present invention.

Example 1-Construction of the Expression Plasmid for the Fusion Protein of P450eam and CYP2C9 CYP2C9 clone (pBP2C9) was obtained from the University of Washington, and P450Cam (pBScam) was obtained from the University of Texas Southwestern Medical Center. Subcloning was performed in Epicurian Coli XL1-Blue MR supercompetent cells (Stratagene, LaJolla, CA). All modifications were introduced by PCR mutagenesis. Templates for PCR were pretreated by alkaline-denaturing method and, then, site-directed mutagenesis was performed by ExSiteTMPCR-Based Site-Directed Mutagenesis Kit (Stratagene, LaJolla, CA).

Firstly, the Nco I restriction site was introduced in P450eam by primers 1 and 2 (the amino acids 216-218) and CYP2C9 by primers 3 and 4 (the amino acids 256-258).

The starting position of the H-helix of CYP2C9 is aspartic acid 264. Since the homology model showed a conserved three-dimensional structure from the 1-helix to the carboxy-terminus between P450eam and the CYP2C9 (Korzekwa et al., Pharacogenetics, 3: 1-8 (1993), which is hereby incorporated by reference). The positions of amino acids were selected as a convenient conjunction. After digestion of Xho I (P450Cam) or Eco RI (CYP2C9), each plasmid was blunt-ended and, then, were digested by Nco I. The fragment of P450eam and CYP2C9 was ligated after the digestion by Nco IlXho I or Eco RI. The ligated plasmid contained P450eam, including the pBluescript vector, from the amino-terminus to the G-helix [1-216], and CYP2C9 from the H-helix to carboxy-terminus [Methionine 257 to C-terminus]. In addition, the sequence of junction [Ala-Met-Asp] was returned to the original sequence [Gly-Met-Asn] of P450eam or CYP2C9 by site-directed mutagenesis by primer 5 and 6. A [His] 6 affinity tag coding sequence was inserted at the 3'-terminus of CYP2C9 cDNA by primer 7 and 8. The sequences of the primers are: primer 1 CCATGGACGCTATCAGCATCGTTGCCAAC (SEQ. ID. No. 7) primer 2 CCGGCTTCTGCCTGCGTTGCTCGA (SEQ. ID. No. 8) primer 3 CCATGGACAACCCTCAGGACTTTATTGAT (SEQ. ID. No. 9) primer 4 CCATTGATTCTTGGTGTTCTTTTACT (SEQ. ID. No. 10) primer 5 GCATGAACAACCCTCAGGACTTTATTGA (SEQ. ID. No. 11) primer 6 CCGGCTTCTGCCTGCGTTGCTCG (SEQ. ID. No. 12)

primer 7 CATCACCATCACCATCACTGAAGAAGAGCAGATGGCCTGGC (SEQ. ID. No. 13) primer 8 GACAGGAATGAAGCACAGCTGGTA (SEQ. ID. No. 14) Example 2-Expression of the Fusion Protein A single ampicillin-resistant colony of DH5a cells transformed with plasmid DNA was grown overnight at 37°C in Luria-Bertani medium containing 100 u. g ampicillin ml-'. A 0.5-ml aliquot was used to innoculate 50 ml of Terrific broth ("TB") and cultured for 10 h. This aliquot of 25 ml was used to innoculate 500 ml of TB media. Incubation at 37°C was continued for 19 h. The TB media was supplemented with ampicillin (100 ug ml-'), 0.2% glucose, 100 uM 8-aminolevulinic acid, vitamins (100-lw/w, Basal Medium Eagle Vitamin Solution, Gibco BRL, Grand Island, NY), and trace elements (2 mM MgS04.7H20,0. 1 mM CaCl2,1.0 aM FeS04, metal solution, 50 uM H3BO4,0.2 suM CoCl2.6H20,1 mM CuS04.5H20,1 mM MnC12.4H20,1 nM Na2Mo04 and 2 mM ZnCl2). The cells were harvested by centrifugation at 5,000 g and 4°C for 10 min. The pellet was stored at-80°C before use.

Example 3-Construction of Expression Plasmid for Pd and PdR Nde I restriction site was introduced at the site of the initiation codon of the Pd or PdR plasmids by the procedures similar to those described above. After digestion of Pd by Sma I and digestion of PdR by Mu I followed by blunt-ending, each plasmid was digested by Nde I. Gel purified DNA was cloned into PET-15, an expression vector (Novagene, Madison, WI), after digestion by Xho I and blunt-ending. E. coli strain BL21 (DE3) was transformed with pETPd or pETPdR.

Pd and PdR were expressed as follows. Icoculum cultures (25 ml) of E. coli BL21 (DE3), transformed with pETPd or pETPdR were grown at 37°C in M9 minimum medium supplemented with 100 u. g ampicillin ml'', 0.5% glucose, vitamins, and trace elements as mentioned above. A 25-ml aliquot was used to inoculate 500 ml of M9 minimum medium and the flask was shaken for 1 h at 37°C, at which

time 0.4 mM isopropyl ß-D-thiogalactoside was added to induce the synthesis of T7 RNA polymerase. Incubation at 37°C was continued for 3 h.

Attempts to make a soluble chimeric construct were based on a homology model of CYP2C9. This model was produced with the program Modeller (Sali et al., 234: 779-815 (1993), which is hereby incorporated by reference), and used the coordinates of P450Camf P450BM3 and P450eyF. The resulting homology model indicated that replacing all amino acids prior to the random coil between the G-and H-helix (using P450Cam structural nomenclature) with bacterial amino acids may provide a soluble bacterial/mammalian chimera. This coil was chosen, because it was believed that amino-terminus and possibly the distal face of the protein (comprised of amino acids prior to the coil) were involved in membrane interactions. Furthermore, since the sequence alignments are based on very low sequence identity, it was believed that by choosing an area for fusion with no secondary structure chances of producing a folded protein would increase.

A chimera was based on the homology model to contain P450eam from the amino-terminus to the G-helix [1-216] and CYP2C9 from before the putative H-helix to carboxy-terminus [Methionine 257 to C-terminus] (Figures 1 (A) and (B)).

According to the nomenclature of Gotoh, O. J. Biol Chem., 267: 83-90 (1992), which is hereby incorporated by reference, the active site would be composed of SRS (substrate recognition site) 1-3 from P450ca.. and SRS4-6 from P450 2C9. All modifications were introduced by PCR-mutagenesis (Dorrell et al.,"Improved Efficiency of Inverse PCR Mutagenesis,"BioTechniques, 21: 604-608 (1996), which is hereby incorporated by reference). A [His] 6 affinity tag coding sequence was inserted at the 3'-terminus of P450 2C9 cDNA to allow protein purification by metal chelate affinity chromatograph. (Imai et al.,"Expression and Purification of Functional Human 17a-hydroxylase/17,20-lyase (P450C, 7) in Escherichia coli,"Proc.

Natl. Acad. Sci. USA, 268: 19681-19689 (1993); Kempf"Truncated Human P450 2D6: Expression in Excherichia coli, Ni2+-chelate Affinity Purification, and Characterization of Solibility and Aggregation,"Arch. Biochem. Biophys., 321: 277- 288 (1995), which are hereby incorporated by reference). The protein was expressed in E. coli with the pBluescript vector. This preparation yielded 260 nmol/liter of Terrific broth medium after 29 h of culture at 37°C. (Peterson et al.,"Putidaredoxin

Reductase and Puridaredoxin: Cloning, Sequence, and Heterologous Expression of the Proteins,"J. Biol. Chem., 265: 6066-6073 (1990), which is hereby incorporated by reference). Expression levels of the wild type P450,,,. was 600-1000 nmoles/liter under similar conditions. After treatment with lysozyme and sonication of the cell pellet, the cell lysate was centrifuged at 105,000g and the supernatant was applied to a Ni-NTA agarose and hydroxylapatite columns (Imai et al.,"Expression and Purification of Functional Human 17a-hydroxylase/17,20-lyase (P45017) in Escherichia coli,"Proc. Natl. Acad. Sci. USA, 268: 19681-19689 (1993), which is hereby incorporated by reference). The purified chimera showed a CO-reduced difference spectrum at 448 nm (Fig. 2A) (Omura et al.,"The Carbon Monoxide- Binding Pigment of Liver Microsomes I Evidence for its Hemeprotein Nature,"J.

Biol. Chem., 239: 2370-2378 (1964), which is hereby incorporated by reference), and showed two major bands on SDS-polyacrylamide gel electrophoresis (Fig. 2B) (Laemmli, U. K.,"Cleavage of Structural Protein During the Assembly of the Head of Bacteriophage,"Nature, 227: 680-685 (1970), which is hereby incorporated by reference). Similar bands are observed from purified wild-type P450cam with a [His] 6 tag coding sequence. The lower molecule weight band is presently unidentified. The resulting purified protein showed an approximae molecular weight of 51 kDa as judged by SDS-polyacrylamide gel electrophoresis, consistent with the molecular weight expected for the chimera (Figure 2B).

The resulting pruified protein showed a reduced CO difference spectrum at 450 nm (Figure 2A). These data are consistent with a folded P450 protein having a functional active site. The observation that a functional chimera of P450 2C9 and P450Cam, which have only 15% primary sequence homology, can still bind CO provides strong evidence for a conserved three-dimensional structure between P450eam and CYP2 family. The fact that the resulting enzyme is soluble, while mammalian enzymes with the amino terminus removed are not, indicates that other regions near the amino terminus may also be important for membrane interactions.

(Lemos-Chiarandine et al., J. Cell Biol., 104: 209-219 (1987); Vergeres et al., Biochemistrv, 28: 3650-3655 (1989); Wachenfeldt et al., Arch. Biochem. Biophvs., 339: 107-114 (1997), which are hereby incorporated by reference.)

Since CO binding spectra is only an indirect measure of whether the chimeric protein has folded, circular dichroism studies were performed to explore the secondary structure of the bacterial/mammalian chimera. (Pfeil et al., Biochemistry, 32: 8856-62 (1993), which is hereby incorporated by reference). The spectrum of the chimera showed a typical helix structure (data not shown). The predicted secondary structure based on these studies are presented in Table 1.

Table 1 Fraction Chimera Ratio P450Cam Ratio Helix:0.2 35. 5 28.8 Beta:0.0 5. 4 18.0 Turn:0.2 23. 2 20.8 Random:0.2 35. 8 32.4 1 Total0.7 100. 0 100.0 The predicted amount of a-helix and p-sheet secondary structure were similar between the chimera and P450cam wild type. Thus, the circular dichroism studies confirm that the chimera is folded and has similar secondary structural features as the bacterial P450eam- Next, the ability of the fusion protein to oxidize a common P450 substrate was determined. The bacterial and mammalian enzymes both require an electron tranfer protein to reduce molecular oxygen to an active monooxygen oxidant.

However, the bacterial and mammaliam enzyme use different unrelated electron transfer proteins. To determine if the bacterial electron transfer proteins could function as an electron donor, putidaredoxin and putidaredoxin reductase were purified after subcloning their cDNAs to pET vector the T71ac promoter and [His] 6 taggled sequence. This bacterial electron transfer system could support the oxidation of 4-chlorotoluene to 4-chlorobenzyl alcohol by the fusion protein. The hydroxylation occured at 37°C being preferred. 50 mM potassium phosphate buffer was utilized with 200 MM KCI, (pH 7.4). Each reaction contained 500 uM 4- chlorotoluene, between. 4 and 1 nmole of P450,3 tM putidaredoxin, 1.5 uM

putidaredoxin reductase, and 300 VtM NADH. The reaction was stopped by the addition of 4 ml of dichloromethane and assayed by gas chromatography/mass spectrometry. Experiments to determine if the mammalian P450 reductase can support the same oxidation are underway.

Detection of the catalyic activity toward 4-chlorotoluene indicate that the fusion protein can function as an active P450 enzyme (Table 1). As compared with the turnover number from the wild type P450eam, the chimera shows approximately 3 times the activity towards 4-chlorotoluene. This means a potential for making soluble P450 that can perform stereospecific synthesis.

This approach could have a number of applications. 1) From other homology models of mammalian P450 enzymes it is apparent that this method may prove to be a general method for constructed soluble P450 enzymes with mammalian active site characteristics. These enzymes should be more adaptable to uses in benign synthesis and bioremediation than the more restrictive bacterial enzymes and easier to work with then the membrane bound mammalian enzymes. 2) Selectively replacing amino acid segments in the amino terminus with the mammalian amino acids may prove to be a valuable method of determining important membrane association sites.

3) Since the enzyme is soluble, it could prove a method for obtaining structural information. In particular it should be amiable to Xray crystallography. 4) Since the enzyme is part mammalian and part bacterial, it can be used to determine the features that confer specific interactions with the different reductases system that are used by the bacterial and mammalian proteins.

Although the invention has been described in detail for the purpose of illustration, it is understood that such detail is solely for that purpose, and variations can be made therein by those skilled in the art without departing from the spirit and scope of the invention which is defined by the following claims.