EXPRESSION

RELATED APPLICATIONS

This application claims priority to US provisional application: 61/432,933 filed on

January 14, 201 1, which is herein incorporated by reference in its entirety.

FIELD OF THE INVENTION

The present invention relates to HER3 and HER4 primers, probes and kits for the measurement of mRNA expression levels of the HER3/ErbB3 and HER4/ErbB4 gene, as well as HER1 and HER2. The invention also provides prognostic methods which are useful in medicine, particularly cancer chemotherapy. More particularly, the invention relates to assessment of survivability of a patient whose tumor cell gene expression is analyzed. Additionally, the sensitivity of tumor cells to receptor tyrosine kinase targeted chemotherapeutic regimen is assayed by examining the mRNA expression of the FIERI , HER2, HER3 or HER4 gene, or combinations thereof in humans.

BACKGROUND OF THE INVENTION

Suipassing heart disease in 2004, cancer is now the leading killer in the United States. According to the American Cancer Society, more than 1,500 people die each day from cancer and over 16 million people have been diagnosed with cancer since 1990. In recent years, medical science has taken great strides in understanding and treating cancer. However, prior to 1997, the majority of treatments such as chemotherapy and radiation, were not based on the underlying biology of cancer growth. These treatments are also often associated with serious side effects. Since the discovery of the HER2 gene, researchers from around the world have elucidated that HER2 is a main component of a complex signaling pathway that includes numerous family members, many of which are also involved in the formation of cancer and other diseases.

Signal transduction is a means by which one cell communicates to another. The

"conversation" between two cells involves a molecular messenger (called a ligand) from the sender and a site (called a receptor) on the membrane surface of the cell receiving the signal. When the signal is received, it is passed along within the cell. In this way, the message is communicated from the outer surface of the cell into the cell's nucleus. Messages can be healthy or harmful. For example, some messages might be signals telling the cell to grow (which can lead to cancer) or a growth signal might be used by the immune system to increase the amount of white blood cells needed to fight and infection. In other cases, signals may cause cells to store materials such as fatty acids, which is healthy in moderation but when uncontrolled, may lead to obesity. This process is referred to as signal transduction.

Some of the more common signaling pathways involve proteins called receptor tyrosine kinases, which have three components: 1) an extracellular ligand-binding domain receptor that is located outside the cell and receives incoming signals; 2) a transmembrane domain that crosses the cell membrane and conveys information from the outside to the inside; and 3) an intracellular tyrosine kinase domain that adds a phosphate molecule to tyrosine, a type of protein. This process initiates an internal messaging cascade and is referred to as "phosphorylation."

In oncology, one of the most important tyrosine kinase signaling networks is a group of ^" receptors belonging to the "HER" family, also known as the ErbB signaling network. The ErbB receptors are named after the Avian erythroblastosis tumor virus, which encodes an aberrant form of the human epidermal growth factor receptor (from which "HER" originates).

The HER family of receptors consists of four main members commonly referred to as HER1/EGFR, HER2, HER3 and HER4. Each of these receptors is in some way culpable in the development of malignant tumors, although some are more involved than others. There is a considerable amount of "cross-talk" between the receptors, meaning that activation or inhibition of one can have collateral effects on the others.

In all cells, some level of growth-signal transduction is normal and is part of the regular growth cycle. It is the over- expression, or activation, of these signals— or the failure to counterbalance or block those signals— that leads to uncontrollable growth. In the case of the HER2, for example, over-expression is the result of a genetic alteration that generates multiple copies of a gene that encodes a growth receptor. Because of the surplus of growth receptor genes in the cell, excessive numbers of growth receptors are created that, when activated, enlarge the number growth signals stimulating the cell, accelerating cell division and tumor growth.

The four members of the HER family are called HER1 , HER2, HER3 and HER4. Each is implicated in the development of cancer, although the degree of involvement varies. HER1 is also known as EGFR. Over-expression has been found in head and neck, bladder, and prostate cancers and in renal cancer, non-small-cell lung cancer, ovarian and pancreatic cancers and glioblastoma. HER1 over-expression enhances tumor cell motility, adhesion and metastatic potential, while normal HER1 signaling disrupts cell cycle control (leading to proliferation) and apoptosis (programmed cell death).

HER2 is also known as c-erbB-2 and ErbB2. Co-expression of HER2 with HER1 improves the ability to predict aggressiveness of breast cancer. Over-expression has been found in breast and ovarian cancer. Perhaps the best-known member of the HER family, over- expression of the HER2 gene is coiTelated positively with an especially aggressive form of breast cancer that occurs in approximately 25 percent of all breast tumors. HER2 also is over-expressed in a variety of other solid tumors and may interact with certain steroid hormone networks, suggesting that it could affect patient response to anti-estrogen therapies.

HER3 is also known as ErbB3. Co-expression of HER3 with HER2 improves the ability to predict the aggressiveness of a breast cancer. Expression has been found in breast, colon, gastric, and prostate cancer and other carcinomas. Expression of HER-3, when activated in a conjunction with HER-2, is linked to increased tumor aggressiveness.

HER4 is also known as ErbB4. Co-expression of HER4 with HER2 has been found to have a prognostic value. Expression has been found in breast and prostate cancer and childhood medulloblastoma. Some studies have shown a lower expression of HER-4 in breast and prostate tumors relative to normal tissue.

A physical feature of the HER pathway is that the signaling system always involves two receptors in combination, in a formation called a "dimer." Homodimers are combinations of two similar receptor types, such as HER 1 /HER 1 and HER3/HER3. Heterodimers contain two different receptors, such as HER1/HER2; HER1/HER3; and HER4/HER3. The various hetero- and homo-dimer pairs affect the signal strength within the cell. For example, the co-expression of certain pairs (such as HER3/HER2) is more powerful than others such as the HER3/HER- homodimer, which is inactive. Research is underway to better understand why certain pairings have different effects and how those effects manifest themselves.

Since certain receptors in the pathway work together to produce malignancy, one of the clinical strategies being explored today involves the possibility of combining several targeted HER molecules as well as other targeted therapies into a single treatment regimen - based on the biology of disease - that potentially have a synergistic or additive effect on the tumor.

SUMMARY OF THE INVENTION

Detecting HER3 or HER4 mRNA:

The present invention provides a method for detecting the presence of a HER 3 or HER4 mRNA in a sample, said method comprising: (a) isolating a nucleic acid from said sample wherein the sample comprises mRNA; (b) performing an amplification reaction of said mRNA, wherein said amplification reaction comprises (i) a first HER3 primer capable of annealing specifically to HER3 at a first position in a HER3 mRNA or a first HER4 primer capable of annealing specifically to HER4 at a first position in HER4 mRNA; wherein said first HER3 primer is SEQ ID NO:6 and wherein said first HER4 primer is SEQ ID NO: 9 (or primers 95% identical thereto); (ii) and a second HER3 primer capable of annealing specifically at a second position in a HER3 mRNA or a second HER4 primer capable of annealing specifically at a second position in a HER4 mRNA; wherein said second HER3 primer is SEQ ID NO:7 and wherein said second HER4 primer is SEQ ID NO: 10 (or primers 95% identical thereto); wherein said first and second primers anneal to different positions in the HER3 or HER4 RNA sequence; wherein the amplification reaction is capable of producing a HER3 or HER4 specific

amplification product when the mRNA sequences of the sample comprise a HER3 or HER4 mRNA sequence; and (c) visualizing or detecting amplification products produced by said amplification reaction, wherein detection of a HER3 or HER4 specific amplification product is a positive indicator of a HER3 or HER4 mRNA in said sample.

Detecting HER3 or HER4 DNA:

The invention also provides a method for detecting the presence of a HER 3 or HER4

DNA in a sample, said method comprising: (a) isolating a nucleic acid from said sample wherein the sample comprises DNA; (b) performing an amplification reaction of said DNA, wherein said amplification reaction comprises (i)a first HER3 primer capable of annealing specifically to HER3 at a first position in a HER3 DNA or a first HER4 primer capable of annealing specifically to HER4 at a first position in HER4 DNA; wherein said first HER3 primer is SEQ ID NO:6 and wherein said first HER4 primer is SEQ ID NO: 9 (or primers 95% identical thereto); (ii) and a second HER3 primer capable of annealing specifically at a second position in a HER3 DNA or a second HER4 primer capable of annealing specifically at a second position in a HER4 DNA; wherein said second HER3 primer is SEQ ID NO:7 and wherein said second HER4 primer is SEQ ID NO: 10 (or primers 95% identical thereto), wherein said first and second primers anneal to different positions in the HER3 or HER4 DNA sequence; wherein the amplification reaction is capable of producing a HER3 or HER4 specific amplification product when the DNA sequences of the sample comprise a HER3 or HER4 DNA sequence; and (c) visualizing or detecting amplification products produced by said amplification reaction, wherein detection of a HER3 or HER4 specific amplification product is a positive indicator of a HER3 or HER4 DNA in said sample.

Determining a chemotherapeutic regimen (HER3 compared to internal control gene): The present invention also provides a method for determining a chemotherapeutic regimen for treating a tumor in a patient comprising: (a) obtaining a tissue sample of the tumor and fixing the sample, to obtain a fixed tumor sample; (b) isolating mRNA from the fixed tumor sample; (c) subjecting the mRNA to amplification using a pair of oligonucleotide primers capable of amplifying a region of the HER3 gene, to obtain a HER3 amplified sample; wherein the oligonucleotide primers comprise SEQ ID NO:6 and SEQ ID NO:7 (or primers 95% identical thereto); (d) determining the amount of HER3 mRNA in the amplified sample; (e) comparing the amount of HER3 mRNA from step (d) to an amount of HER3 of an internal control gene; and (f) determining a chemotherapeutic regimen based on the amount of HER3 mRNA in the amplified sample and the threshold level for HER3 gene expression. In certain embodiments the method utilizes a probe comprising SEQ ID NO:8 (or a probe 95% identical thereto) to determine the amount of HER3 mRNA in the sample.

Determining a chemotherapeutic regimen (HER4 compared to internal control gene): The present invention also provides a method for determining a chemotherapeutic regimen for treating a tumor in a patient comprising: (a) obtaining a tissue sample of the tumor and fixing the sample, to obtain a fixed tumor sample; (b) isolating mRNA from the fixed tumor sample; (c) subjecting the mRNA to amplification using a pair of oligonucleotide primers capable of amplifying a region of the HER4 gene, to obtain a HER4 amplified sample, wherein the oligonucleotide primers comprise SEQ ID NO:9 and SEQ ID NO: 10 (or primers 95% identical thereto); (d) determining the amount of HER4 mRNA in the amplified sample; (e) comparing the amount of HER4 mRNA from step (d) to an amount of HER4 of an internal control gene; and (f) determining a chemotherapeutic regimen based on the amount of HER4 mRNA in the amplified sample and the threshold level for HER4 gene expression. In certain embodiments the method utilizes a probe comprising SEQ ID NO: 11 (or a probe 95% identical thereto) to determine the amount of HER4 mRNA in the sample.

Determining a chemotherapeutic regimen (HER3 malignant versus non-malignant):

The invention also provides a method for determining a chemotherapeutic regimen comprising a receptor tyrosine kinase targeted agent, for treating a tumor in a patient comprising: (a) obtaining a tissue sample of the tumor; (b) obtaining a matching non-malignant tissue sample; (c) isolating mRNA from the tumor sample and non-malignant sample; (d) subjecting the mRNA to amplification using a pair of oligonucleotide primers capable of amplifying a region of the HER3 gene, to obtain a HER3 tumor amplified sample and a HER3 non-malignant amplified sample, wherein the oligonucleotide primers comprise SEQ ID NO:6 and SEQ ID NO:7 (or primers 95% identical thereto); (e) determining an amount of HER3 mRNA in the HER3 tumor amplified sample and HER3 non-malignant amplified sample using a probe comprising SEQ ID NO:8 (or a probe 95% identical thereto); (f) obtaining a differential HER3 expression level; and (g) determining a chemotherapeutic regimen comprising a receptor tyrosine kinase targeted agent by comparing the differential HER3 expression level of step (f) and a threshold level for differential HER3 gene expression.

Determining a chemotherapeutic regimen (HER4 malignant versus non-malignant):

The invention also provides a method for determining a chemotherapeutic regimen comprising a receptor tyrosine kinase targeted agent, for treating a tumor in a patient comprising: (a) obtaining a tissue sample of the tumor; (b) obtaining a matching non-malignant tissue sample; (c) isolating mRNA from the tumor sample and non-malignant sample; (d) subjecting the mRNA to amplification using a pair of oligonucleotide primers capable of amplifying a region of the HER4 gene, to obtain a HER4 tumor amplified sample and a HER4 non-malignant amplified sample, wherein the oligonucleotide primers comprise SEQ ID NO:9 and SEQ ID NO: 10 (or primers 95% identical thereto); (e) determining an amount of HER4 mRNA in the HER4 tumor amplified sample and HER4 non-malignant amplified sample using a probe comprising SEQ ID NO:l 1 (or a probe 95%) identical thereto); (f) obtaining a differential HER4 expression level; and (g) determining a chemotherapeutic regimen comprising a receptor tyrosine kinase targeted agent by comparing the differential HER4 expression level of step (f) and a threshold level for differential HER4 gene expression.

Determining a chemotherapeutic regimen

(HER2 malignant versus non-malignant compared to HER3 malignant versus non-malignant):

The invention further provides a method for determining a chemotherapeutic regimen comprising a receptor tyrosine kinase targeted agent for treating a tumor in a patient comprising: (a) obtaining a tissue sample of the tumor; (b) obtaining a matching non-malignant tissue sample; (c) isolating mRNA from the tumor sample and non-malignant sample; (d) subjecting the mRNA to amplification using a pair of oligonucleotide primers capable of amplifying a region of the HER2 gene, wherein the primers comprise SEQ ID NO: 4 and SEQ ID NO:5 (or primers 95% identical thereto); and a pair of oligonucleotide primers capable of amplifying a region of the HER3 gene, wherein the primers comprise SEQ ID NO: 6 and SEQ ID NO:7 (or primers 95%o identical thereto) to obtain an HER2 tumor amplified sample and a HER2 non-malignant amplified sample, and a HER3 tumor amplified sample and a HER3 ^' non-malignant amplified sample; (e) detennining the amount of HER2 mRNA in the HER2 tumor amplified sample and HER2 non-malignant amplified sample and detennining the amount of HER3 mRNA in the HER3 tumor amplified sample and HER3 non-malignant amplified sample using a probe comprising SEQ ID NO: 8 (or a probe 95%o identical thereto); (f) obtaining a differential HER2 expression level and obtaining a differential HER3 expression level; and (g) determining a chemotherapeutic regimen comprising a receptor tyrosine kinase targeted agent by comparing the differential HER2 expression level of step (f) and a threshold level for differential HER2 gene expression, and comparing the differential HER3 expression level of step (f) and a threshold level for differential HER3 gene expression. Determining a chemotherapeutic regimen

(HER2 malignant versus non-malignant compared to HER4 malignant versus non-malignant):

The invention also provides a method for determining a chemotherapeutic regimen comprising a receptor tyrosine kinase targeted agent for treating a tumor in a patient comprising: (a) obtaining a tissue sample of the tumor; (b) obtaining a matching non-malignant tissue sample; (c) isolating mRNA from the tumor sample and non-malignant sample; (d) subjecting the mRNA to amplification using a pair of oligonucleotide primers capable of amplifying a region of the HER2 gene, wherein the primers comprise SEQ ID NO: 4 and SEQ ID NO:5 (or primers 95% identical thereto); and a pair of oligonucleotide primers capable of amplifying a region of the HER4 gene, wherein the primers comprise SEQ ID NO: 9 and SEQ ID NO: 10 (or primers 95% identical thereto) to obtain an HER2 tumor amplified sample and a HER2 non-malignant amplified sample, and a HER4 tumor amplified sample and a HER4 non-malignant amplified sample; (e) determining the amount of HER2 mRNA in the HER2 tumor amplified sample and HER2 non-malignant amplified sample and determining the amount of HER4 mRNA in the HER4 tumor amplified sample and HER4 non-malignant amplified sample using a probe comprising SEQ ID NO:l 1 (or a probe 95% identical thereto); (f) obtaining a differential HER2 expression level and obtaining a differential HER4 expression level; and (g) determining a chemotherapeutic regimen comprising a receptor tyrosine kinase targeted agent by comparing the differential HER2 expression level of step (f) and a threshold level for differential HER2 gene expression, and comparing the differential HER4 expression level of step (f) and a threshold level for differential HER4 gene expression.

Kits

The invention also provides a kit for detecting expression of a HER3 gene comprising oligonucleotide pairs SEQ ID NO:6 and SEQ ID NO:7, or pair of oligonucleotide primers at least 95% identical thereto. The kit may further comprising a probe comprising SEQ ID NO: 8 or a probe at least 95% identical thereto.

The invention also provides a kit for detecting expression of a HER4 gene comprising oligonucleotide pairs SEQ ID NO:9 and SEQ ID NO: 10, or pair of oligonucleotide primers at least 95% identical thereto. The kit may further comprise a probe comprising SEQ ID NO: 11 or a probe at least 95% identical thereto. Primers and Probes

The invention also provides HER3 specific primers comprising SEQ ID NO:6 or a primer at least 95% identical thereto and SEQ ID NO:7 or a primer at least 95% identical thereto.

The invention further provides a HER3 specific probe comprising SEQ ID NO: 8 or a primer at least 95% identical thereto.

The invention provides HER4 specific primers comprising SEQ ID NO:9 or a primer at least 95% identical thereto and SEQ ID NO: 10 or a primer at least 95% identical thereto.

The invention further provides a HER4 specific probe comprising SEQ ID NO: 1 1 or a primer at least 95% identical thereto.

DETAILED DESCRIPTION OF THE INVENTION

In one aspect of the invention there is provided a method for assessing levels of expression of the HER family (hereinafter referred to as "HER" or "HER family"), which includes HER1 (EGFR), HER2 (ErbB2), HER3 (ErbB3) and HER 4 (ErbB4) mRNA obtained from fresh, frozen, fixed or fixed and paraffin-embedded (FPE) tumor cells.

In another aspect of the invention there is provided a method of quantifying the amount of HER1 (EGFR), HER2 (ErbB2), HER3 (ErbB3) and/or HER 4 (ErbB4) mRNA expression relative to a normal tissue sample or to an internal control from a fresh, frozen, fixed or fixed and paraffin-embedded (FPE) tissue sample. This method includes isolation of total mRNA from said sample and determining the quantity of HER 1 (EGFR), HER2 (ErbB2), HER3 (ErbB3) and/or HER 4 (ErbB4) mRNA relative to the quantity expressed in the normal tissue or relative to the quantity of an internal control gene's mRNA.

In an embodiment of this aspect of the invention, there are provided HER1

oligonucleotide primers having the sequence of EGFR-1813F (TGCGTCTCTTGCCGGAAT) (SEQ ID NO: l) or EGFR-1883R (GGCTCACCCTCCAGAAGGTT)(SEQ ID NO:2) and sequences substantially identical thereto. In addition the invention also provides a probe (EGFR- 1833 T) useful to detect EGFR mRNA, especially when the primers EGFR1813F and EGFR- 1883R are used to amplify the isolated mRNA. The probe has the sequence EGFR-1833 T (6FAM-ACGCATTCCCTGCCTCGGCTG)(SEQ ID NO:3). in another embodiment of this aspect of the invention, there are provided HER2 oligonucleotide primers having the sequence of HER2-neu 267 IF

(CTGAACTGGTGTATGCAGATTGC )(SEQ ID NO: 4) or HER2-neu 2699R

(TTCCGAGCGGCCAAGTC)(SEQ ID NO: 5) and sequences substantially identical thereto.

In another embodiment of this aspect of the invention, there are provided HER3 oligonucleotide primers having the sequence of ERBB3a-3663F

(ACGGTTATGTCATGCCAGATACAC)(SEQ ID NO:6) or ERBB3a-3744R

(GAACTGAGACCCACTGAAGAAAGG)(SEQ ID NO:7) and sequences substantially identical thereto. In addition the invention also provides a probe (ERBB3a-3690T) useful to detect HER3 mRNA, especially when the primers ERBB3a-3663F

(ACGGTTATGTCATGCCAGATACAC)(SEQ ID NO:6) and ERBB3a-3744R

(GAACTGAGACCCACTGAAGAAAGG)(SEQ ID NO:7) are used to amplify the isolated mRNA. The probe has the sequence ERBB3a-3690T (6FAM- CTCAAAGGTACTCCCTCCTCCCGGG)(SEQ ID NO: 8).

In another embodiment of this aspect of the invention, there are provided HER4 oligonucleotide primers having the sequence of ERBB4a-l 129F

(TTG ATCTTTCT AGTC ACT GGT ATTC ATG) (SEQ ID NO:9) or ERBB4a-1215R

(TGTCCG A A AG ACGTTC A GTTTC) (SEQ ID NO: 10) and sequences substantially identical thereto. In addition the invention also provides a probe (ERBB4a-l 161 T) useful to detect HER4 mRNA, especially when the primers ERBB4a- 1129F or ERBB4a- 1215R are used to amplify the isolated mRNA. The probe has the sequence ERBB4a-l 161T (6FAM- CCCTTACAATGCAATTGAAGCCATAGACCC)(SEQ ID NO: 11).

The present invention provides primers comprising, consisting of, or consisting essentially of SEQ ID NO: l-2, 4-5, 6-7, or 9-10 or their complements, or a primer that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1-2, 4-5, 6-7, or 9-10 or their complements.

The present invention provides probes comprising, consisting of, or consisting essentially of SEQ ID NO:3, 8, or 11, or their complements or a probe that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:3, 8 or 11 or their complements. The sequence provided for the probes of the present invention show the 6-FAM fluorescent dye. The invention also provides the probes without this dye or with other markers attached. Preferably the primers and probes are specific to HER RNA or DNA. In other words, the primer will only bind to HER DNA or RNA and not to other RNA or DNA. In certain embodiments, the primers are also specific to a particular HER DNA or RNA. In other words, the primer will only bind to one specific HER gene. For instance, a HER1 primer may be specific and only bind to HER1 DNA or RNA and not to other HER RNAs or DNAs.

Methods of the present invention may use any of the primers or probes of the present invention.

"Substantially identical" in the nucleic acid context as used herein, means hybridization to a target under stringent conditions, and also that the nucleic acid segments, or their complementary strands, when compared, are the same when properly aligned, with the appropriate nucleotide insertions and deletions, in at least about 60% of the nucleotides, typically, at least about 70%, more typically, at least about 80%, usually, at least about 90%, and more usually, at least, about 95, 96, 97, 98 and 99% of the nucleotides. Selective hybridization exists when the hybridization is more selective than total lack of specificity. See, Kanehisa, Nucleic Acids Res., 12:203-213 (1984).

Under stringent hybridization conditions, only highly complementary, i.e., substantially similar nucleic acid sequences as defined herein hybridize. Preferably, such conditions prevent hybridization of nucleic acids having 4 or more mismatches out of 20 contiguous nucleotides, more preferably 2 or more mismatches out of 20 contiguous nucleotides, most preferably one or more mismatch out of 20 contiguous nucleotides.

Hybridization of the oligonucleotide primer to a nucleic acid sample under stringent conditions is defined below. Nucleic acid duplex or hybrid stability is expressed as a melting temperature (Tm), which is the temperature at which the probe dissociates from the target DNA. This melting temperature is used to define the required stringency conditions. If sequences are to be identified that are substantially identical to the probe, rather than identical, then it is useful to first establish the lowest temperature at which only homologous hybridization occurs with a particular concentration of salt (e.g. SSC or SSPE). Then assuming that 1 % mismatching results in a 1 °C decrease in Tm, the temperatre of the final wash in the hybridization reaction is reduced accordingly (for example, if sequences having >95% identity with the probe are sought, the final wash temperature is decrease by 5°C). In practice, the change in Tm can be between 0.5 °C. and 1.5 °C per 1% mismatch. Stringent conditions involve hybridizing at about 68 ° C in 5 x SSC/5 x Denhart's solution/1.0% SDS, and washing in 0.2 x SSC/0.1 % SDS at room temperature. Moderately stringent conditions include washing in 3 x SSC at about 42 °C. The parameters of salt concentration and temperature be varied to achieve optimal level of identity between the primer and the target nucleic acid. Additional guidance regarding such conditions is readily available in the art, for example, Sambrook, Fischer and Maniatis, Molecular Cloning, a laboratory manual, (2nd ed.), Cold Spring Harbor Laboratory Press, New York, (1989) and F. M. Ausubel et al eds., Current Protocols in Molecular Biology, John Wiley and Sons (1994).

Embodiments of the present invention comprise HER 1 , HER2, HER3 or HER4 specific forward and reverse primers (i.e. primers that are capable of binding to and amplifying HER 1 , HER2, HER3 or HER4 as opposed to not binding to and amplifying nonHER DNA or RNA). Exemplary forward primers include SEQ ID NO:l ; SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO: 9. Exemplary reverse primers include SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:7and SEQ ID NO: 10. In addition, to the sequences set forth in SEQ ID NO:l-l 1 the invention also provides primers having 80%, 85%, 90%, 95%, 96%, 97%, 98% and 99% identity to the sequences set forth in the SEQ ID NOs. One skilled in the art can appreciate that one may be able to take the enumerated sequence in the SEQ ID NO: and alter one or a few bases and the primer may still work in the methods of the present invention. In addition, one may shift the primers upstream or downstream, and/or add a few or subtract a few bases and still achieve a desired amplicon of suitable length and allow for later identification of the presence or quantification of the amount of expression of the HER RNA or DNA. One can easily test these primer variants by methods known in the art, for example by performing amplification of a control sample that has the HER DNA or RNA present and then determining if the new primer was indeed able to amplify and pick up this variant.

Embodiments of the present invention comprise oligonucleotide probe sequences, wherein the oligonucleotide is used as a probe for the detection of HER 1, HER2, HER3 or HER4 sequences. Optionally, the oligonucleotide is detectably labeled. Exemplary probes include SEQ ID NO:3, SEQ ID NO: 8, and SEQ ID NO:l 1. In addition, to the probe sequences set forth in SEQ ID NO:3, SEQ ID NO:8, and SEQ ID NO: l 1, the invention also provides probes having 80%, 85%, 90%, 95%, 96%, 97%, 98%,and 99% identity to the sequences set forth in the SEQ ID NO:3, SEQ ID NO:8, and SEQ ID NO:l 1. One skilled in the art can appreciate that one may be able to take the enumerated sequence in the SEQ ID NO and alter one or a few bases, and the probe may still work in the methods of the present invention. In addition, one may shift the probe upstream or downstream, and/or add a few or subtract a few bases, and it may still be able to bind to and identify the various HER 1, HER2, HER3 or HER4 sequences. One can easily test these new probe by methods known in the art, for example by taking a sample known to contain a HER 1, HER2, HER3 or HER4 sequence, labeling the probe and allowing the probe to bind to the HER 1, HER2, HER3 or HER4 sequences, washing away any unbound probe and then looking to see if there is label present bound to the HER 1 , HER2, HER3 or HER4 sequences.

The present invention also provides a kit comprising at least one of SEQ ID NO: 1 -1 1 or primer or probe 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:l-l 1.

The present invention provides a method for detecting the presence and amount of either HER1 , HER2, HER3 and/or HER4 in a sample by (a) isolating a nucleic acid from the sample wherein the sample comprises DNA sequences, (b) performing an amplification reaction of said sequences using a first primer capable of annealing specifically to the HER1 , HER2, HER3 and/or HER4 DNA sequence at a first position in a HERl , HER2, HER3 and/or HER4 DNA sequence and a second primer capable of annealing specifically at a second position in a HERl , HER2, HER3 and/or HER4 DNA sequence, and (c) visualizing or detecting amplification products produced by said amplification reaction, wherein detection of the HER (1,2, 3 and/or 4) specific amplification product is a positive indicator of a HER(1 ,2, 3 and/or 4) in the sample, as well as the amount of HER(1,2, 3 and/or 4) in the sample. The first and second primers anneal to different strands of double stranded HERl, HER2, HER3 and/or HER4 DNA sequence. The first primer is selected from the group consisting of SEQ ID NO: 1 ; SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:9. The second primer is SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:7and SEQ ID NO.T 0. The term "first primer" is used interchangeably with "forward primer."

Similarly, the term "second primer" is used interchangeably with "reverse primer." The amplification reaction is capable of producing an HER 1, HER2, HER3 or HER4 specific amplification product when the DNA sequences of the sample comprise an HER 1, HER2, HER3 or HER4 DNA sequence. In certain embodiments a probe is added to assed in the visualization or detection or quantification of the amplified DNA. For example the probe may be SEQ ID

NO: 3, 8 or 1 1. For example, in the Taq Man® real time PCR assay, the probe is labeled with 6- Fam and this allows for the quantification of the amount of DNA based on the amount (the fluorescent output) of the labeled probe.

The present invention provides a method for detecting the presence of HER 1, HER2, HER3 or HER4 in a sample by (a) isolating a nucleic acid from the sample wherein the sample comprises RNA sequences, (b) performing an amplification reaction of said sequences using a first primer capable of annealing specifically to HER 1, HER2, HER3 or HER4 sequence at a first position in a HER 1 , HER2, HER3 or HER4 RNA sequence and a second primer capable of annealing specifically at a second position in a HER 1, HER2, HER3 or HER4 RNA sequence, and (c) visualizing or detecting amplification products produced by said amplification reaction, wherein detection of a HER 1, HER2, HER3 or HER4 specific amplification product is a positive indicator of a HER 1 , HER2, HER3 or HER4 in the sample. The first and second primers anneal to different strands of double stranded HER 1 , HER2, HER3 or HER4 RNA sequence. The first primer is selected from the group consisting of SEQ ID NO:l ; SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:9. The second primer is SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO: 10. The amplification reaction is capable of producing an HER 1, HER2, HER3 or HER4 specific amplification product when the RNA sequences of the sample comprise an HER 1 , HER2, HER3 or HER4 RNA sequence. For example the probe may be SEQ ID NO: 3, 8 or 1 1. For example, in the taq man® real time PCR assay, the probe is labeled with 6-Fam and this allows for the quantification of the amount of DNA based on the amount (the fluorescent output) of the labeled probe.

In performing a method of the present invention, HER 1 , HER2, HER3 and/or HER4 expression levels are assayed in patient tumor samples to prognosticate the efficacy of a treatment regimen. Tumors expressing high levels of the HER gene family (HER 1 , 2, 3 and 4) mRNA are considered likely to be sensitive to receptor tyrosine kinase targeted chemotherapy. For example, if the tumor shows the a high expression level of an HER 1 , HER2, HER3 or HER4, then the patient may be unresponsive to certain treatments. Accordingly, the present invention provides a method of determining a chemotherapeutic regimen for treating a tumor in a patient comprising: (a) obtaining a tissue sample of the tumor; (b) isolating DNA or RNA from the tumor sample; (c) subjecting the DNA or RNA to amplification using a pair of

oligonucleotide primers capable of amplifying a region of the HER 1, HER2, HER3 or HER4 gene, to obtain a HER 1, HER2, HER3 or HER4 amplified sample; (d) determining the presence of a HER 1 , HER2, HER3 or HER4 in the amplified sample; (e) determining a chemotherapeutic regimen based on the presence or amount of an HER 1, HER2, HER3 or HER4 RNA or DNA in the sample. In certain embodiments, the method also involves adding a probe that is specific to HER1 , 2 3 or 4, such as the probes of the present invention to aid in determining and quantifying the amount of HER RNA or DNA in the sample.

In performing an embodiment of the present invention, tumor cells are preferably isolated from the patient. In certain embodiments, mRNA is obtained from fresh, frozen, fixed or fixed and paraffin-embedded (FPE) tissue. Solid or lymphoid tumors or portions thereof are usually surgically resected from the patient or obtained by routine biopsy. DNA or RNA isolated from frozen or fresh samples is extracted from the cells by any of the methods typical in the art, for example, Sambrook, Fischer and Maniatis, Molecular Cloning, a laboratory manual, (2nd ed.), Cold Spring Harbor Laboratory Press, New York, (1989). Preferably, care is taken to avoid degradation of the DNA or RNA during the extraction process.

In yet another aspect of the invention there is provided a method for determining a receptor tyrosine kinase targeted chemotherapeutic regimen for a patient, comprising isolating RNA from a fresh, frozen, fixed or fixed and paraffin-embedded (FPE) tumor sample; isolating RNA from a fresh, frozen, fixed or fixed and paraffin-embedded (FPE) matching non-malignant tissue sample; determining a gene expression level of HER1 , 2, 3 and or 4 in both samples; dividing the level of HER1 , 2, 3 and or 4 expression in the tumor sample with the HER1 , 2, 3 and or 4 expression level in the matching non-malignant tissue sample to determine a differential expression level; comparing the differential HE 1, 2., 3 and or 4 gene expression level with a predetermined threshold level for the HER1, 2, 3 and or 4 gene; and determining a

chemotherapeutic regimen based on results of the comparison of the differential HER1, 2, 3 and or 4 gene expression level with the predetermined threshold level.

In yet another aspect of the invention there is provided a method for determining a receptor tyrosine kinase targeted chemotherapeutic regimen for a patient, comprising isolating RNA from a fresh, frozen, fixed or fixed and paraffin- embedded (FPE) tumor sample; isolating RNA from a fresh, frozen, fixed or fixed and paraffin-embedded (FPE) matching non-malignant tissue sample; determining gene expression levels of a first HER1, 2, 3 or 4 gene and from a second, but different HER1, 2, 3 and 4 gene in both of the samples; dividing the level of the first HER1 , 2, 3 or 4 expression in the tumor sample with the first HER1 , 2, 3 or 4 expression level in the matching non-malignant tissue sample to determine a first HERl, 2, 3 and 4 differential expression level; dividing the level of the second HERl , 2, 3 or 4 expression in the tumor sample with the second HERl, 2, 3 and 4 expression level in the matching non-malignant tissue sample to determine a second differential HERl , 2, 3 and 4 expression level; comparing the differential from the first and the second HERl, 2, 3 or 4 gene expression levels with a predetermined threshold level for each of the HERl , 2, 3 and 4 genes; and determining a chemotherapeutic regimen based on results of the comparison of the first and second differential HERl, 2, 3 and 4 gene expression levels with the predetermined threshold levels. For example, in one scenario the first HER gene is HERl and the second is HER2. In another scenario, the first HER gene is HER 2 and the second is HER 3. In another scenario, the first HER gene is HER 2 and the second gene is HER4. Any combination of testing HE l ,2,3 and 4 gene expression is contemplated by the present invention.

In yet another aspect of the invention there is provided a method for determining the survivability of a patient, comprising isolating RNA from a fresh, frozen, fixed or fixed and paraffin- embedded (FPE) tumor sample; isolating RNA from a fresh, frozen, fixed or fixed and paraffin- embedded (FPE) matching non-malignant tissue sample; determining a gene expression level of HERl, 2, 3 or 4 in both samples; dividing the level of HERl, 2, 3 or 4 expression in the tumor sample with the HERl, 2, 3 or 4 expression level in the matching non-malignant tissue sample to determine a differential expression level; comparing the differential HERl, 2, 3 or 4 gene expression level with a predetermined threshold level for the HERl , 2, 3 or 4 gene; and determining the survivability of a patient based on results of the comparison of the differential HERl, 2, 3 or 4 gene expression levels with the predetermined threshold level.

In yet another aspect of the invention there is provided a method for determining the survivability of a patient, comprising isolating RNA from a fresh, frozen, fixed or fixed and paraffin- embedded (FPE) tumor sample; isolating RNA from a fresh, frozen, fixed or fixed and paraffin- embedded (FPE) matching non-malignant tissue sample; determining gene expression level of a first HER 1, 2, 3 or 4 gene and a second, different HER 1, 2,3 or 4 gene in both of the samples; dividing the level of the first HER 1, 2, 3 or 4 expression in the tumor sample with the first HER 1 , 2, 3 or 4 expression level in the matching non-malignant tissue sample to determine a first HER 1, 2, 3 or 4 differential expression level; dividing the level of the second HER 1, 2, 3 or 4 expression in the tumor sample with the second HER 1 , 2, 3 or 4 expression level in the matching non-malignant tissue sample to determine a second HER 1, 2, 3 or 4 differential expression level; comparing the differential first and second HER 1 , 2, 3 or 4 gene expression levels with a predetermined threshold level for each of the first and second HER 1 , 2, 3 or 4 genes; and determining the survivability of a patient based on results of the comparison of the first and second HER 1, 2, 3 or 4 gene expression levels with the predetennined threshold levels.

The invention further relates to a method of normalizing the uncorrected gene expression (UGE) of HER 1 , 2, 3 and/or 4 relative to an internal control gene in a tissue sample analyzed using TaqMan® technology to known HERl, 2, 3 and 4 expression levels relative to an internal control from samples analyzed by pre-TaqMan® technology. See US patent 6,582,919, which is incorporated herein in its entirety.

This measurement of HERl, 2, 3 and/or 4 gene expression may then be used for prognosis of receptor tyrosine kinase targeted chemotherapy.

The methods of the present invention can be applied over a wide range of tumor types. This allows for the preparation of individual "tumor expression profiles" whereby expression levels of HERl , 2, 3 and/or 4 are determined in individual patient samples and response to various chemotherapeutics is predicted.

A "differential expression level" as defined herein refers to the difference in the level of expression of HERl, 2,3 or 4 in a tumor with respect to the level of expression of either HERl , 2,3 or 4 in a matching non-malignant tissue sample, respectively. The differential expression level is determined by dividing the UGE of a particular gene from the tumor sample with the UGE of the same gene from a matching non-malignant tissue sample. See US patent 6.582,919 for a discussion of calculating differential expression levels.

A "predetermined threshold level", as defined herein relating to HERl , 2,3 or 4 expression, is a level of differential HERl , 2,3 or 4 expression above which (i.e., high), tumors are likely to be sensitive to a receptor tyrosine kinase targeted chemotherapeutic regimen. A high differential HERl, 2,3 or 4 expression level is prognostic of lower patient survivability. Tumors with expression levels below this threshold level are not likely to be affected by a receptor tyrosine kinase targeted chemotherapeutic regimen. A low differential HERl , 2,3 or 4 expression level is prognostic of higher patient survivability. Whether or not differential expression is above or below a "predetermined threshold level" is determined by the method used by Mafune et al., who calculated individual differential tumor/normal (T/N) expression ratios in matching non-malignant tissues obtained from patients with squamous cell carcinoma of the esophagus. Mafune et al., Clin Cancer Res 5:4073-4078, 1999. This method of analysis leads to a precise expression value for each patient, being based on the individual background expression obtained from matching non-malignant tissue. For example, the differential expression of HER1 or HER2is considered "high" and indicative of low survivability if the UGE of HER1 or HER2: -actin in a tumor sample divided by the UGE of HER1 or HER2:p-actin in a matching non-malignant tissue sample, is above the predetermined threshold value of about 1.8. The differential expression of HER 1 or HER24 is considered "low" and indicative of high survivability if the UGE of HER 1 or HER2: -actin in a tumor sample divided by the UGE of HER1 or HER2: -actin in a matching non-malignant tissue sample, is below the predetermined threshold value of about 1.8. See US patent 6.582,919 for a more detailed description and explanation of threshold levels.

In performing the method of the present invention either differential HER1, 2, 3 and/or 4 or any combination thereof, expression levels are assayed in a patient to. prognosticate the efficacy of a receptor tyrosine kinase targeted chemo therapeutic regimen. Moreover, in the method of the present invention differential HER expression levels are assayed in a patient prognosticate the efficacy of a receptor tyrosine kinase targeted chemo therapeutic regimen. Alternatively, more than one HER expression levels and differential HER expression levels are assayed in a patient to prognosticate the efficacy of a receptor tyrosine kinase targeted chemotherapeutic regimen.

"Matching non-malignant sample" as defined herein refers to a sample of non-cancerous tissue derived from the same individual as the tumor sample to be analyzed for differential HER expression. Preferably a matching non-malignant sample is derived from the same organ as the organ from which the tumor sample is derived. Most preferably, the matching non-malignant tumor sample is derived from the same organ tissue layer from which the tumor sample is derived. Also, it is preferable to take a matching non-malignant tissue sample at the same time a tumor sample is biopsied. In a preferred embodiment tissues from the following two locations are analyzed: 1 ung tumor and non-malignant lung tissue taken from the greatest distance form the tumor or colon tumor and non-malignant colon tissue taken from the greatest distance form the tumor as possible under the circumstances. In performing the method of this embodiment of the present invention, tumor cells are preferably isolated from the patient. Solid or lymphoid tumors or portions thereof are surgically resected from the patient or obtained by routine biopsy. RNA isolated from frozen or fresh tumor samples is extracted from the cells by any of the methods typical in the art, for example, Sambrook, Fischer and Maniatis, Molecular Cloning, a laboratory manual, (2nd ed.), Cold Spring Harbor Laboratory Press, New York, (1989). Preferably, care is taken to avoid degradation of the RNA during the extraction process.

However, tissue obtained from the patient after biopsy is often fixed, usually by formalin (formaldehyde) or gluteraldehyde, for example, or by alcohol immersion. Fixed biological samples are often dehydrated and embedded in paraffin or other solid supports known to those of skill in the art. See Plenat et al., Ann Pathol January 2001 ;21(l):29-47. Non-embedded, fixed tissue as well as fixed and embedded tissue may also be used in the present methods. Solid supports for embedding fixed tissue are envisioned to be removable with organic solvents for example, allowing for subsequent rehydration of preserved tissue.

RNA is extracted from paraffin-embedded (FPE) tissue cells by any of the methods as described in U.S. Pat. No. 6,248,535, which is hereby incorporated by reference in its entirety. As used herein, FPE tissue means tissue that has been fixed and embedded in a solid removable support, such as storable or archival tissue samples. RNA may be isolated from an archival pathological sample or biopsy sample which is first deparaffinized. An exemplary

deparaffinization method involves washing the paraffmized sample with an organic solvent, such as xylene, for example. Deparaffinized samples can be rehydrated with an aqueous solution of lower alcohol. Suitable lower alcohols, for example include, methanol, ethanol, propanols and butanols. Deparaffinized samples may be rehydrated with successive washes with lower alcoholic solutions of decreasing concentration, for example. Alternatively, the sample is simultaneously deparaffinized and rehydrated. RNA is then extracted from the sample.

For RNA extraction, the fixed or fixed and deparaffinized samples can be homogenized using mechanical, sonic or other means of homogenization. Rehydrated samples may be homogenized in a solution comprising a chaotropic agent, such as guanidinium thiocyanate (also sold as guanidinium isothiocyanate). Homogenized samples are heated to a temperature in the range of about 50 to about 100 °C in a chaotropic solution, which contains an effective amount of a chaotropic agent, such as a guanidinium compound. A preferred chaotropic agent is guanidinium thiocyanate.

An "effective concentration of chaotropic agent" is chosen such that RNA is purified from a paraffin-embedded sample in an amount of greater than about 10-fold that isolated in the absence of a chaotropic agent. Chaotropic agents include, for example: guanidinium compounds, urea, formamide, potassium iodiode, potassium thiocyantate and similar compounds. The preferred chaotropic agent for the methods of the invention is a guanidinium compound, such as guanidinium isothiocyanate (also sold as guanidinium thiocyanate) and guanidinium

hydrochloride. Man anionic counterions are useful, and one of skill in the art can prepare many guanidinium salts with such appropriate anions. The effective concentration of guanidinium solution used in the invention generally has a concentration in the range of about 1 to about 5M with a preferred value of about 4M. If RNA is already in solution, the guanidinium solution may be of higher concentration such that the final concentration achieved in the sample is in the range of about 1 to about 5M. The guanidinium solution also is preferably buffered to a pH of about 3 to about 6, more preferably about 4, with a suitable biochemical buffer such as Tris-Cl. The chaotropic solution may also contain reducing agents, such as dithiothreitol (DTT) and β- mercaptoethanol (BME). The chaotropic solution may also contain RNAse inhibitors.

RNA is then recovered from the chaotropic solution by, for example, phenol chloroform extraction, ion exchange chromatography or size- exclusion chromatography. RNA may then be further purified using the techniques of extraction, electrophoresis, chromatography,

precipitation or other suitable techniques.

In addition other methods of RNA isolation may be employed that are known in the art. For example, US patent application 12/144,388 published as 2009/0092979 discloses another preferred method of isolating RNA.

The quantification of HER mRNA from purified total mRNA from fresh, frozen or fixed is preferably carried out using real time polymerase chain reaction (RT-PCR) methods common in the art, for example. Other methods of quantifying of HER mRNA include for example, the use of molecular beacons and other labeled probes useful in multiplex PCR. Additionally, the present invention envisages the quantification of HER mRNA via use of a PCR-free systems employing, for example fluorescent labeled probes similar to those of the Invader® Assay (Third Wave Technologies, Inc.). Most preferably, quantification of HER cDNA and an internal control or house keeping gene (e.g. β-actin) is done using a fluorescence based real-time detection method (ABI PRISM 7700 or 7900 Sequence Detection System [TaqMan®], Applied Biosystems, Foster City, Calif.) or similar system as described by Heid et al., (Genome Res 1996;6:986-994) and Gibson et al.(Genome Res 1996;6:995-1001). The output of the ABI 7700 (TaqMan® Instrument) is expressed in Ct's or "cycle thresholds." With the TaqMan® system, a highly expressed gene having a higher number of target molecules in a sample generates a signal with fewer PCR cycles (lower Ct) than a gene of lower relative expression with fewer target molecules (higher Ct).

As used herein, a "house keeping" gene or "internal control" is any constitutively or globally expressed gene whose presence enables an assessment of HER mRNA levels. Such an assessment comprises a determination of the overall constitutive level of gene transcription and a control for variations in RNA recovery. House-keeping" genes or "internal controls" can include, but are not limited to the cyclophilin gene, β-actin gene, the transferrin receptor gene, GAPDH gene, and the like. Most preferably, the internal control gene is β-actin gene as described by Eads et al, Cancer Research 1 99; 59:2302-2306.

A control for variations in RNA recovery requires the use of "calibrator RNA." The "calibrator RNA" is intended to be any available source of accurately pre-quantified control RNA. Preferably, Human Liver Total RNA (Stratagene, Cat #735017) is used.

"Uncorrected Gene Expression (UGE)" as used herein refers to the numeric output of HER expression relative to an internal control gene generated by the TaqMan® instrument. The equation used to determine UGE is shown in US patent 6,582,919.

These numerical values allow the determination of whether or not the differential gene expression (i.e., "UGE" or of a particular tumor sample divided by the "UGE" of a matching non-tumor sample) falls above or below the "predetermined threshold" level. The predetermined threshold level for HER1 or HER2 is about 1.8.

A further aspect of this invention provides a method to normalize uncorrected gene expression (UGE) values acquired from the TaqMan® instrument with "known relative gene expression" values derived from non-TaqMan® technology. Preferably, TaqMan® derived HER UGE values from a tissue sample are normalized to samples with known non-TaqMan® derived relative HER^-actin expression values. "Corrected Relative HER Expression" as used herein refers to normalized HER expression whereby UGE is multiplied with a HERspecific correction factor (KHER), resulting in a value that can be compared to a known range of HERexpression levels relative to an internal control gene. US patent 6,582,939 illustrate these calculations in detail. These numerical values also allow the determination of whether or not the "Corrected Relative Expression" of a particular tumor sample divided by the "Corrected Relative Expression" of a matching non- tumor sample (i.e., differential expression) falls above or below the "predetermined threshold" level. The predetermined threshold level for HER 1 or HER2 is about 1.8. In determining whether the differential expression of either HER1 or HER2 in a tumor sample is 1 .8 times greater than in a matching non-tumor sample, one will readily recognize that either UGE values or Corrected Relative Expression values can be used. For example, if one divides the Corrected Relative Expression level of the tumor with that of the matching non-tumor sample, the K-factor cancels out and one is left with same ratio as if one had used UGE values.

"Known relative gene expression" values are derived from previously analyzed tissue samples and are based on the ratio of the RT-PCR signal of a target gene to a constitutively expressed internal control gene (e.g. β-Actin, GAPDH, etc.). Preferably such tissue samples are formalin fixed and paraffin-embedded (FPE) samples and RNA is extracted from them according to the protocol described in Example 1 of US 6,582,919. To quantify gene expression relative to an internal control standard quantitative RT-PCR technology known in the art is used. Pre- TaqMan® technology PCR reactions are run for a fixed number of cycles (i.e., 30) and endpoint values are reported for each sample. These values are then reported as a ratio of HER expression to β-actin expression.

K _HER may be determined for an internal control gene other than β-actin and/or a calibrator RNA different than Human Liver Total RNA (Stratagene, Cat #735017). To do so, one must calibrate both the internal control gene and the calibrator RNA to tissue samples for which HER expression levels relative to that particular internal control gene have already been determined (i.e., "known relative gene expression"). Preferably such tissue samples are formalin fixed and paraffin-embedded (FPE) samples and RNA is extracted using known reliable techniques. Such a determination can be made using standard pre-TaqMan®, quantitative RT-PCR techniques well known in the art. Upon such a determination, such samples have "known relative gene expression" levels of HER useful in the determining a new K _H ER specific for the new internal control and/or calibrator RNA. See example 3 and 4 of US patent 6,582, 19.

The methods of the invention are applicable to a wide range of tissue and tumor types and so can be used for assessment of clinical treatment of a patient and as a diagnostic or prognostic tool for a range of cancers including, but not limited to, breast, head and neck, lung, esophageal, colorectal, and others. The present methods may also be applied to the prognosis of NSCLC tumors.

Oligonucleotide primers disclosed herein are capable of allowing accurate assessment of HER gene expression in a fixed or fixed and paraffin embedded tissue, as well as frozen or fresh tissue. This is despite the fact that RNA derived from FPE samples is more fragmented relative to that of fresh or frozen tissue. Thus, the methods of the invention are suitable for use in assaying HER gene expression levels in all tissues where previously there existed no accurate and consistent way to assay HER gene in fresh and frozen tissues and no way at all to assay HER gene expression using fixed tissues.

A "receptor tyrosine kinase targeted" chemotherapy or chemotherapeutic regimen in the context of the present invention refers a chemotherapy comprising agents that specifically interfere with Class I receptor tyrosine kinase function. Preferably, such agents will inhibit HER receptor tyrosine kinase signaling activity. Such agents include 4-anilinoquinazolines such as 6- acrylamido-4-anilinoquinazoline Bonvini et al., Cancer Res. Feb. 15, 2001 ;61(4):1671-7 and derivatives, erbstatin (Toi et al., Eur. J. Cancer Clin. Oncol., 1990, 26, 722.), Geldanamycin, bis monocyclic, bicyclic or heterocyclic aryl compounds (PCT WO 92/20642), vinylene-azaindole derivatives (PCT WO 94/14808) and l-cycloproppyl-4-pyridyl-quinolones (U.S. Pat. No.

5,330,992) which have been described generally as tyrosine kinase inhibitors. Also, Styryl compounds (U.S. Pat. No. 5,217,999), styryl-substituted pyridyl compounds (U.S. Pat. No. 5,302,606), certain quinazoline derivatives (EP Application No. 0 566 266 Al), seleoindoles and selenides (PCT WO 94/03427), tricyclic polyhydroxylic compounds (PCT WO 92/21660) and benzylphosphonic acid compounds (PCT WO 91/15495) have been described as compounds for use as tyrosine kinase inhibitors for use in the treatment of cancer.

Other agents targeting HER receptor tyrosine kinase signaling activity include antibodies that inhibit growth factor receptor biological function indirectly by mediating cytotoxicity via a targeting function. Antibodies complexing with the receptor activates serum complement and/or mediate antibody-dependent cellular cytotoxicity. The antibodies which bind the receptor can also be conjugated to a toxin (immunotoxins). Advantageously antibodies are selected which greatly inhibit the receptor function by binding the steric vicinity of the ligand binding site of the receptor (blocking the receptor), and/or which bind the growth factor in such a way as to prevent (block) the ligand from binding to the receptor. These antibodies are selected using conventional in vitro assays for selecting antibodies which neutralize receptor function. Antibodies that act as ligand agonists by mimicking the ligand are discarded by conducting suitable assays as will be apparent to those skilled in the art. For certain tumor cells, the antibodies inhibit an autocrine growth cycle (i.e. where a cell secretes a growth factor which then binds to a receptor of the same cell). Since some Iigands, e.g. TGF-a, are found lodged in cell membranes, the antibodies serving a targeting function are directed against the ligand and/or the receptor.

The cytotoxic moiety of the immunotoxin may be a cytotoxic drug or an enzymatically active toxin of bacterial or plant origin, or an enzymatically active fragment of such a toxin. Enzymatically active toxins and fragments thereof used are diphtheria, nonbinding active fragments of diphtheria toxin, exotoxin (from Pseudomonas aeruginosa), ricin, abrin, modeccin, alpha-sarcin, Aleurites fordii proteins, dianthin proteins, Phytolacca americana proteins (PAPI, PAP II, and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, and enomycin. In another embodiment, the antibodies are conjugated- to small molecule anticancer drugs. Conjugates of the monoclonal antibody and such cytotoxic moieties are made using a variety of bifunctional protein coupling agents. Examples of such reagents are SPDP, IT, bifunctional derivatives of imidoesters such a dimethyl adipimidate HCI, active esters such as disuccinimidyl suberate, aldehydes such as glutaraldehyde, bis-azido compounds such as bis (p-azidobenzoyl) hexanediamine, bis- diazonium derivatives such as bis-(p-diazoniumbenzoyl)-ethylenediamine, diisocyanates such as tolylene 2,6-diisocyanate, and bis-active fluorine compounds such as l,5-difluoro-2,4- dinitrobenzene. The lysing portion of a toxin may be joined to the Fab fragment of the antibodies.

Cytotoxic radiopharmaceuticals for treating cancer may be made by conjugating radioactive isotopes to the antibodies. The term "cytotoxic moiety" as used herein is intended to include such isotopes. In another embodiment, liposomes are filled with a cytotoxic drug and the liposomes are coated with antibodies specifically binding a growth factor receptor. Since there are many receptor sites, this method permits delivery of large amounts of drug to the appropriate cell type. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g. Fingl et al., in The Pharmacological Basis of Therapeutics, 1975, Ch. 1 p. 1). It should be noted that the attending physician would know how and when to terminate, interrupt, or adjust administration due to toxicity, or organ dysfunctions. Conversely, the attending physician would also know to adjust treatment to higher levels if the clinical response were not adequate (precluding toxicity). The magnitude of an administrated dose in the management of the oncogenic disorder of interest will vary with the severity of the condition to be treated and to the route of administration. The severity of the condition may, for example, be evaluated, in part, by standard prognostic evaluation methods. Further, the dose and perhaps dose frequency, will also vary according to the age, body weight, and response of the individual patient.

Depending on the specific conditions being treated, such agents may be formulated and administered systemically or locally. Techniques for formulation and administration may be found in Remington's Pharmaceutical Sciences, 18th ed., Mack Publishing Co., Easton, Pa. (1990). Suitable routes may include oral, rectal, transdermal, vaginal, transmucosal, or intestinal administration; parenteral delivery, including intramuscular, subcutaneous, intramedullary injections, as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, or intraocular injections, just to name a few. For injection, the agents of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. For such transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

The invention being thus described, practice of the invention is illustrated by the experimental examples provided below. The skilled practitioner will realize that the materials and methods used in the illustrative examples can be modified in various ways. Such

modifications are considered to fall within the scope of the present invention. EXAMPLES

Example 1

cDNA generated from the tissue RNA is used as a template for quantitative PCR analysis. The quantitative PCR analysis yields a relative gene expression by relating the quantity of a target gene to a stably and constitutively expressed "housekeeping" gene. The cDNA template is generated using random hexamers to reverse transcribe the RNA, hence all genes should be represented proportionally in the cDNA solution. The relative levels of gene expression are then detemiined by "Real Time" PCR amplification and quantitation of a target gene with respect to a housekeeping gene, e.g. TS/beta-Actin.

Quantitation is accomplished by comparing relative levels of gene expression in unknown cDNA solutions to known standards analyzed simultaneously using the ABI 7900. These PCR reactions use gene-specific PCR primers and fluorescent labeled probes specifically designed to be used with ABI 7900 technology. The resultant relative gene expression of the specimen is then compared to other similar specimens in the database to determine whether the tissue exhibits a high or low level of gene expression.

Procedure (PCR Preparation): For each assay, the forward and reverse primer along with the probe and the reaction mix is used.

Tissues tested included colon, brain, liver, skin, spleen and testes.