Field of the invention

The present invention relates to a diagnostic for trypanosomes that cause Human African Trypanosomiasis (HAT) and Animal African Trypanosomiasis (AAT). In particular a diagnostic kit and method to determine the presence of small RNA derived from the non-coding 7SL RNA of the peptide signal recognition particle and use of the same to monitor the effectiveness of treatment strategies is provided. Detection of small RNA derived from the non-coding 7SL RNA of the peptide signal recognition particle in the blood and / or serum of an infected subject is particularly attractive.

Background

African trypanosomes are vector borne protozoa transmitted by tsetse flies (Glossina species) that cause Human African Trypanosomiasis (HAT) and Animal African Trypanosomiasis (AAT) across sub-Saharan Africa. AAT, caused by Trypanosoma congolense, Trypanosoma vivax and Trypanosoma brucei affects approximately 70 million cattle and kills 3 million cattle per year. It is one of the most significant infectious disease constraints upon agriculture in the region. HAT is caused by two variants of T brucei, T b. gambiense and T b. rhodesiense, and in recent years the impact of this disease has been significantly reduced through active case detection. The ability to diagnose active infections is currently still a significant challenge for both AAT and HAT. While there have been substantial efforts to develop new effective diagnostics for HAT, currently the gold standards for detection of AAT and HAT are microscopy and the card agglutination test (CATT) - an antibody capture ELISA based upon several VSGs expressed by T b. gambiense. Available methods for both HAT and AAT have their limitations. The requirement for a test that enables detection of active infection remains, both for potential utility in the field and to improve, for example, assessment of clinical efficacy of drugs and vaccines (increasing areas of interest for AAT).

Human and animal African trypanosomiasis (HAT & AAT, respectively) remain a significant health and economic issue across much of sub-Saharan Africa. Effective control of AAT and potential eradication of HAT requires affordable, sensitive and specific diagnostic tests that can be used in the field. Zelazny et al, 2005, American Journal of Tropical Medicine and Hygiene, 72, 415- 420 evaluated the utility of the 7SL gene in Leishmania (a distantly related protozoan parasite to African trypanosomes) as a potential tool to identify Leishmania in samples. Whilst this study considered gene sequence in DNA, from either laboratory or clinical samples only genomic DNA alone was considered (i.e. requiring presence of parasite cells in the original sample).

Rosales-Chilama et al, 2015, PLoS Neglected Tropical Diseases, 9, e0004273 analysed the utility of the 7SL gene to assess Leishmania presence and persistence in samples from human patients. This study also used the gene sequence in DNA extracted from cells and tissue samples, not the small RNA product used as our target.

Michaeli et al, 2012, Nucleic Acids Research, 4, 1282-1298 analysed the repertoire of small RNAs within Trypanosoma brucei cells using RNAseq. This study only looked at all of the small RNAs present within cells.

Summary of the Invention

The inventors have determined species-specific trypanosome small RNA that can be detected at high levels in the serum of cattle with active parasite infections. This small RNA is a 26-nucleotide segment of the 7SL long non-coding RNA (7SL RNA’); the latter is usually described as a cytoplasmic non-coding RNA that is part of the signal recognition particle (SRP) involved in protein translocation across cell membranes. The 7SL-derived small RNA (hereafter termed 7SL-sRNA’) sequences are species-specific, enabling the design of tests that differentiate between T.

congolense, T. vivax and T. brucei. The 7SL-sRNA is present at high levels in infected animals (equivalent to levels of highly expressed bovine miRNAs), enabling robust detection both before detection by microscopy and during periods of infection with subpatent parasitaemia. Importantly, following post-curative treatment the levels of the 7SL-sRNA drops to undetectable levels. Therefore, the 7SL-sRNA represents a suitably sensitive and specific marker for detection of active infection in

trypanosomes, with potential utility for both HAT and AAT. The finding that particular sequences are excreted/secreted from trypanosome and that such sequences are stably present in the serum/plasma of infected animals allows the RNA sequences identified herein to be utilised as a diagnostic target.

The sequences of the small RNA fragment are conserved within trypanosome species, but contain polymorphisms between trypanosome species. This enabled the inventors to design of species-specific assays for Trypanosoma brucei,

Trypanosoma congolense and Trypanosoma vivax, the main causative agents of animal trypanosomiasis.

Small RNAs in the blood or serum are attractive disease biomarkers due to their stability, accessibility and available technologies for detection.

Using RNAseq, the inventors have identified a trypanosome specific small RNA, detected at high levels in the serum of infected cattle. The sequence is a species of small RNA, which is encoded by the 7SL gene, i.e. the sequence is a product of the gene being transcribed by the relevant trypanosome cells.

The small RNA is derived from the non-coding 7SL RNA of the peptide signal recognition particle and is detected in the plasma or serum of infected cattle. This means that it is extracellular to the parasite, and therefore has been secreted or excreted. Detection of the sequence in the plasma or serum at significantly higher levels than in the parasite has been determined.

Without wishing to be bound by theory it is considered this may be due to active processing and secretion. It is considered that each trypanosome cell may be producing and secreting/excreting many copies of the small RNA. Therefore, the signal represented by the numbers of sequence in serum/plasma is significantly higher than if, for example, a gene in trypanosome DNA was being detected.

Measurement of genes in trypanosome DNA suffer from the limitations of the number of parasite cells in the starting sample, in that the detection limit is defined by the number of copies of the gene in each cells’ genome (for example, in the case of the 7SL gene, this is one gene copy per cell).

Ongoing infections with trypanosomes results in waves of parasitaemia with the parasite undetectable in the blood by microscopy during the lag phase of infection. The inventors have determined that the 7SL small RNA can be detected at high levels, even during the lag phase of infection, indicating positive infection when the gold standard microscopy approach would provide a false negative.

Moreover, levels of 7SL rapidly drop with successful treatment with trypanocide drugs, demonstrating differentiation between active infection and exposure, an issue with antibody-based detection methods and potentially with DNA amplification based approaches.

Importantly, as the signal disappeared after successful treatment and when the treatment failed, the assay could identify when infection persisted. This provides potential for the development of a cheap, non-invasive and highly effective diagnostic test for trypanosomiasis.

Accordingly, a first aspect of the present invention provides a method to determine the presence of small RNA derived from the non-coding 7SL RNA of the peptide signal recognition particle, the method comprising the steps: providing a test sample with a nucleic acid probe under a condition which allows for binding wherein the probe is substantially complementary to a target sequence of small RNA from the non-coding 7SL RNA of the peptide signal recognition particle from a trypanosome selected from T. brucei, T. congolense or T. vivax detecting whether binding of the nucleic acid probe to the target sequence of small RNA from the non-coding 7SL RNA of the peptide signal recognition particle in the test sample occurs,

- wherein detecting binding of the probe to the target sequence, is indicative of the presence of trypanosome in the sample and an absence of detecting binding of the probe to the target sequence, is indicative of the absence of trypanosome in the sample.

Suitably, the nucleic acid probe may be a DNA oligonucleotide that binds through complementary base pairing to the target sequence of small RNA from the non coding 7SL RNA of the peptide signal recognition particle target nucleic acid. Suitably this small RNA is a 26 nucleotide segment of the long non-coding RNA; the latter usually described as a cytoplasmic non-coding RNA that is part of the signal recognition particle (SRP) involved in protein translocation across cell membranes. Suitably the probe has a nucleic acid sequence that has binding specificity to complementary nucleotides in a portion of the small RNA from the non-coding 7SL RNA of the peptide signal recognition particle. As would be understood in the art, binding may be by hydrogen bonding and electrostatic interactions between the probe and the portion of the small RNA from the non-coding 7SL RNA of the peptide recognition particle. Suitably, the probe may comprise a detectable label. The label may be linked to the oligonucleotide via covalent bonds, ionic bonds, Van der Waal bonds, electrostatic bonds, hydrogen bonds or the like. Suitably the nucleic acid probe may comprise a detectable label wherein the detectable label may be selected from FAM, FITC, or equivalent suitable fluorescent probe.

Suitably substantially complementary may be greater than 99% sequence complementary between the probe and the small RNA from the non-coding 7SL RNA of the peptide recognition particle. As is known in the art, complementary nucleotides are adenine binding to thymine or uracil, and guanine binding to cytosine. Suitably analogues of adenine, thymine, guanine or cytosine may be provided in the probe as would be known in the art. Percent identity refers to the percentage of nucleotides that are complementary between two sequences when compared and aligned for maximum correspondence over a comparison window, for example the length of the probe, and measured using a sequence comparison algorithm as would be known in the art, or by manual alignment and visual inspection. When using a computer programme to assess sequence identity, default parameters may be used or alternative parameters can be utilised. Suitably, the target sequence may be 26 bases in length. Suitably, the comparison window may be at least 25 bases in length. Suitably probe / primer design methods as known in the art can be used to design a suitable probe based on the knowledge of the target portion of the small RNA from the non-coding 7SL RNA. As would be known in the art, suitably a probe may be about 18-22 bp in length. Suitably a probe to target binding may have a melting temperature in the range of 52-58°C. Suitably a GC content of a probe may be 40 to 60 ^% . Suitably nucleotide sequences of a probe which may prevent formation of secondary structures, or have repeats of di nucleotides are not provided. Suitably conditions under which binding of the probe to the portion of the small RNA from the non-coding 7SL RNA may be stringent hybridisation conditions. For example, hybridisation conditions which allow the selective binding of probe nucleic acid to non-coding 7SL RNA of the peptide signal recognition particle of trypanosome in comparison to non-trypanosome organisms. Suitably hybridisation may occur at 60°C for specificity and selectivity. Suitably the method may allow for detection of both HAT and AAT. Suitably the method may allow for differentiation between species, for example between T. congolense, T. vivax, and T. brucei.

Suitably binding between the probe and the portion of the non-coding 7SL RNA may be selective hybridisation wherein hybridisation occurs at least two times more than to non-trypanosome organisms (background), at least five times more to

trypanosome organisms, in particular from a trypanosome selected from T. brucei, T. congolense or T. vivax, at least ten times more, at least 20 times more than to non- Trypansome organisms (background). Stringent conditions may be dependent on the probe and target nucleic acid sequences, but would be understood to allow the probe to bind to the target selectively in a complex mixture of nucleic acid

sequences. Generally, stringent conditions are selected to be about 5-10°C lower than the thermal melting point (T _m ) for the specific sequence at a defined ionic strength pH. The T _m is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target (non-coding 7SL RNA of the peptide signal recognition particle of trypanosome) hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at T _m , 50% of the probes are occupied at equilibrium). In embodiments stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents. For stringent hybridization, a positive signal is at least two times background, preferably 10 times background hybridization.

Suitably a probe may be provided to allow for PCR amplification of the target non coding 7SL RNA of the peptide signal recognition particle. Exemplary stringent hybridization conditions may be based on ABI TaqMan 2 x Universal Master Mix which AmpliTaq Gold DNA Polymerase, Uracil-DNA Glycolase, dNTPs with dUTP Passive Reference 1 and optimized buffer components. Suitably, the target nucleic acid sequence is from the small RNA from the non-coding 7SL RNA of the peptide signal recognition particle has a sequence selected from:

T. brucei

GGGGGCTGATCCCGCTTAGCGGGGAC - SEQ ID NO:1 T. congolense

GGGGGCCGGGTCCGCTTAGCGGGGAC - SEQ ID NO:2 T. vivax

GGGGGCCGGCGCCTGTGAGCGGGGAA - SEQ ID NO: 3 or a sequence with at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 97% sequence identity, at least 99% sequence identity to any of SEQ ID NO: 1 , SEQ ID NO: 2 or SEQ ID NO: 3. As would be known in the art, the target nucleic acid sequence from the small RNA from the non-coding 7SL RNA of the peptide signal recognition particle. Suitably, such target sequences can be identified based on position in 7SL and conserved 5’ and 3’ ends.

Suitably, the probe sequence may overlap the 3’ end of the small RNA and a reverse primer. Suitably, the reverse primer may be a set non-variable sequence that recognises a binding site in the RT primer. The RT primer can have a non-variable region forming a stem loop with a specific sequence that would recognise the small RNA. Suitably the reverse primer may recognise all three small RNAs, but the probe and forward primers may be species specific

Suitably the detection of hybridisation of the probe to the target sequence may be correlated to the infection of the animal.

Advantageously the inventors have determined the small RNA from the non-coding 7SL RNA of the peptide signal recognition particle appears to be actively secreted or excreted from the trypanosome into the blood. This provides for a higher level of the small RNA from the non-coding 7SL RNA of the peptide signal recognition particle in the blood of the animal being tested than in the parasite cell. Advantageously this may allow a sensitive assay to be provided.

Suitably, detection of binding of the probe, i.e. hybridisation of the probe and target sequence, may be by detection of a duplex of the nucleic acid probe and the target sequence, wherein the probe is substantially complementary to small RNA from the non-coding 7SL RNA of the peptide signal recognition particle. Suitably the nucleic acid probe may be immobilised, for example the probe may be a gel-immobilised nucleic acid probe.

Suitably more than one a nucleic acid probe that is substantially complementary to small RNA from the non-coding 7SL RNA of the peptide signal recognition particle from a trypanosome may be provided wherein at least a first nucleic acid probe is only capable of hybridising and specifically binding small RNA from the non-coding 7SL RNA of the peptide signal recognition particle from T. brucei under stringent conditions.

Suitably more than one a nucleic acid probe that is substantially complementary to small RNA from the non-coding 7SL RNA of the peptide signal recognition particle from a Trypanosome may be provided wherein at least a first nucleic acid probe is only capable of hybridising and specifically binding small RNA from the non-coding 7SL RNA of the peptide signal recognition particle from T. congolense under stringent conditions.

Suitably more than one a nucleic acid probe that is substantially complementary to small RNA from the non-coding 7SL RNA of the peptide signal recognition particle from a trypanosome may be provided wherein at least a first nucleic acid probe is only capable of hybridising and specifically binding to small RNA from the non coding 7SL RNA of the peptide signal recognition particle from T. vivax under stringent hybridisation conditions.

By only capable is meant that the probe selectively binds the noted species of trypanosome over other trypanosome species. For example, the probe may selectively bind a particular species of trypanosome at least twice as much as another species of trypanosome, at least five times, at least ten times as much as another species of trypanosome.

Advantageously the provision of a nucleic acid probe that is substantially complementary to small RNA from the non-coding 7SL RNA of the peptide signal recognition particle of a specific trypanosome under stringent conditions allows for the specific detection of the presence of T. brucei, T. congolense or T. vivax. Thus probes can be provided such that they provide species specific information.

Suitably a plurality of nucleic acid probes may be provided that are substantially complementary to small RNA from the non-coding 7SL RNA of the peptide signal recognition particle wherein at least a first nucleic acid probe is only capable of hybridising and specifically binding to small RNA from the non-coding 7SL RNA of the peptide signal recognition particle from T. brucei under stringent hybridisation conditions, at least a second nucleic acid probe is only capable of hybridising and specifically binding to small RNA from the non-coding 7SL RNA of the peptide signal recognition particle from T. congolense under stringent hybridisation conditions, at least a third nucleic acid probe is only capable of hybridising and specifically binding to small RNA from the non-coding 7SL RNA of the peptide signal recognition particle from T. vivax under stringent hybridisation conditions.

Suitably a nucleic acid probe of the invention may be about 15 to 40 nucleotides in length, suitably 20 to 24 nucleotides in length, suitably 20 to 30 nucleotides in length, suitably 24 to 28 nucleotides in length, suitably 15 to 20 nucleotides in length.

Suitably the test sample may be serum of an animal to be tested. Suitably the animal may be cattle. Suitably the animal may be human.

Suitably the target sequence of the small RNA from the non-coding 7SL RNA of the peptide signal recognition particle may be any one or a combination of SEQ ID NO: 1 , 2 and 3.

Probes may be synthesised chemically, for example using solid phase methods as known in the art. Suitably probes to the target sequence may be obtained from commercial suppliers as known in the art. Advantageously detection of the small RNA in the serum, for example serum of infected cattle, may be provided via a qRT-PCR assay.

Suitably in embodiments the method can comprise the steps providing a primer pair capable of binding to at least one small RNA target sequence from the non-coding 7SL RNA of the peptide signal recognition particle from a trypanosome selected from T. brucei, T. congolense or T. vivax amplifying nucleic acid bound by the primer pair detecting the amplified nucleic acid.

Suitably a primer pair may be selected which can bind to small RNA target sequence from the non-coding 7SL RNA of the peptide signal recognition particle from a trypanosome selected from T. brucei, T. congolense and T. vivax.

Suitably, at least one of a forward and reverse primer may be provided which is species specific to one of T. brucei, T. congolense or T. vivax. Suitably, only the forward primer may be species specific to one of T. brucei, T. congolense or T. vivax.

Alternatively, to allow species selective detection, a pair of primer sequences may be selected which selectively bind to a small RNA target sequence from the non-coding 7SL RNA of the peptide signal recognition particle from a trypanosome selected from T. brucei, T. congolense or T. vivax.

Suitably multiple species selective primers may be used in wherein at least a first primer pair provides an amplified nucleic acid which can be distinguished from an amplified nucleic acid provided by at least a second primer pair.

Suitably the nucleic acid probe sequences for use in the method of T. brucei detection may be against a target sRNA GGGGGCTGATCCCGCTTAGCGGGGAC with reverse and forward primers (all 5’ to 3’)

FP GGGGGGGCTGATCCCGCT RP GAGCAGCGACCGTCCT

and a probe

Probe (6-FAM) CACGATGCACCGTCCCCG(MGB)

The portion of sRNA reverse transcribed may be

RT GGTGCATCGTGAGGGAAGAGCAGCGACCGTCCTCACGATGCACCGTCCCC

Suitably the nucleic acid probe sequences for use in the method of T. congolense detection may be against a target sRNA GGGGGCCGGGTCCGCTTAGCGGGGAC with reverse and forward primers (all 5’ to 3’)

FP GGGGGGGCCGGGTCCTCT RP GAGCAGCGACCGTCCT

And a probe

Probe (6~FAM)CACGATGCACCGTCCCCG(MGB

The portion of sRNA reverse transcribed may be

RT

CCCCTGCCACGTAGCACTCCTGCCAGCGACGAGAAGGGAGTGCTACGTGG

Suitably the nucleic acid probe sequences for use in the method of T. vivax detection may be against a target

sRNA GGGGGCCGGCGCCTGTGAGCGGGGAA with reverse and forward primers (all 5’ to 3’)

FP GGGGGGGCCGGCGCCT RP GAGCAGCGACCGTCCT

and a probe

Probe (MGB) CACGATGCACCTTCCCCG(6-FAM) The portion of sRNA reverse transcribed may be

RT

GGTGCATCGTGAGGGAAGAGCAGCGACCGTCCTCACGATGCACCTTCC

CC

Suitably primers and probes (5’ to 3’) which may be provided are:

T.c & T.b RT:

GGTGCATCGTGAGGGAAGAGCAGCGACCGTCCTCACGATGCACCGTCCCC

T.b & T.c & T.v RP: GAGCAGCGACCGTCCT

T.b and T.c Probe (6-FAM)CACGATGCACCGTCCCCG(MGB)

T.v

RT: GGTGCATCGTGAGGGAAGAGCAGCGACCGTCCTCACGATGCACCTTCCCC T.v Probe: (MGB) CACGATGCACCTTCCCCG(6-FAM)

T.b FP: GGGGGGGCTGATCCCGCT

T.c FP: GGGGGGGCCGGGTCCTCT

T.v FP: GGGGGGGCCGGCGCCT

As would be understood, whilst the above example uses FAM as the reporter, other reporters, for example other fluorescent probes may be used.

In particular embodiments, custom stem-loop qRT-PCR primer probe assays may be designed wherein reverse primers contain a short sequence complementary to the target small RNA 3’ end and a longer non-variable sequence that forms a stem-loop structure. The stem-loop structure causes steric hindrance making it specific to the small RNA rather than longer precursor RNAs containing the same sequence. Following the reverse transcription (RT) reaction, a forward primer specific to the 5’ end of the target small RNA may be used in conjunction with a non-variable reverse primer that recognises a sequence in the non-variable region of the RT primer. A probe, for example provided with a fluorescent label, can be provided which is complementary to the cDNA region comprising both the small RNA sequence and the RT primer such that a fluorescent signal is generated during amplification. In embodiments both the forward primer and the probe are specific to the T. brucei, T. congolense and T. vivax small RNA sequences. Suitably the method may allow for the effective detection of the small RNA directly from serum, without the need for sample processing using a single step qRT-PCR assay.

Alternatively, methods other than RT-qPCR may be used for DNA/RNA amplification as would be understood in the art.

For example, in embodiments alternative isothermal amplification strategies as known in the art may be utilised. Suitably a LAMP assay could be optimised for the 7SL-sRNA. LAMP is based on auto-cycling strand displacement DNA synthesis in which the reaction can be processed with one type of DNA polymerase under isothermal conditions.

Alternatively, Recombinase Polymerase Amplification (RPA) developed by TwistDX may be used. Suitably a recombinase, a single-stranded DNA-binding protein and a strand-displacing polymerase may be used to amplify the target. Advantageously, this method can be carried out at low temperatures, and amplification has been shown to proceed using just body heat.

In embodiments an alternative DNA/RNA amplification methodology, for example Recombinase Polymerase Amplification, may be provided by coupling this assay to a lateral flow device or a dipstick using biotinylated primers. Suitably such coupling allows the target to be visualised by eye, thereby bypassing the need for thermocycler or real-time fluorescence detection Whilst RPA typically requires targets consisting of >30 bp, this technology has recently been adapted to the detection of miRNAs by ligating highly specific probes to the miRNA using a PBCV-1 ligase.

Advantageously, the RNA can be detected before microscopy detection of parasitaemia in the blood, and during remission periods of infection when no parasitaemia is detectable. However, RNA levels rapidly drop following treatment with trypanocides, demonstrating accurate prediction of active infection. Advantageously following post- curative treatment, the levels of the 7SL sRNA rapidly drops to undetectable levels.

Small RNA sequence is conserved between different species of trypanosome. However, nucleotide differences within the sequence allow generation of highly specific assays that can distinguish between infections with Trypanosoma brucei , Trypanosoma congolense and Trypanosoma vivax.

Based on the target sequences

T brucei

GGGGGCTGATCCCGCTTAGCGGGGAC T congolense

GGGGGCCGGGTCCGCTTAGCGGGGAC T. vivax

GGGGGCCGGCGCCTGTGAGCGGGGAA it has been demonstrated by the inventors that species selectivity can be achieved.

According to a further aspect of the present invention there is a method of monitoring disease progression of Human African Trypanosomiasis (HAT) and Animal African Trypanosomiasis (AAT) in an animal the method comprising the steps:

providing a test sample from a first time point with a nucleic acid probe that is substantially complementary to small RNA from the non-coding 7SL RNA of the peptide signal recognition particle from a trypanosome selected from T brucei, T congolense or T vivax under hybridisation conditions detecting hybridisation of the nucleic acid probe to small RNA from the non coding 7SL RNA of the peptide signal recognition particle in the test sample

- wherein detection of hybridisation is indicative of the presence of trypanosome in the sample from the first time point, providing a test sample from at least a second time point with a nucleic acid probe that is substantially complementary to small RNA from the non-coding 7SL RNA of the peptide signal recognition particle from a trypanosome selected from T brucei, T congolense or T vivax under hybridisation conditions detecting hybridisation of the nucleic acid probe to small RNA from the non coding 7SL RNA of the peptide signal recognition particle in the test sample

- wherein detection of hybridisation is indicative of the presence of Trypanosome in the animal from the second time point.

Suitably the value of detection at the first and second time point may be compared. Suitably the detection value at a time point may be correlated to the level of infection in an animal from which a first and second sample has been provided an indication of the infection statue of the animal can be provided.

According to a further aspect of the present invention there is provided a method to optimise therapeutic treatment regimens (chemotherapeutics) for the treatment of Human African Trypanosomiasis (HAT) and Animal African Trypanosomiasis (AAT) in an animal the method comprising the steps:

providing a test sample from a first time point with a nucleic acid probe that is substantially complementary to small RNA from the non-coding 7SL RNA of the peptide signal recognition particle from a trypanosome selected from T. brucei, T. congolense or T. vivax under hybridisation conditions detecting hybridisation of the nucleic acid probe to small RNA from the non coding 7SL RNA of the peptide signal recognition particle in the test sample

- wherein detection of hybridisation is indicative of the presence of trypanosome in the sample from the first time point, providing a test sample from at least a second time point after treatment has been provided with a nucleic acid probe that is substantially complementary to small RNA from the non-coding 7SL RNA of the peptide signal recognition particle from a trypanosome selected from T. brucei, T. congolense or T. vivax under hybridisation conditions detecting hybridisation of the nucleic acid probe to small RNA from the non coding 7SL RNA of the peptide signal recognition particle in the test sample from at least a second time point after treatment has been provided - wherein comparison of the results of the detecting step from the sample at the first and at least second time point allows a determination as to the efficacy of the treatment.

This is advantageous as it allows therapeutics, for example chemotherapeutics which require their efficacy to be accurately measured during clinical trials to be assessed.

Suitably the method of the present invention may be undertaken on samples from animals including humans. It is considered that the sequences used in the methods of the present invention do not change according to host. In embodiments a sample for use in a method of the invention may be obtained from bovine, equine, camel or human subjects. Suitably the method may be used for samples for equines for Trypanosoma brucei equiperdum detection. Suitably this may be provided as a detection surveillance system to monitor importing and transport of equines between and within countries. Suitably the method may be used to monitor Trypanosoma vivax and Trypanosoma brucei evansi in cattle, for example as part of a veterinary surveillance programme in countries effected by Trypanosoma, for example Brazil.

Suitably the methods of the present invention may be undertaken using a laboratory- based assay (qPCR).

According a further aspect of the present invention there is provided a kit comprising a probe for use in the methods of the invention wherein the probe comprises a nucleic acid that is capable of selectively binding to a target sequence selected from any of

T brucei

GGGGGCTGATCCCGCTTAGCGGGGAC

T congolense

GGGGGCCGGGTCCGCTTAGCGGGGAC

T vivax

GGGGGCCGGCGCCTGTGAGCGGGGAA Suitably, the probe may comprise a nucleic acid that is capable of selectively binding to any one target sequence selected from

T. brucei

GGGGGCTGATCCCGCTTAGCGGGGAC T. congolense

GGGGGCCGGGTCCGCTTAGCGGGGAC T. vivax

GGGGGCCGGCGCCTGTGAGCGGGGAA

Suitably the nucleic acid probe may be about 15 to 40 nucleotides in length, suitably 20 to 30 nucleotides in length, suitably 20 to 24 nucleotides, suitably 24 to 28 nucleotides in length, suitably 15 to 20, suitably 15 nucleotides in length.

Suitably the probe may be immobilised. Suitably the probe is immobilised in gel.

Suitably, the probe may be

reverse and forward primers (all 5’ to 3’)

FP GGGGGGGCTGATCCCGCT RP GAGCAGCGACCGTCCT

or

reverse and forward primers (all 5’ to 3’)

FP GGGGGGGCCGGGTCCTCT RP GAGCAGCGACCGTCCT

or reverse and forward primers (all 5’ to 3’)

FP GGGGGGGCCGGCGCCT RP GAGCAGCGACCGTCCT Suitably primers and probes (5’ to 3’) which may be provided are:

T.c & T.b RT:

GGTGCATCGTGAGGGAAGAGCAGCGACCGTCCTCACGATGCACCGTCCCC

T.b & T.c & T.v RP: GAGCAGCGACCGTCCT

T.b and T.c Probe (6-FAM)CACGATGCACCGTCCCCG(MGB)

T.v

RT: GGTGCATCGTGAGGGAAGAGCAGCGACCGTCCTCACGATGCACCTTCCCC T.v Probe: (MGB) CACGATGCACCTTCCCCG(6-FAM)

T.b FP: GGGGGGGCTGATCCCGCT

T.c FP: GGGGGGGCCGGGTCCTCT

T.v FP: GGGGGGGCCGGCGCCT

Embodiments of the present invention will now be described by way of example only with reference to the accompanying figures in which:

Figure 1 shows small RNA derived from non-coding 7SL RNA is detected at high levels in the serum of T. congolense infected cattle: A) Read counts normalised by RPM of the ten most abundant small RNAs detected in T. congolense-infected serum (small RNA1 in Figure being the 7SL-sRNA). B) Visualisation of the location of the 7SL-sRNA identified at high abundance in infected serum. The panels below show read alignments of the 26-bp sequence in two serum samples from infected cattle, as well as read count from an in vitro-derived T. congolense cell pellet and an uninfected serum control, in the form of histograms. C) The predicted secondary structure of the T. congolense 7SL RNA, with the 7SL-sRNA highlighted in bold. Figure 2 shows 7SL sRNA conservation across trypanosome species with variable sequences, wherein (A) Bioinformatic studies identified 7SL sRNA sequences present in trypanosome species, with several nucleotide differences which were utilised in designing Taqman qRT-PCR assays that showed species specificity (b) Shows qRT-PCR results from samples selected from time points where equal parasitaemia scores had been determined and tested for each of the 3 trypanosome species, demonstrating the ability to develop species-specific qRT-PCR. Note that the T. brucei assay also enables the detection of the 7SL sRNA from Trypanosoma brucei gambiense (the main causative agent of Human African Trypanosomiasis). Figure 3 shows 7-SL sRNA expression relative to infection in untreated T.b brucei infected calves wherein six calves were infected with T.b brucei and parasitaemia determined every 2 days on average for a minimum of 6 days and a maximum of 28 days, as well as serum samples collected for RNA extraction. Parasitaemia scores were determined by microscopy and are plotted as bar graphs on the right y-axis. RNA was extracted from serum and 100ng used for RT reaction in a total of 15mI and 2mI of that then used for qPCR to determine 7-SL sRNA expression which is plotted as line graph on the left y-axis. * represents day when animal was euthanised.

Figure 4 shows 7-SL sRNA expression relative to infection in treated T. congolense infected calves. Animals were infected with T. congolense KONT2/133 and parasitaemia determined every 2 days on average. Serum samples were collected for RNA extraction. Parasitaemia scores were determined by microscopy and are plotted as bar graphs on the right y-axis. RNA was extracted from serum and 100ng used for RT reaction in a total of 15mI and 2mI of that then used for qPCR to determine 7-SL sRNA expression which is plotted as line graph on the left y-axis. Green star represents day when animal was treated with a rescue drug (isometamidium (1 mg/kg) or diminazene (7 mg/kg)) and red star represents when test drug was administered.

Figure 5 shows 7-SL sRNA expression relative to infection in treated T. vivax infected calves Animals were infected with T. vivax STIB 719 and parasitaemia determined every 2 days on average. Serum samples were collected for RNA extraction. Parasitaemia scores were determined by microscopy and are plotted as bar graphs on the right y-axis. RNA was extracted from serum and 100ng used for RT reaction in a total of 15mI and 2mI of that then used for qPCR to determine 7-SL sRNA expression which is plotted as line graph on the left y-axis. Green star represents day when animal was treated with a rescue drug (isometamidium (1 mg/kg) or diminazene (7 mg/kg)) and red star represents when test drug was administered.

Figure 6 shows serum as a substrate and 1 step assay wherein a) 6 mI of heat treated (60°C for 15 minutes) serum from cattle infected with T. congolense and T. brucei was used directly for the qRT-PCR assay b) Serum from a T. brucei infected cow was used for the qRT-PCR reaction using a one-step TaqMan assay to determine the expression of 7SL-sRNA (left y-axis) and compared to the parasitaemia as determined by microscopy (right y-axis). Figure 7 shows example methodology of providing RNA and testing for the presence of target RNA which can bind to a probe - Nucleic Acids Res. 2005; 33(20):

e179. Published online 2005 Nov 27. doi: [10 _: 1093/nar/jan j 178J .

Figure 8: - 7SL-sRNA abundance is correlated to cell density in cultured

trypanosome supernatants - shows time course of in vitro cultures. Cell density of in vitro cultures of T. brucei (A) and T. congolense (B) was monitored over time and supernatant samples were simultaneously isolated for 7SL-sRNA detection. Relative levels of the sRNA, normalized to the 0 hour time-point control, were observed to increase as cell density increased. Statistical significance of correlation between cell density and relative Ct value was calculated by Spearman Rank correlation and Pearson’s product moment correlation.

Examples

RNA deep sequencing

Libraries were prepared using the TruSeq Small RNA library preparation kit (lllumina) with 10 pL total RNA as starting material (approximately 50 ng - 1.66 pg). Samples were enriched using 15 cycles of PCR and library products of 145-160 bp were gel purified, quantified and pooled for sequencing. The library pool was sequenced using an lllumina® HiSeq 2500 with 50-base single end reads and V4 chemistry.

In vivo infections with drug treatments

Drug studies were carried out in collaboration with GALVmed/ClinVet testing for a drug product (CC0478956). Experimental animals were infected, 21 with T. vivax (STIB 719) and 21 with T. congolense (KONT 2/133), with approximately 100,000 fresh blood viable parasites intravenously via the jugular vein. Animals were divided into control (3 animals) and experimental groups (18 animals, sub-grouped into 3 groups of 6). The control group was treated with saline and the 3 sample groups of experimental animals were treated at different dosages of the drug (CC0478956) which was administered intramuscularly. A rescue treatment was administered for both control and experimental animals, when clinically justified and as agreed by stakeholders, in the form of isometamidium (1 mg/kg) or diminazene (7 mg/kg). Infection levels were determined by microscopy every 2 to 3 days and serum samples were collected for from RNA extraction and 7SL-sRNA expression determination.

RNA extraction

RNA extractions were conducted using the TRIzol™ LS reagent (Invitrogen) following the manufacturer’s instructions. 250 pl_ of starting material, serum and culture supernatants for in vivo and in vitro samples respectively, was used. Where the sample was less than 250 mI_, water was added to make up the volume. For in vivo samples received from GALVmed/Clinvet, RNA was extracted from 125 mI_ of plasma with distilled water added to make up the volume to 250 mI_. In cases where in vitro culture supernatants were used for RNA extraction, 500 mI_ supernatant was centrifuged at 2,000 ^c g for 10 minutes to remove cells from the medium.

Subsequently, 250 mI_ supernatant was used for downstream experiments. qRT-PCR

The species-specific 7SL small RNA primer-probe detection assays for T. brucei, T. congolense and T. vivax were generated based on the sequences

T. brucei GGGGGCTGATCCCGCTTAGCGGGGAC T. congolense

GGGGGCCGGGTCCGCTTAGCGGGGAC T. vivax

GGGGGCCGGCGCCTGTGAGCGGGGAA

Reverse transcription was carried out in a total volume of 15 mI_, using a High Capacity cDNA Reverse Transcription Kit (Applied Biosciences, cat. number: 4368814). In vivo samples from the aforementioned GALVmed trial were isolated from heparinised blood and required 2 units of Bacteroides Heparinase 1 (New England BioLabs, cat. Number: P0735) per RT reaction. A total of 100 ng of RNA was used per reaction with the following thermocycling conditions: 16°C for 30 minutes, 42°C for 30 minutes and 85°C for 5 minutes. Subsequently, 1.5 pl_ of the cDNA was transferred to a qPCR reaction (TaqMan universal PCR master mix, cat. number: 4368814). Reactions were set up as per manufacturer’s protocols with a total reaction mixture of 20 mI_ and a cycling profile of 50 ^° C for 2 minutes followed by 95°C for 10 minutes and 40 cycles of 95°C for 15 seconds and a probe detection step of 60°C for 1 minute. When serum was used a substrate for qRT-PCR, samples were heat treated at 65°C for 15 minutes.

Small RNA derived from the non-coding 7SL is detected at high levels in the serum of infected cattle

To test whether trypanosomes secrete or excrete small RNAs during in vivo infections, serum samples were obtained from two cattle infected with the livestock trypanosome T. congolense, as well as an uninfected control and an in wfro-derived cell pellet. RNA extracted from these samples was submitted for RNA deep sequencing as described herein, and the resulting dataset was filtered for reads of specific length between 20- and 30-bp long, which were subsequently aligned to the T. congolense genome (TriTrypDB v9.0).

A total of 15,645,557 and 16,770,619 reads were obtained for the infected samples, of which 4.2% and 1.3% were uniquely mapped to the T. congolense genome respectively. In contrast, 6,290,490 reads were obtained from the uninfected sample, with 0.0% (1 ,804 reads) aligning uniquely to the T. congolense genome. Subsequent analysis showed that the majority of these reads aligned to ribosomal RNA (rRNA) loci in the genome (as shown in Figure 1) the sequences of which are known to be deeply conserved.

For this reason, rRNA alignments were omitted from downstream analyses as they did not exhibit potential as molecular diagnostics. 9,439,764 reads were generated from RNAseq of the cell pellet sample, with 11.5% and 58.9% unique and multimapped reads respectively.

Read counts were next obtained using HTSeq-count, resulting in total read counts of 42,302, 18,230, 322,385 and 524 for the two infected, cell pellet and uninfected samples, respectively. Normalisation was carried out by correcting for gene/exon length as well as library depth (transcripts per million; TPM). Surprisingly, the majority of reads from the infected samples originated from one specific 26-bp sequence (Figure 1).

The abundance of this small RNA specific sequence and the next most abundant small RNA observed in infected serum, as well as uninfected and cell pellet controls, is illustrated in Figure 1a. Further analyses indicated that the sRNA was uniquely mapped to a single copy locus on chromosome 8 (Figure 1 b). Specifically, the sRNA formed part of the 176-bp 7SL RNA gene (SRP RNA, T. congolense Gene ID: TclL3000_8_ncRNA004-1 ; T. brucei Gene ID: Tb927.8.2861), and was therefore termed“7SL-sRNA”. The full secondary structure of the 7SL RNA is shown in Figure 1c. Notably, part of the 7SL-sRNA is bound to a passenger strand which was also detected, but at much lower abundance in infected serum.

In vitro supernatants were assayed to confirm that the 7SL-sRNA was of trypanosomal origin (Figure 2). Time course analysis of both T. b. brucei and T. congolense culture supernatants showed that the RNA could be readily detected by RT-qPCR after a short period of incubation and strikingly, abundance of the RNA was shown to increase in a cell density dependent fashion, suggesting that the 7SL- sRNA is constitutively secreted/excreted. Moreover, the RNA could also be detected from cells incubated over a short period of time in culture medium lacking serum.

RT-PCR assay against 7SL small RNA is highly sensitive and species-specific

Further sequence analysis of 7SL-sRNA was carried out using the publicly available TriTrypDB genome assemblies of several species of African trypanosome (Figure 2a). Whilst no sequence variation was observed in any of the T. brucei subspecies (specifically T. b. brucei, T. b. gambiense, T. b. rhodesiense and T. b. evansi), there were several nucleotide polymorphisms in both the T. vivax and T. congolense sequences (Figure 2a), raising the possibility to distinguish between the 3 primary livestock trypanosomiasis-causing species (Figure 2a). To investigate this further, primers were developed for each individual species and RT-qPCR experiments performed. Each primer set was applied to samples from each species to test for cross-reactivity. As illustrated in Figure 2b sequence diversity of the 7SL-sRNA is sufficient to enable differentiation between T. vivax, T. congolense and T. brucei without cross-reaction, demonstrating the potential of this RNA as a target sequence for molecular diagnostics in livestock trypanosomiasis, where host mammals remain susceptible to all 3 species, and drug regimens are species-specific. However, the lack of variation between the T. brucei subspecies means differentiation between T. b. gambiense and T. b. rhodesiense are impossible with the 7SL-sRNA, and indeed the T. brucei assay detected T. b. gambiense 7SL-sRNA with equal efficiency to T. b. brucei (Figure 2b).

7SL-sRNA is detectable before onset of parasitaemia is detectable by microscopy and during remission phase

To further investigate the suitability of the 7SL-sRNA as a diagnostic for monitoring disease progression, serum samples were obtained from an in vivo study of six calves experimentally infected with T. b. brucei, which remained untreated for the duration of infection. The disease progression was monitored over a time period ranging from six to 28 days depending on the severity of infection and day of euthanasia, and parasitaemia score was determined by microscopy approximately every two days (Figure 3). RNA extractions were carried out on serum samples as described in the methods, and resulting RNA samples were analysed by RT-qPCR. Levels of 7SL-sRNA were normalised to signal from day 0 samples.

Parasites were typically detected in blood by microscopy after 4 days (Figure 3). In contrast, the 7SL-sRNA was pre-emptively detected by day 2, suggesting higher sensitivity and a lower cell number detection threshold compared to microscopy. Furthermore, following the first wave of parasitaemia, parasites were cleared from the blood, or migrated elsewhere, yet the 7SL-sRNA was still detectable during this time. Notably, whilst signal was still several orders of magnitude higher than in the day 0 sample, the abundance of 7SL-sRNA seemed to decrease somewhat after the first parasitaemia wave, as exemplified by animals 6630 and 6640.

Interestingly, microscopy data suggested that animal 6630 remained uninfected after day 16 (Figure 3), when no further parasites were detected. However, 7SL-sRNA abundance remained high, suggesting that this animal was suffering from a chronic stage of disease. Whilst microscopy would result in a false negative diagnosis, the RT-qPCR clearly remains highly sensitive, with a lower detection threshold than microscopy. However, the result could also indicate that the RNA is highly stable in the bloodstream and remains detectable after the infection has been cleared. To investigate this further, the inventors next focused our attention on animals undergoing treatment. Monitoring in vitro 7SL-sRNA excretion/secretion

For the 7SL-sRNA to be a suitable target for development of molecular diagnostics, there is a requirement that the sRNA is constitutively released into the bloodstream, rather than only under certain conditions such as cellular stress, as has recently been shown with, for example, the spliced leader RNA. To investigate this, time courses lasting 3 days (72 hours) were carried out using in vitro cultures of both T. brucei (Lister 427) and T. congolense (IL3000). Cells were seeded at 5 x 10 ⁴ cells/mL, and density was periodically counted by haemocytometer and supernatant samples were taken simultaneously for qRT-PCR analysis (Fig.8). By the first time- point, the small RNA was readily detected in both T. brucei (Fig. 3A) and T. congolense (Fig. 3B) supernatants (mean cell densities: T. brucei, 2.37 x 10 ⁵ cells/mL; T. congolense, 3.5 x 10 ⁴ cells/mL). Furthermore, relative 7SL-sRNA levels appeared to increase correlating with cell density (T. brucei: Pearson = 0.7724, Spearman p = 0.9643; T. congolense: Pearson = 0.9353, Spearman p = 0.9643). For example, levels did not increase further when T. brucei cultures had reached maximum density (Fig. 3A). Taken together, these data indicate that the 7SL-sRNA is constitutively released by both species of parasite, and indeed, relative abundance of the sRNA can give an indication of cell density in parasite cultures. Interestingly, when 7SL-sRNA levels were corrected for cell number and directly compared, levels of 7SL-sRNA accumulated more rapidly in T. congolense than T. brucei cultures, suggesting there may be species-specific kinetics of extracellular production (Fig. 3C).

7SL-sRNA is detected before parasitaemia is detectable by microscopy and during remission phase

To further investigate the suitability of the 7SL-sRNA as a diagnostic for monitoring disease progression, serum samples were obtained from an in vivo study of six calves experimentally infected with 1 ^c 106 T. brucei AnTat 1.1 , which remained untreated for the duration of infection. The infection time courses ranged from six to 28 days depending on the severity of infection and day of euthanasia, and

parasitaemia score was determined by microscopy approximately every two days. Total RNA was extracted from serum samples and analysed by RT-qPCR. The relative expression of 7SL-sRNA was calculated relative to the zero hour time point. Parasites were typically detected in blood by microscopy after 4 days. In contrast, the 7SL-sRNA was detected by day 2, suggesting higher sensitivity compared to microscopy. Furthermore, following the first peak of parasitaemia, parasites became subpatent by microscopy, yet the 7SL-sRNA was still detectable at high levels during this time (animals 6630 and 6632). Interestingly, data indicated that parasitaemia in animal 6630 remained undetectable by microscopy after day 16 (Fig 3), when no further parasites were detected until infections were terminated at day 28. However, 7SL-sRNA remained detectable, suggesting that this animal was suffering from a chronic stage of disease. Therefore, microscopy resulted in a false negative diagnosis but the RT-qPCR clearly remained sensitive, with a lower detection threshold than microscopy. However, the result could also indicate that the RNA is stable in the bloodstream and remains detectable after live parasites have been cleared. To investigate this further, we next focused our attention on animals undergoing treatment.

Detection of 7SL small RNA accurately predicts active infection and parasite clearance

Monitoring of disease progression is a vital aspect of treatment as well as the development of optimised chemotherapeutics which require their efficacy to be accurately measured during clinical trials. The inventors have used a 7SL-sRNA RT- qPCR assay of the invention on samples obtained from clinical trials carried out on cattle experimentally infected with T. congolense (Figure 4) or T. vivax (Figure 5). The objectives of this study were primarily to test how the assay would compare with other measurements of disease progression like microscopy, and furthermore to evaluate whether the 7SL-sRNA remains present in the bloodstream when an infection is cleared.

In the first clinical trial, 21 cattle were challenged with T. congolense (KONT 2/133), and subsequently divided into four groups depending on a treatment regimen. Parasitaemia scores were measured by microscopy every two to three days and plasma samples were obtained for downstream analyses at longer intervals. RT- qPCR analyses were carried out on RNA extractions from the aforementioned plasma samples as in previous experiments and cycling data was normalised to the day 0 time-points. In all 21 cases, an initial wave of parasitaemia was observed by microscopy after ~5 days. Whilst no plasma samples were made available between day 0 and day 8, 7SL-sRNA was detected at the first time-point in all cattle (Figure 4). Upon experimental treatment of the cattle, there was a marked decrease in parasitaemia as determined by microscopy, which was mirrored by 7SL-sRNA detection assays carried out at the nearest time-points post-treatment (Figure 4). This observation was exemplified by animals 519 and 549, where plasma sampled just one day after treatment was completely devoid of 7SL-sRNA, as well as blood-borne parasites (Figure 4). Indeed, 7SL-sRNA was rarely detected after treatment for the duration of the trial.

In one case (549), 7SL-sRNA was detected after 40 days, suggesting a relapse. Almost 15 days later, live trypanosomes were observed by microscopy, after which the infection was once again cleared (Figure 4).

Importantly, these results indicate that 7SL-sRNA is short-lived in vivo, as successful drug treatment rapidly leads to the abolishment of signal, suggesting live infections are required to sustain the high abundance of the RNA. This further highlights the potential of 7SL-sRNA as a diagnostic for active trypanosome infections, rather than historical infections.

Samples from a second clinical trial involving 21 cattle experimentally infected with T. vivax (STIB 719) were also tested using the T. wVax-specific RT-qPCR assay (Figure 5). As with the T. congolense study, parasitaemia was measured every 2-3 days, and plasma samples were obtained more sporadically over a period of 85 days post-infection. Treatment was administered after peak parasitaemia was observed by microscopy, typically after ~14 days. For the T. vivax trials, rescue treatment was administered if the trial compound failed.

Analysis of T. vivax 7SL-sRNA showed much more variability compared to that observed in T. congolense infection, potentially due to the efficacy of the compound (fig. 5). However, detection was rapid, and once again mirrored parasitaemia observed by microscopy in the majority of cases. In most cattle, T. vivax was cleared rapidly post-treatment (exemplified by animals 515, 520, 522, 532, 544, 496, 511 and 538), and the 7SL-sRNA signal was lost after approximately 20 days.

In several cases, the presence of 7SL-sRNA was detected in time points where no parasites were observed by microscopy, suggesting that the RT-qPCR assay exhibited increased sensitivity compared to conventional microscopy diagnostic methods. In these cases, such as animals 498, 524 and 527, 7SL-sRNA appeared to indicate cyclical changes in parasitaemia commonly associated with trypanosomatid infections (Figure 5).

The above theory was further strengthened when investigating several animals that suffered from relapse of infection due to treatment failure (in particular, animals 502, 543 and 550) (Figure 5). In animal 543, 7SL-sRNA was observed to become increasingly abundant after day 30, without a corresponding increase in parasitaemia. Parasites were finally observed by microscopy on day 55, more than 3 weeks later. Therefore, by RT-qPCR analysis of a highly abundant secretory/excretory RNA, infection status was confirmed far more rapidly than by microscopy. Further analysis must be carried out with time courses and more frequent sampling of host serum then determine the time between infection and detection.

7SL-sRNA is detected directly from serum with one-step RT-qPCR assay

For use in the field, it would be advantageous if RNA could be detected directly from serum samples (Figure 6).

For serum samples from both T. congolense and T. b. b ce/-infected cattle, one- step RT-qPCR reactions were set-up with varying volumes of serum ranging from 2 pL to 10 pL in a 15 pL reaction. Serum was heated for 5 minutes at 65°C to dissociate the RNA from any potential binding protein complexes, and the RT-qPCR subsequently proceeded as indicated in the methods.

For both T. bruce i and T. congolense, 7SL-sRNA was readily detected directly from serum at all volumes tested (Figure 6).

Whilst this study was able to utilise samples from multiple experimental animal trials, human blood or CSF samples that would be suitable for testing could not be identified, although the inventors hypothesise the 7SL-sRNA would also be present at similar levels in these types of clinical samples in human patients. The inventors tested culture supernatant from T. b. gambiense (ELIAN E) grown in vitro, and the level of signal was the same as observed with T. b. brucei (Figure 2B). Developing a diagnostic for HAT that is able to detect both T. b. gambiense and T. b. rhodesiense would be greatly beneficial, as currently there is no molecular test that is widely used in the field for T. b. rhoesiense diagnosis [3]

Whilst the 7SL-sRNA is detectable using conventional laboratory RT-PCR machines, it is envisaged that the assays would be modified for use in the field, i.e. adapt the assays (e.g. to the loop mediated isothermal amplification (LAMP) platform; to be field applicable. Field-applicable diagnostic techniques that could be adapted to detect 7SL-sRNA are known in the art from detection of MiRNAs in cancer.

Alternative platforms suitable for small RNA detection, may be the LAMP assay, which has been previously developed for all three livestock trypanosome species based on gDNA targets and for which a test intended for field application was developed for HAT and has been shown to be suitable for application to small RNA as an assay substrate and therefore could potentially be optimised to develop a field- applicable 7SL-sRNA assay. Another recently developed method, Recombinase Polymerase Amplification exhibits potential as an extremely sensitive detection method, even surpassing the aforementioned LAMP assay. This process requires a reaction consisting of a recombinase, a single-stranded DNA-binding protein and a strand-displacing polymerase to amplify the target. Importantly, this method can be carried out at low temperatures, and amplification has been shown to proceed using just body heat. By coupling this assay to a lateral flow device or a dipstick using biotinylated primers, the target can be visualised by eye, thereby bypassing the need for thermocycler or real-time fluorescence detection. Whilst RPA typically requires targets consisting of >30 bp, this technology has recently been adapted to the detection of miRNAs by ligating highly specific probes to the miRNA using a PBCV-1 ligase.