Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
METABOLICALLY ENHANCED PHOTOAUTOTROPHIC ETHANOL PRODUCING HOST CELLS, METHOD FOR PRODUCING THE HOST CELLS, CONSTRUCTS FOR THE TRANSFORMATION OF THE HOST CELLS, AND METHOD OF PRODUCING ETHANOL USING THE HOST CELLS
Document Type and Number:
WIPO Patent Application WO/2011/018116
Kind Code:
A1
Abstract:
One embodiment of the invention provides a metabolically enhanced photoautotrophic, ethanol producing host cell comprising: at least two first metabolic enhancements reducing the enzymatic activity or affinity of at least two endogenous host cell enzymes involved in acetate and lactate fermentation, the first metabolic enhancements resulting in an enhanced level of biosynthesis of acetaldehyde, pyruvate, acetyl-CoA or precursors thereof compared to the respective wild type host cell, at least one second metabolic enhancement different from the first metabolic enhancement comprising an overexpressed enzyme for the formation of ethanol.

Inventors:
BAIER KERSTIN (DE)
DUEHRING ULF (DE)
OESTERHELT CHRISTINE (DE)
ZIEGLER KARL (DE)
ENKE HEIKE (DE)
Application Number:
PCT/EP2009/060526
Publication Date:
February 17, 2011
Filing Date:
August 13, 2009
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
ALGENOL BIOFUELS INC (US)
BAIER KERSTIN (DE)
DUEHRING ULF (DE)
OESTERHELT CHRISTINE (DE)
ZIEGLER KARL (DE)
ENKE HEIKE (DE)
International Classes:
C12N9/04; C12N9/10; C12N9/12; C12N9/88; C12P7/06
Domestic Patent References:
WO2009062190A22009-05-14
WO1998039457A11998-09-11
Other References:
PENGCHENG FU: "Genome-scale modeling of Synechocystis sp. PCC 6803 and prediction of pathway insertion", JOURNAL OF CHEMICAL TECHNOLOGY & BIOTECHNOLOGY, vol. 84, 16 October 2008 (2008-10-16), pages 473 - 483, XP002579652, DOI: 10.1002/jctb.2065
JASON DEXTER AND PENGCHENG FU: "Metabolic engineering of cyanobacteria for ethanol production", ENERGY ENVIRON. SCI.,, vol. 2, 10 June 2009 (2009-06-10), pages 857 - 864, XP002579653, DOI: DOI: 10.1039/b811937f
See also references of EP 2464726A1
"Molecular Cloning: A Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY PRESS
"Current Protocols in Microbiology", 2007, JOHN WILEY AND SONS, INC.
"The Molecular Biology of Cyanobacteria", 1994, SPRINGER NETHERLANDS
"The cyanobacteria, molecular Biology, Genomics and Evolution", 2008, ACADEMIC PRESS
"Fermentative Metabolism of Chlamydomonas reinhardtii", PLANT PSYCHOLOGY, vol. 75, 1984, pages 212 - 218
Attorney, Agent or Firm:
EPPING HERMAN FISCHER PATENTANWALTSGESELLSCHAFT MBH (München, DE)
Download PDF:
Claims:
Claims (We claim)

1. Metabolically enhanced photoautotrophic, ethanol

producing host cell comprising:

- at least two first metabolic enhancements reducing the enzymatic activity or affinity of at least two

endogenous host cell enzymes involved in acetate and lactate fermentation,

the first metabolic enhancements resulting in an

enhanced level of biosynthesis of acetaldehyde,

pyruvate, acetyl-CoA or precursors thereof compared to the respective wild type host cell,

at least one second metabolic enhancement different from the first metabolic enhancement comprising an

overexpressed enzyme for the formation of ethanol.

2. Metabolically enhanced host cell according to claim 1, wherein

- the at least two endogenous host cell enzymes are

lactate dehydrogenase and an enzyme selected from phosphotransacetylase and acetate kinase.

3. Metabolically enhanced host cell according to the previous claims, wherein the enzymes are lactate

dehydrogenase, phosphotransacetylase and acetate kinase.

4. Metabolically enhanced host cell according to the

previous claims, wherein the reduction of activity is the result of at least one disruption of a gene encoding at least one of the endogenous host cell enzymes.

5. Metabolically enhanced host cell according to the

previous claim, wherein at least one of the gene disruptions is caused by insertion of a biocide

resistance gene into the respective gene.

6. Metabolically enhanced host cell according to any of the previous claims, wherein

- at least one of the first metabolic enhancements

comprises the transcription of an antisense mRNA

molecule that binds to the mRNA encoding at least one of the endogenous host cell enzymes, wherein binding results in a reduction of activity of the endogenous host cell enzyme.

7. Metabolically enhanced host cell according to any of the preceding claims, wherein

- the at least one overexpressed enzyme for the formation of ethanol is an alcohol dehydrogenase enzyme.

8. Metabolically enhanced host cell according to the

previous claim, wherein

- the alcohol dehydrogenase enzyme is an alcohol

dehydrogenase enzyme having at least 60% or 70%, preferably 80% most preferred 90% sequence identity to the amino acid sequence of Synechocystis Adh shown in Fig. 42.

9. Metabolically enhanced host cell according to claim 7, wherein

the alcohol dehydrogenase is AdhE directly converting acetyl-CoA to ethanol.

10. Metabolically enhanced host cell according to any of the previous claims, wherein - the alcohol dehydrogenase enzyme is a Zn2+-dependent dehydrogenase .

11. Metabolically enhanced host cell according to any of the claims 7 to 10, further comprising

- a pyruvate decarboxylase enzyme converting pyruvate to acetaldehyde, wherein

- the alcohol dehydrogenase enzyme converts the

acetaldehyde to ethanol.

12. Metabolically enhanced host cell according to any of the claims 1 to 6, wherein

the only second metabolic enhancement is a pyruvate decarboxylase enzyme.

13. Metabolically enhanced host cell according to any of the previous claims, further comprising

- at least one endogenous alcohol dehydrogenase enzyme. 14. Metabolically enhanced host cell according to any of the previous claims, wherein the gene encoding the at least one overexpressed enzyme for the formation of ethanol is under the transcriptional control of a promoter endogenous to the host cell.

15. Metabolically enhanced host cell according to claim

14. wherein the gene encoding the at least one

overexpressed enzyme for the formation of ethanol is under the transcriptional control of a heterologous promoter.

16. Metabolically enhanced host cell according to the claims 14 or 15, wherein the gene encoding the at least one overexpressed enzyme for the formation of ethanol is under the transcriptional control of an inducible

promoter .

17. Metabolically enhanced host cell according to the previous claim, wherein the inducible promoter is induced under conditions of nutrient starvation, by stationary growth phase, by heat shock, by cold shock, by oxidative stress, by salt stress, by light or by darkness. 18. Metabolically enhanced host cell according to any of the claims 16 or 17, wherein the promoters are selected from a group consisting of:

- rbcLS, ntcA, nblA, isiA, petJ, petE, sigB, lrtA, htpG, hspA, clpBl, hliB, ggpS, psbA2, psaA, nirA and crhC.

19. Metabolically enhanced photoautotrophic, ethanol producing host cell comprising:

at least two first metabolic enhancements reducing the enzymatic activity or affinity of at least two

endogenous host cell enzymes involved in acetate and lactate fermentation,

at least one second metabolic enhancement different from the at least two first metabolic enhancements comprising an overexpressed enzyme for the formation of ethanol,

- the first and second metabolic enhancements resulting in an increased rate of ethanol production compared to the respective photoautotrophic, ethanol producing host cell harboring the second metabolic enhancement but lacking the first metabolic enhancements.

20. Metabolically enhanced host cell according to the previous claim, wherein the at least two endogenous host cell enzymes are lactate dehydrogenase and an enzyme selected from

phosphotransacetylase and acetate kinase. 21. Metabolically enhanced photoautotrophic, ethanol producing host cell according to any of the claims 1 to 20, wherein

- the host cell is an aquatic organism. 22. Metabolically enhanced host cell according to the previous claim, wherein

- the host cell is selected from a group consisting of: algae, protists, and bacteria. 23. Metabolically enhanced host cell according to the previous claim, wherein

- the host cell is a cyanobacterium.

24. Metabolically enhanced host cell according to the previous claim, wherein

the cyanobacterium is selected from a group consisting of Synechococcus, Synechocystis, and Phormidium.

25. Method for the production of ethanol comprising the method steps of:

A) providing and culturing metabolically enhanced host cells according to any of the claims 1 to 24 in a growth medium under the exposure of light and CO2, the host cells accumulating ethanol while being cultured, B) separating the ethanol from the host cells and/or the growth medium.

26. Method according to the previous claim, wherein - in method step A) host cells are provided, which comprise a metabolically enhanced gene encoding at least one enzyme for the formation of ethanol under the transcriptional control of an inducible promoter, which can be induced by exposure to an exogenous stimulus, the method step A) further comprising :

Al) culturing the host cells under the absence of the exogenous stimulus or under a low presence of the exogenous stimulus, and thereafter

A2 ) providing or enhancing the exogenous stimulus, thereby inducing or enhancing ethanol production.

27. Construct for the transformation of a host cell by disrupting a host gene encoding a host cell enzyme

selected from endogenous host cell enzymes involved in acetate and lactate fermentation, comprising:

- a heterologous nucleic acid sequence comprising a

promoter and a biocide resistance conferring gene under the transcriptional control of the promoter, wherein

- the heterologous nucleic acid sequence is flanked at its 5' and 3' end by nucleic acid sequences, which are able to bind to at least parts of said host gene. 28. Construct for the transformation of a host cell by disrupting a host gene encoding a host cell enzyme

selected from acetate and lactate fermentation,

comprising :

- a heterologous nucleic acid sequence comprising a

promoter and a first gene encoding at least one

overexpressed first enzyme for the formation of ethanol under the transcriptional control of the promoter, wherein - the heterologous nucleic acid sequence is flanked at its 5' and 3' end by nucleic acid sequences, which are able to bind to at least parts of said host gene. 29. Construct according to any of the claims 27 or 28, wherein

- the heterologous nucleic acid sequence further comprises a second gene encoding at least one overexpressed second enzyme for ethanol formation.

30. Construct according to any of the claims 27 to 29, wherein

the host cell enzymes are selected from a group

consisting of lactate dehydrogenase,

phosphotransacetylase and acetate kinase.

Description:
Description

METABOLICALLY ENHANCED PHOTOAUTOTROPHIC ETHANOL PRODUCING HOST CELLS, METHOD FOR PRODUCING THE HOST CELLS, CONSTRUCTS FOR THE TRANSFORMATION OF THE HOST CELLS, AND METHOD OF

PRODUCING ETHANOL USING THE HOST CELLS

FIELD OF THE INVENTION This invention is related to the field of ethanol production using metabolically enhanced cells. The PCT patent

application PCT/EP2009/000892 filed on February 9, 2009 is incorporated by reference herein in its entirety. BACKGROUND OF THE INVENTION

Without new methods for biofuel production, the world will continue to depend on fossil fuels for transportation.

Accelerating demand, diminishing reserves and geopolitical risks have in recent years dramatically driven up the cost of fossil fuels. Use of fossil fuels also releases carbon dioxide into the atmosphere, which may cause deleterious environmental effects. Many governments have prescribed a reduction in the use of fossil fuels in favor of alternative renewable biofuels in an effort to stem the release of carbon dioxide from transportation vehicles.

Ethanol can be used as renewable biofuel but methods do not currently exist that can produce ethanol in sufficient quantities and at a price that could lead to a widespread adoption of ethanol as a major alternative to fossil fuels in the worldwide transportation fuel market. The patent and scientific literature cited herein establishes the knowledge that is available to those with skill in the art. The issued U.S. and foreign patents, published U.S. and foreign patent applications, and all other publications cited herein are hereby incorporated by reference. Additionally, all amino acid and nucleic acid sequences with the respective amino acid sequences encoded thereby identified by database accession number are hereby incorporated by reference. Aspects of the invention utilize techniques and methods common to the fields of molecular biology, microbiology and cell culture. Useful laboratory references for these types of methodologies are readily available to those skilled in the art. See, for example, Molecular Cloning: A Laboratory Manual (Third Edition), Sambrook, J., et al . (2001) Cold Spring Harbor Laboratory Press; Current Protocols in

Microbiology (2007) Edited by Coico, R, et al . , John Wiley and Sons, Inc.; The Molecular Biology of Cyanobacteria (1994) Donald Bryant (Ed.), Springer Netherlands; Handbook Of

Microalgal Culture: Biotechnology And Applied Phycology

(2003) Richmond, A.; (ed.), Blackwell Publishing; and "The cyanobacteria, molecular Biology, Genomics and Evolution", Edited by Antonia Herrero and Enrique Flores, Caister

Academic Press, Norfolk, UK, 2008.

Definitions

As used herein, the term "metabolically enhanced" refers to any change in the endogenous genome of a wild type cell or to the addition of non-endogenous genetic code to a wild type cell, e.g., the introduction of a heterologous gene. More specifically, such changes are made by the hand of man through the use of recombinant DNA technology or mutagenesis. The changes can involve protein coding sequences or nonprotein coding sequences such as regulatory sequences as promoters or enhancers . The term "nucleic acid" is intended to include nucleic acid molecules, e.g., polynucleotides which include an open reading frame encoding a polypeptide, and can further include non-coding regulatory sequences, and introns in the case of eukaryotic organisms for example algae. In addition, the terms are intended to include one or more genes that map to a functional locus. In addition, the terms are intended to include a specific gene for a selected purpose. The gene can be endogenous to the host cell or can be recombinantly introduced into the host cell.

The phrase "operably linked" means that the nucleotide sequence of the nucleic acid molecule or gene of interest is linked to the regulatory sequence (s) in a manner which allows for expression (e.g., enhanced, increased, constitutive, basal, attenuated, decreased or repressed expression) of the nucleotide sequence and expression of a gene product encoded by the nucleotide sequence (e.g., when the recombinant nucleic acid molecule is included in a recombinant vector, as defined herein, and is introduced into a microorganism) .

The term "recombinant nucleic acid molecule" includes a nucleic acid molecule (e.g., a DNA molecule) that has been altered, enhanced or engineered such that it differs in nucleotide sequence from the native or natural nucleic acid molecule from which the recombinant nucleic acid molecule was derived (e.g., by addition, deletion or substitution of one or more nucleotides) . Advantageously, a recombinant nucleic acid molecule (e.g., a recombinant DNA molecule) includes an isolated nucleic acid molecule or gene of the present

invention

The terms "host cell" and "recombinant host cell" are

intended to include a cell suitable for metabolic

manipulation, e.g., which can incorporate heterologous polynucleotide sequences, e.g., which can be transformed. The cell can be a prokaryotic or a eukaryotic cell. The term is intended to include progeny of the cell originally

transformed. In particular embodiments, the cell is a

prokaryotic cell, e.g., a cyanobacterial cell. Particularly, the term recombinant host cell is intended to include a cell that has already been selected or engineered to have certain desirable properties and suitable for further enhancement using the compositions and methods of the invention.

The term "promoter" is intended to include a polynucleotide segment that can transcriptionally control a gene-of- interest, e.g., a pyruvate decarboxylase gene that it does or does not transcriptionally control in nature. In one

embodiment, the transcriptional control of a promoter results in an increase in expression of the gene-of-interest . In another embodiment, a promoter is placed 5' to the gene-of- interest. A promoter can be used to replace the natural promoter, or can be used in addition to the natural promoter. A promoter can be endogenous with regard to the host cell in which it is used or it can be a heterologous polynucleotide sequence introduced into the host cell, e.g., exogenous with regard to the host cell in which it is used. Promoters of the invention may also be inducible, meaning that certain exogenous stimuli (e.g., nutrient starvation, heat shock, mechanical stress, light exposure, etc.) will induce the promoter leading to the transcription of the gene behind. The term "about" is used herein to mean approximately, in the region of, roughly, or around. When the term "about" is used in conjunction with a numerical value/range, it modifies that value/range by extending the boundaries above and below the numerical value (s) set forth. In general, the term "about" is used herein to modify a numerical value (s) above and below the stated value (s) by a variance of 20%. As used herein, the phrase "increased activity" refers to any metabolic enhancement resulting in increased levels of enzyme in a host cell. As known to one of ordinary skill in the art, enzyme activity may be increased by increasing the level of transcription, either by modifying promoter function or by increasing gene copy number, increasing translational

efficiency of an enzyme messenger RNA, e.g., by modifying ribosomal binding, or by increasing the stability of an enzyme protein, at which the half-life of the protein is increased, will lead to more enzyme molecules in the cell. All of these represent non-limiting examples of increasing the activity of an enzyme. (mRNA Processing and Metabolism: Methods and Protocols, Edited by Daniel R. Schoenberg, Humana Press Inc., Totowa, NJ; 2004; ISBN 1-59259-750-5; Prokaryotic Gene Expression (1999) Baumberg, S., Oxford University Press, ISBN 0199636036; The Structure and Function of Plastids

(2006) Wise, R. R. and Hoober J. K., Springer, ISBN 140203217X; The Biomedical Engineering Handbook (2000) Bronzino, J. D., Springer, ISBN 354066808X) . In one aspect the invention also provides nucleic acids, which are at least 60%, 70%, 80% 90% or 95% identical to the promoter nucleic acids disclosed therein and to the nucleic acids, which encode proteins, for example enzymes for ethanol formation or host cell enzymes involved in the conversion or formation of acetyl CoA, acetaldehyde or pyruvate. The invention also provides amino acid sequences for enzymes for ethanol formation or host cell enzymes involved in the conversion or formation of acetyl-CoA, acetaldehyde or pyruvate or for formation of reserve compounds, which are at least 60%, 70%, 80% 90% or 95% identical to the amino acid sequences disclosed therein. The percentage of identity of two nucleic acid sequences or two amino acid sequences can be determined using the

algorithm of Thompson et al . (CLUSTALW, 1994 Nucleic Acid Research 22: 4673-4,680). A nucleotide sequence or an amino acid sequence can also be used as a so-called "query

sequence" to perform searches against public nucleic acid or protein sequence databases in order, for example, to identify further unknown homologous genes, which can also be used in embodiments of this invention. In addition, any nucleic acid sequences or protein sequences disclosed in this patent application can also be used as a "query sequence" in order to identify yet unknown sequences in public databases, which can encode for example new enzymes, which could be useful in this invention. Such searches can be performed using the algorithm of Karlin and Altschul (1999 Proceedings of the National Academy of Sciences U.S.A. 87: 2,264 to 2,268), modified as in Karlin and Altschul (1993 Proceedings of the National Academy of Sciences U.S.A. 90: 5,873 to 5,877). Such an algorithm is incorporated in the NBLAST and XBLAST

programs of Altschul et al . (1999 Journal of Molecular

Biology 215: 403 to 410). Suitable parameters for these database searches with these programs are, for example, a score of 100 and a word length of 12 for BLAST nucleotide searches as performed with the NBLAST program. BLAST protein searches are performed with the XBLAST program with a score of 50 and a word length of 3. Where gaps exist between two sequences, gapped BLAST is utilized as described in Altschul et al. (1997 Nucleic Acid Research, 25: 3,389 to 3,402).

Database entry numbers given in the following are for the CyanoBase, the genome database for cyanobacteria

(http://bacteria.kazusa.or.jp/ cyanobase/index .html) ;

Yazukazu et al . "CyanoBase, the genome database for

Synechocystis sp . Strain PCC6803: status for the year 2000", Nucleic Acid Research, 2000, Vol. 18, page 72.

It is one object of embodiments of the invention to provide a metabolically enhanced host cell, which can be used for production of ethanol.

This object is reached by providing a metabolically enhanced host cell according to base claim 1. Further embodiments of the metabolically enhanced host cell, as well as constructs for producing the metabolically enhanced host cells and a method for producing ethanol using the metabolically enhanced host cells are subject matters of further claims.

Embodiment of metabolic knockout and/or overexpression of metabolic pathway enzymes

One aspect of the invention provides a metabolically enhanced photoautotrophic, ethanol producing host cell comprising:

- at least two first metabolic enhancements reducing the enzymatic activity or affinity of at least two

endogenous host cell enzymes involved in acetate and lactate fermentation, - the first metabolic enhancements resulting in an

enhanced level of biosynthesis of acetaldehyde,

pyruvate, acetyl-CoA or precursors thereof compared to the respective wild type host cell,

- at least one second metabolic enhancement different from the first metabolic enhancement comprising an

overexpressed enzyme for the formation of ethanol.

Acetaldehyde, pyruvate and acetyl-coA or their precursors are important metabolic intermediates for energy production in cells. In photoautotrophic cells, which use light, CO2, and water as a source of energy to produce carbohydrates via photosynthesis, acetaldehyde, pyruvate, acetyl-CoA and their precursors can be formed by conversion of organic molecules obtained via CO2 fixation in the Calvin-cycle, for example 3- phosphoglycerate . Pyruvate, acetyl-CoA and their precursors are important metabolic intermediates obtained e.g. by photosynthetic CO2 fixation in photoautotrophic cells.

Acetaldehyde is a metabolic intermediate of the anoxygenic fermentation pathway in many photoautotrophic cells.

Precursors of pyruvate and acetyl-CoA are organic compounds, which can be converted into these important metabolic

intermediates via the enzymatic action of enzymes of the photoautotrophic cell. For example the organic compounds 2- phosphoglycerate, 3-phosphoglycerate or phosphoenolpyruvate can be converted into pyruvate by enzymes of the glycolytic pathway in photoautotrophic cells. The metabolically enhanced photoautotrophic ethanol producing host cell comprises at least two different metabolic

enhancements, a first and a second metabolic enhancement. The first metabolic enhancement changes the enzymatic activity or affinity of at least two endogenous host cell enzymes

involved in acetate and lactate fermentation, resulting in a higher level of biosynthesis of acetyl-CoA, acetaldehyde, pyruvate or precursors thereof. The endogenous host enzyme is already present in an unmodified wild type host cell and its activity or affinity is changed by the first metabolic enhancement in order to increase the level of biosynthesis of metabolic intermediates, which are also present in the wild type host cell and which can be used to form ethanol.

Furthermore the metabolically enhanced photoautotrophic ethanol producing host cell comprises a second metabolic enhancement in the form of at least one overexpressed enzyme, which can form ethanol, for example from the above-mentioned important metabolic intermediates. In a further embodiment the overexpressed enzyme for ethanol formation can catalyze the last step of ethanol formation leading to the final product ethanol. The overexpressed enzyme for ethanol

formation can also catalyze the penultimate step of ethanol formation resulting in a metabolic intermediate, which can further be converted by another enzyme for ethanol formation into the final product ethanol.

The enzyme for ethanol formation can, for example, be an endogenous enzyme already present in a wild type

photoautotrophic host cell, which is not metabolically enhanced. In this case the activity or affinity of the enzyme for ethanol formation can be enhanced by the second metabolic enhancement, for example by metabolic engineering or random mutagenesis. This can, for example, be done by metabolically modifying the amino acid sequence of the enzyme by site directed or random mutagenesis of the gene encoding this endogenous enzyme, thereby enhancing its activity for formation of ethanol. Another possibility is to increase the number of gene copies encoding for the enzyme in the host cell or simply by enhancing the rate of transcription of the gene already present in the wild type cell to increase the abundance of its messenger RNA in the second metabolic enhancement. This can be done for example by replacing or mutating the endogenous promoter controlling the

transcription of the endogenous gene encoding the enzyme for ethanol formation.

Alternatively or additionally a heterologous enzyme for ethanol formation can be introduced into the host cell by the second metabolic enhancement, if that enzyme is not present in a metabolically unmodified wild type host cell. This can be done, for example, by introducing a construct, for example a DNA vector into the host cell including a heterologous gene encoding the overexpressed enzyme for ethanol formation. In the case that an endogenous enzyme for ethanol formation is already present in a photoautotrophic wild type host cell, the heterologous enzyme for ethanol formation can enhance the activity of the endogenous enzyme resulting in a higher rate of ethanol formation.

The enzymatic activity and the affinity of an enzyme for its substrate are important kinetic features. The enzymatic activity is given by the parameter V max , which reflects the maximal velocity of an enzymatic reaction occurring at high substrate concentrations when the enzyme is saturated with its substrate. The affinity is given by the Michaelis-Menten constant K m which is the substrate concentration required for an enzyme to reach one-half of its maximum velocity. In order to increase the enzymatic activity V max has to be increased, whereas for increasing the affinity K m has to be reduced. Regarding a further explanation of enzyme kinetics we refer to the chapter "enzyme kinetics" in the textbook

"Biochemistry" by Donald Voet and Judith Voet (John Wiley & Sons, 1990, pages 335 to 340) .

The higher level of biosynthesis of acetyl-CoA, acetaldehyde, pyruvate or precursors thereof results in a change of the flux of the acetyl-CoA, acetaldehyde, pyruvate or precursors thereof in the direction of the at least one overexpressed enzyme for ethanol formation so that formation of ethanol can be increased in comparison to a photoautotrophic ethanol producing host cell harboring only the second metabolic enhancement, but lacking the first metabolic enhancement. Acetyl-CoA, acetaldehyde, pyruvate or precursors thereof are transient metabolic intermediates, which are often rapidly processed into other metabolites by the photoautotrophic host cell and therefore a change in the level of biosynthesis of these metabolic intermediates can be hard to detect in photoautotrophic host cells featuring the first metabolic enhancement but lacking the second metabolic enhancement.

A first metabolic enhancement therefore results in a higher level of biosynthesis of acetyl-CoA, acetaldehyde, pyruvate or precursors thereof compared to the respective wild type host cell, if after introduction of the second metabolic enhancement a higher level of ethanol formation can be detected in a cell harboring the first and second metabolic enhancement than in a cell only harboring the second

metabolic enhancement but lacking the first metabolic

enhancement. This even applies if a change in the level of biosynthesis of these metabolic intermediates could not be detected in the photoautotrophic host cell harboring the first metabolic enhancement but lacking the second metabolic enhancement in comparison to the respective wild-type

photoautotrophic host cell, which does not harbor the first and second metabolic enhancement.

In particular, the metabolically enhanced photoautotrophic host cell can comprise more than two first metabolic

enhancements and can also comprise more than one second metabolic enhancement. For example the first metabolic enhancements can comprise at least three metabolic

enhancements, which are lactate dehydrogenase

phosphotransacetylase and acetate kinase.

The inventors found out that by reducing the enzymatic affinity or activity of lactate dehydrogenase and an enzyme selected from phosphotransacetylase and acetate kinase the level of in particular pyruvate can be increased. Pyruvate is an important substrate for ethanologenic enzymes such as pyruvate decarboxylase, so that the pyruvate can be used for ethanol production.

The metabolically enhanced photoautotrophic host cell shows a high production of ethanol due to the fact that the ethanol forming enzyme is overexpressed due to the second metabolic enhancement leading to a high enzymatic activity for ethanol formation and that at the same time a higher level of

biosynthesis of acetaldehyde, pyruvate, acetyl-CoA or their precursors is formed in the cells compared to the respective wild type cells due to the first metabolic enhancements.

Acetaldehyde, pyruvate, acetyl-CoA or their precursors serve as substrates for the ethanol production. These metabolic intermediates can either be a direct substrate for a first overexpressed enzyme for the formation of ethanol or for another second overexpressed enzyme for ethanol formation, which then catalyzes the formation of a substrate for the first overexpressed enzyme for ethanol formation. In yet a further embodiment of the host cell of the

invention, the at least one overexpressed enzyme for the formation of ethanol is an alcohol dehydrogenase.

An alcohol dehydrogenase catalyzes the reduction of a substrate to ethanol. This reaction is normally dependent on the cofactor NADH. Alternatively there are alcohol

dehydrogenases which are NADPH-dependent .

Furthermore, the alcohol dehydrogenase can be a thermophilic alcohol dehydrogenase. Thermophilic alcohol dehydrogenase can, for example, be obtained from a host cell which can normally grow well at temperatures above 45 0 C. Thermophilic alcohol dehydrogenases can be more stable and probably more active at higher temperatures than alcohol dehydrogenases obtained from mesophilic host cells, which normally grow at temperatures below 45 0 C. One possible example for such a thermophilic alcohol dehydrogenase is the alcohol

dehydrogenase AdhE obtained from the thermophilic

cyanobacterium Thermosynechococcus sp. or from E. coli (see Figure 44A for the nucleic acid sequence and Figure 44B for the amino acid sequence of ThAdhE protein sequence BAC07780)

One possible substrate for alcohol dehydrogenase can be acetyl-CoA, which for example can be directly converted to ethanol by the above-mentioned alcohol dehydrogenase AdhE from Thermosynechococcus or E. coli. Overexpressing such an alcohol dehydrogenase in a metabolically enhanced host cell has the advantage that only one enzyme has to be overexpressed in order to enhance the level of ethanol production. In the case that the level of biosynthesis of acetyl-CoA of the host cell is increased due to

overexpression of acetyl-coenzyme A forming enzymes and due to the reduction of enzymatic activity of acetyl-CoA

converting enzymes, a high level of ethanol formation can result .

In a further embodiment of the invention, a metabolically enhanced host cell can be provided, which further comprises: - pyruvate decarboxylase converting pyruvate to acetaldehyde, wherein

the alcohol dehydrogenase converts the acetaldehyde to ethanol .

In this case, the substrate for the alcohol dehydrogenase is provided by a further second overexpressed enzyme, for example pyruvate decarboxylase, which is introduced into the host cell via a further second metabolic enhancement. Due to the fact that the level of biosynthesis of pyruvate of the host cell is increased due to the above-mentioned

enhancements of the pyruvate forming and converting enzymatic activities by way of the first metabolic enhancement, more acetaldehyde is formed via the enzymatic activity of pyruvate decarboxylase. Therefore there is an increased synthesis of acetaldehyde, which is then further converted by alcohol dehydrogenase, the first overexpressed enzyme for ethanol formation to ethanol resulting in a higher intracellular or extracellular ethanol level in the host cell. The alcohol dehydrogenase, as well as the pyruvate decarboxylase can be obtained from alcohol-fermenting organisms such as the bacteria Zymomonas mobilis, Zymobacter palmae or other prokaryots carrying genes encoding pyruvate decarboxylases with comparable or better enzymatic features as well as the yeast Saccharomyces cerevisiae or other eukaryotes carrying genes encoding pyruvate decarboxylases with comparable or better enzymatic features.

In another embodiment of the invention the metabolically enhanced host cell comprises two second metabolic

enhancements, one comprising alcohol dehydrogenases Adh converting acetaldehyde into ethanol and another second metabolic enhancement comprising a CoA-dependent acetaldehyde dehydrogenase converting acetyl-CoA into acetaldehyde.

In yet a further embodiment of the invention the

metabolically enhanced host cell harbors a pyruvate

decarboxylase enzyme as the only second metabolic

enhancement. Such a single second metabolic enhancement is particularly advantageous in metabolically enhanced host cells, which already have an endogenous alcohol dehydrogenase enzyme. The inventors surprisingly found that the activity of such an endogenous alcohol dehydrogenase enzyme can be high enough in order to convert all or almost all of the

acetaldehyde formed by the overexpressed pyruvate

decarboxylase enzyme into ethanol. For example all cyanobacterial host cells harbor at least one endogenous alcohol dehydrogenase enzyme. A preferred example is the cyanobacterium Synechocystis in particular

Synechocystis PCC6803 or nitrogen fixing cyanobacteria such as Nostoc/Anabaena spec. PCC7120 and Anabaena variabilis ATCC 29413.

In a further embodiment of the invention the metabolically enhanced photoautotrophic ethanol producing host cell is an aquatic organism. This aquatic organism can, for example, be a fresh water species living in lakes, rivers, streams or wetlands. Alternatively the aquatic organism can be a marine organism, which lives in salty water, for example oceans. The aquatic organism also can be a fresh water species, which shows a high tolerance for brackish water or even salt water. The inventors also found fresh water strains that can grow in marine media with the same growth rate as in fresh water media . In a further embodiment the metabolically enhanced host cell is selected from a group consisting of: algae and bacteria.

Algae are a diverse group of simple plant-like organisms which include unicellular or multicellular forms. Algae are photosynthetically active organisms, in particular

photoautotrophs, which produce organic compounds from

inorganic molecules such as CO2 and water using light as an external source of energy.

Algae are considered to be eukaryotic organisms in particular protists. Protists are relatively simple eukaryotic organisms which are unicellular or multicellular without highly

specialized tissues.

In particular, protist algae can include Chlorophytes, which are green algae, such as Ulva chlatrata, Rhodophytes, which are red algae or heterokontophytes, which are brown algae. A preferred green algal species is Chlorella . Another example of a green algae is Chlamydomonas, which are unicellular flagellates. A particular well known example of Chlamydomonas is Chlamydomonas reinhardtii, which is a motile single-celled green algae found in, for example, fresh water. Chlamydomonas reinhardtii is also known to produce minor amounts of ethanol via fermentation under dark conditions (Gfeller and Gibbs, Fermentative Metabolism of Chlamydomonas reinhardtii, Plant Psychology (1984) 75, pages 212 to 218) .

In a further embodiment of the invention a metabolically enhanced photoautotrophic, ethanol producing host cell is provided, which comprises:

at least one first metabolic enhancement enhancing the enzymatic activity or affinity of the endogenous host cell enzymes selected from a group consisting of malic enzyme and malate dehydrogenase,

at least one second metabolic enhancement different from the at least two first metabolic enhancements comprising an overexpressed enzyme for the formation of ethanol,

- the first and second metabolic enhancements resulting in an increased rate of ethanol production compared to the respective photoautotrophic, ethanol producing host cell harboring the second metabolic enhancement but lacking the first metabolic enhancements.

In the case that the enzymatic activity of malate

dehydrogenase, an enzyme of the citric acid cycle and malic enzyme, an enzyme of the intermediate steps of metabolism is enhanced, for example by co-overexpression, malate

dehydrogenase can stimulate the conversion of oxaloacetate to pyruvate via malate. Malate dehydrogenase catalyzes the conversion of oxaloacetate to malate using NADH:

Oxaloacetate + NADH + H + → malate + NAD +

Malic enzyme catalyzes the conversion of malate into pyruvate using NADP + : malate + NADP + → pyruvate + CO 2 + NADPH

Alternatively the enzymatic activity or affinity of only one of the enzymes malic enzyme or malate dehydrogenase can be enhanced, by for example overexpression .

In yet another embodiment of the invention a metabolically enhanced photoautotrophic, ethanol producing host cell is provided, which comprises:

- at least one first metabolic enhancement enhancing the enzymatic activity or affinity of the endogenous host cell enzymes aldehyde dehydrogenase,

at least one second metabolic enhancement different from the at least one first metabolic enhancement comprising an overexpressed enzyme for the formation of ethanol,

- the first and second metabolic enhancements resulting in an increased rate of ethanol production compared to the respective photoautotrophic, ethanol producing host cell harboring the second metabolic enhancement but lacking the first metabolic enhancement.

An enzyme of the fermentation pathway, which can be

overexpressed is for example the aldehyde dehydrogenase enzyme, which can convert acetate to acetaldehyde and vice versa, thereby increasing the level of biosynthesis of acetaldehyde in the host cell. Alternatively also other aldehyde dehydrogenase enzymes could be overexpressed in order to increase the level of biosynthesis of acetaldehyde in the host cell. In a further embodiment of the invention a metabolically enhanced photoautotrophic, ethanol producing host cell is provided, which comprises:

at least two first metabolic enhancements enhancing the enzymatic activity or affinity of the endogenous host cell enzymes phosphoketolase and

phosphoacetyltransacetylase,

at least one second metabolic enhancement different from the at least two first metabolic enhancements comprising an overexpressed enzyme for the formation of ethanol,

- the first and second metabolic enhancements resulting in an increased rate of ethanol production compared to the respective photoautotrophic, ethanol producing host cell harboring the second metabolic enhancement but lacking the first metabolic enhancements.

According to a further aspect of the invention the enzymatic activity or affinity of the enzyme phosphoketolase (EC 4.1.2.-, putative phosphoketolase in Synechocystis PCC 6803 sir 0453) is enhanced in a first metabolic enhancement in order to increase the level of biosynthesis of precursor molecules for the generation of acetyl-CoA and acetaldehyde . Phosphoketolase catalyses the formation of acetyl phosphate and glyceraldehyde 3-phosphate, a precursor of 3-phospho- glycerate from xylulose-5-phosphate which is an intermediate of the Calvin cycle. The concomitant enhancement of the enzymatic activity or affinity of the enzyme phosphoacetyltransacetylase, which catalyzes the interconversion of acetylphosphate and acetyl-CoA can enhance the level of, for example, acetyl-CoA and pyruvate. In particular the acetylphosphate produced by the overexpressed phosphoketolase can be further converted to acetyl-CoA via the enzymatic action of the overexpressed phosphoacetyltransacetylase . Without being bound by an theory, an enhanced level of acetyl-CoA might lead to a feed back effect and slow down the conversion of pyruvate to acetyl-CoA.

Any of the above mentioned enhancements, for example but not limiting the different ethanologenic enzymes for the second metabolic enhancement or the various different promoters, which are described in relation to the at least two first metabolic enhancements reducing the enzymatic activity or affinity of at least two endogenous host cell enzymes

involved in acetate and lactate fermentation can also be used in conjunction with the enhancement of the enzymatic activity or affinity of malic enzyme and/or malate dehydrogenase, or aldehyde dehydrogenase or phosphoketolase and phosphoacetyltransacetylase.

Further in another embodiment of the invention, the

metabolically enhanced host cell harboring any of the above disclosed first metabolic enhancements can also comprise overexpressed enzymes as a first metabolic enhancement or overexpressed ethanologenic enzymes for ethanol formation as a second metabolic enhancement, which are under the

transcriptional control of various inducible or constitutive promoters, wherein the promoters are selected from a group consisting of:

- rbcLS, ntcA, nblA, isiA, petJ, petE, sigB, lrtA, htpG, hspA, clpBl, hliB, ggpS, psbA2, psaA, nirA and crhC. The promoters hspA, clpBl, and hliB can be induced by heat shock (raising the growth temperature of the host cell culture from 30 0 C to 40 0 C), cold shock (reducing the growth temperature of the cell culture from 30 0 C to 20 °C) , oxidative stress (for example by adding oxidants such as hydrogen peroxide to the culture) , or osmotic stress (for example by increasing the salinity) . The promoter sigB can be induced by stationary growth, heat shock, and osmotic stress. The promoters ntcA and nblA can be induced by decreasing the concentration of nitrogen in the growth medium and the promoters psaA and psbA2 can be induced by low light or high light conditions. The promoter htpG can be induced by osmotic stress and heat shock. The promoter crhC can be induced by cold shock. An increase in copper concentration can be used in order to induce the promoter petE, whereas the promoter petJ is induced by decreasing the copper concentration.

All the above promoter elements can be combined with any of the genes encoding any of the enzymes of the invention by using standard molecular cloning techniques. In particular the promoters, which can be used for the present invention include, but are not limited to: (1) Figure 45A depicts the nucleotide sequence of the petJ promoter (Synechocystis sp . PCC 6803) (petJ gene: slll796

(encoding for cytochrome c553; induced expression under copper starvation) ;

Reference :

J Biol Chem. 2004 Feb 20 ; 279 (8) : 7229-33. Epub 2003 Dec.

The efficient functioning of photosynthesis and

respiration in Synechocystis sp . PCC 6803 strictly requires the presence of either cytochrome c6 or

plastocyanin .

Duran RV, Hervas M, De La Rosa MA, Navarro JA.

(2) Figure 45B depicts the nucleotide sequence of the sigB promoter (Synechocystis sp . PCC 6803) sigB gene : sll0306 (encoding for RNA polymerase group 2 sigma factor) induced expression after heat shock, in

stationary growth phase/nitrogen starvation and darkness) References :

Arch Microbiol. 2006 Oct; 186 (4) : 273-86. Epub 2006 JuI 26.

The heat shock response in the cyanobacterium

Synechocystis sp . Strain PCC 6803 and regulation of gene expression by HrcA and SigB.

Singh AK, Summerfield TC, Li H, Sherman LA

FEBS Lett. 2003 Nov 20 ; 554 (3) : 357-62.

Antagonistic dark/light-induced SigB/SigD, group 2 sigma factors, expression through redox potential and their roles in cyanobacteria .

Imamura S, Asayama M, Takahashi H, Tanaka K, Takahashi

H, Shirai M

J Biol Chem. 2006 Feb 3; 281 (5) : 2668-75. Epub 2005 Nov 21.

Growth phase-dependent activation of nitrogen-related genes by a control network of group 1 and group 2 sigma factors in a cyanobacterium.

Imamura S, Tanaka K, Shirai M, Asayama M.

(3) Figure 45C depicts the nucleotide sequence of the htpG promoter (Synechocystis sp . PCC 6803) htpG gene: sll0430 : (encoding for heat shock protein 90, molecular chaperone) induced expression after heat shock

Reference :

Plant Physiol. 1998 May; 117 (1) : 225-34.

Transcriptional and posttranscriptional control of mRNA from lrtA, a light-repressed transcript in Synechococcus sp. PCC 7002.

Samartzidou H, Widger WR (4) Figure 45D shows the nucleotide sequence of the lrtA promoter (Synechocystis sp . PCC 6803) lrtA gene:sllO947

(encoding the light repressed protein A homolog

induced expression after light to dark transition)

Reference :

Plant Physiol. 1998 May; 117 (1) : 225-34.

Transcriptional and posttranscriptional control of mRNA from lrtA, a light-repressed transcript in Synechococcus sp. PCC 7002.

Samartzidou H, Widger WR

(5) the nucleotide sequence of the psbA2 promoter

(Synechocystis sp. PCC 6803) (see Figure 45E) psbA2 gene: slrl311 (encoding the photosystem II Dl protein) induced expression after dark to light transition

Reference :

Biochem Biophys Res Commun. 1999 Feb 5; 255 (1) : 47-53.

Light-dependent and rhythmic psbA transcripts in

homologous/heterologous cyanobacterial cells.

Agrawal GK, Asayama M, Shirai M.

(6) Figure 45F shows the nucleotide sequence of the rbcL promoter (Synechocystis sp . PCC 6803) rbcL gene: slr0009

(encoding the ribulose biphosphate carboxylase/oxygenase large subunit constitutive strong expression under continuous light conditions

Reference :

Plant MoI Biol. 1989 Dec; 13 ( 6) : 693-700

Influence of light on accumulation of photosynthesis- specific transcripts in the cyanobacterium Synechocystis 6803. Mohamed A, Jansson C.

(7) Figure 45G depicts the nucleotide sequence of the psaA promoter (Synechocystis sp . PCC6803) ; PsaA gene: slr!834

(encoding P700 apoprotein subunit Ia) induced expression under low white light and orange light, low expression level under high light and red light, repressed in darkness

References :

Plant Cell Physiol. 2005 Sep; 46 ( 9) : 1484-93. Epub 2005 Jun 24.

Regulation of photosystem I reaction center genes in Synechocystis sp . strain PCC 6803 during Light

acclimation .

Herranen M, Tyystjarvi T, Aro EM.

Plant Cell Physiol. 2006 JuI; 47 (7) : 878-90. Epub 2006 May 16.

Characterization of high-light-responsive promoters of the psaAB genes in Synechocystis sp . PCC 6803.

Muramatsu M, Hihara Y.

(8) Figure 45H shows the nucleotide sequence of the ggpS promoter (Synechocystis sp . PCC6803) ; ggpS gene: slll566

(encoding glucosylglycerolphosphate synthase) induced

expression after salt stress

Reference :

Plant Physiol. 2004 Oct; 136 (2) : 3290-300. Epub 2004 Sep 10.

Gene expression profiling reflects physiological

processes in salt acclimation of Synechocystis sp . strain PCC 6803.

Marin K, Kanesaki Y, Los DA, Murata N, Suzuki I, Hagemann M.

J Bacterid. 2002 Jun; 184 (11) : 2870-7. Salt-dependent expression of glucosylglycerol-phosphate synthase, involved in osmolyte synthesis in the

cyanobacterium Synechocystis sp . strain PCC 6803.

Marin K, Huckauf J, Fulda S, Hagemann M.

(9) Figure 451 depicts the nucleotide sequence of the nirA promoter (Synechocystis sp . PCC6803) ; nirA gene: slrO898

(encoding ferredoxin-nitrite reductase) induced expression after transition from ammonia to nitrate.

Reference :

Appl Environ Microbiol. 2005 Oct; 71 (10) : 5678-84.

Application of the Synechococcus nirA promoter to

establish an inducible expression system for engineering the Synechocystis tocopherol pathway.

Qi Q, Hao M, Ng WO, Slater SC, Baszis SR, Weiss JD,

Valentin HE. J Bacteriol. 1998 Aug; 180 (16) : 4080-8

cis-acting sequences required for NtcB-dependent, nitrite- responsive positive regulation of the nitrate assimilation operon in the cyanobacterium Synechococcus sp . strain PCC 7942.

Maeda S, Kawaguchi Y, Ohe TA, Omata T.

(10) Figure 45J depicts the nucleotide sequence of the petE promoter (Anabaena sp . PCC7120); petE gene: allO258 (encoding plastocyanin precursor) induced expression at elevated copper concentrations

Reference :

Microbiology. 1994 May;140 ( Pt 5):1151-9. Cloning, sequencing and transcriptional studies of the genes for cytochrome c-553 and plastocyanin from Anabaena sp. PCC 7120.

Ghassemian M, Wong B, Ferreira F, Markley JL, Straus NA.

Proc Natl Acad Sci U S A. 2001 Feb 27 ; 98 (5) : 2729-34. Epub 2001 Feb 20.

Expression of the Anabaena hetR gene from a copper- regulated promoter leads to heterocyst differentiation under repressing conditions.

Buikema WJ, Haselkorn R.

(11) Figure 45K shows the nucleotide sequence of the hspA promoter (Synechocystis sp . PCC6803) ; hspA gene: slll514 16.6 kDa small heat shock protein, molecular chaperone

multi-stress responsible promoter (heat, cold, salt and oxidative stress)

Reference :

Curr Microbiol. 2004 Sep; 49 (3) : 192-8.

Expression of the heat shock gene hsplδ.6 and promoter analysis in the cyanobacterium, Synechocystis sp . PCC 6803.

Fang F, Barnum SR. J Exp Bot. 2006;57 (7) :1573-8. Epub 2006 Mar 30.

The heat shock response of Synechocystis sp . PCC 6803 analyzed by transcriptomics and proteomics.

Suzuki I, Simon WJ, Slabas AR. (12) Figure 45L depicts the nucleotide sequence of the hliB promoter (Synechocystis sp . PCC6803) ; hliB gene: ssr2595 : high light-inducible polypeptide HliB, CAB/ELIP/HLIP superfamily multi-stress responsible promoter (heat, cold, salt and oxidative stress)

Reference :

J Biol Chem. 2001 Jan 5; 276 (1) : 306-14.

The high light-inducible polypeptides in Synechocystis PCC6803. Expression and function in high light.

He Q, Dolganov N, Bjorkman O, Grossman AR.

Arch Microbiol. 2007 Apr; 187 (4) : 337-42. Epub 2007 Feb 10.

The response regulator RpaB binds the high light

regulatory 1 sequence upstream of the high-light-inducible hliB gene from the cyanobacterium Synechocystis PCC 6803.

Kappell AD, van Waasbergen LG.

(13) Figure 45M shows the nucleotide sequence of the clpBl promoter (Synechocystis sp . PCC6803) ; clpBl gene: slrl641 : ATP-dependent CIp protease, Hsp 100, ATP-binding subunit CIpB multi-stress responsible promoter (heat, cold, salt and oxidative stress)

Reference :

Microbiology. 2004 May;150(Pt 5) .1271-81.

Effects of high light on transcripts of stress-associated genes for the cyanobacteria Synechocystis sp . PCC 6803 and Prochlorococcus MED4 and MIT9313.

Mary I, Tu CJ, Grossman A, Vaulot D. J Exp Bot. 2006;57 (7) :1573-8. Epub 2006 Mar 30.

The heat shock response of Synechocystis sp . PCC 6803 analysed by transcriptomics and proteomics.

Suzuki I, Simon WJ, Slabas AR. Embodiments of the Invention

In the following the inventions will be explained in more detail with reference to figures and certain embodiments:

Figures 1 and 3 depict general schemes of metabolic pathways in Cyanobacteria with marked enzymes for overexpression and down-regulation or knock-out for the increase of biosynthesis of different metabolic intermediates, in particular acetyl- CoA and pyruvate .

Figure 2 shows a flow chart including some ethanologenic enzymes for ethanol production.

Figure 1 shows some general metabolic pathways in cyanobacteria as a non-limiting example. In particular the Calvin cycle as the light independent part of the photosynthesis is shown starting with the carbon dioxide fixation reaction catalyzed by the enzyme RubisCO. Further the glycolysis pathway, the pentose phosphate pathway and the citric acid cycle are shown. The general metabolic pathways depict boxed and circled enzymes, whose activity or affinity can be changed as part of at least one first metabolic enhancement of an endogenous host enzyme of the cyanobacterial host cell. Boxed enzymes either have been overexpressed compared to the respective wild type cyanobacterial cells or are prime candidates for overexpression. Circled enzymes either have been knocked out or down regulated or are prime targets for knock-out or down-regulation. The main reason for the knockout or overexpression is to enhance the level of pyruvate biosynthesis in the metabolically enhanced cell by knocking- out or reducing the activity or affinity of enzymes consuming pyruvate or its metabolites and to enhance the enzymatic activity of enzymes producing pyruvate or its precursors such as phosphoenolpyruvate (PEP) . The cyanobacterial host cell can comprise more than one first metabolic enhancement. For example enzymes enhancing the level of pyruvate biosynthesis such as enolase, phosphoketolase or malic enzyme can be overexpressed and the activity or affinity of enzymes

consuming pyruvate, such as the enzymes of fermentative pathway such as lactate dehydrogenase,

phosphoacetyltransacetylase and acetate kinase can be reduced or abolished by knock-out of the respective genes in one cyanobacterial host cell.

Figure 2 shows in a more detailed way the last steps of ethanol synthesis in metabolically enhanced cyanobacteria .

Figure 3 depicts a further non-limiting representation of metabolic pathways of a cyanobacterium. In contrast to the figure 1 a NAD dependent acetaldehyde dehydrogenase is shown, which can convert acetate into acetaldehyde, which then can be converted into ethanol by Adh enzyme. Such an aldehyde dehydrogenase can be overexpressed in order to increase the level of acetaldehyde for ethanol production.

1. General Construction of DNA-vectors for overexpression

DNA sequences encoding genes of interest were amplified by polymerase chain reaction (PCR) using specific primers. When the genomic sequence did not contain appropriate restriction sites for cloning, primers were designed containing restriction sites. Genomic DNA from Synechocystis sp . PCC 6803 was used as template. The amplified PCR fragments were digested with the appropriate restriction enzymes and cloned into either a self replicating plasmid (pVZ series) or an integrative plasmid (pSK series) . As promoters either the genomic 5 'region of the specific gene itself was used or alternative an inducible promoter like PpetJ. (PpetJ, pVZ, pSK, for description see below mentioned adh/pdc constructs) . An antibiotic resistance cassette for selection of positive clones is present on the appropriate plasmid. The structures and sequences of all used DNA-vectors are described below. Metabolic engineering of constructs as well as PCRs, ligations into cloning vectors, insertions of antibiotic resistance cassettes and transformations into E. coli were done using standard procedures (state of the art) or according to the manufacturer instructions.

All pVZ plasmids were transferred to Synechocystis sp . PCC 6803 by the below described "general Protocol for conjugation". The pSK, pUC or pBluescript constructs were transferred to Synechocystis sp . PCC 6803 by the below described "general protocol for transformation".

General Protocol for transformation

All pSK or pBluescript constructs were transferred to

Synechocystis sp . PCC 6803 by transformation.

Host cells are mutagenized by transformation of the DNA- vectors (pSK, pUC or pBluescript constructs) using the natural competence of Synechocystis sp . PCC 6803 for DNA uptake and its system for homologous recombination.

10 ml of exponentially growing culture of Synechocystis spec, were spun down at room temperature (RT) and the supernatant was removed. The pellet was resuspended in 0.5-1.0 ml of BGIl medium and 1-10 μg plasmid DNA (pSK-constructs carrying ethanologenic genes and an antibiotic cassette for screening for homologous recombination or pUC- and pBluescript knockout-constructs carrying gene of interest and an antibiotic cassette for screening for homologous recombination) were added. The cells were incubated on a table-top shaker for 5-6 hours in the light at 28°C. 0.2 ml of the transformation mixture were plated on a BGIl agar. The plates were incubated in the light at 28°C over night. For selection of mutant clones the appropriate antibiotics were put under the agar

(0.4 ml of kanamycin (1 mg/mL) or 0.4 ml chloramphenicol (1.4 mg/mL) or 0.2 ml gentamycin (1 mg/mL), respectively).

After approx. 2 weeks incubation in the light at 28°C, colonies were picked and plated to plates containing the appropriate antibiotic. Thereafter, the concentrations of the antibiotic were increased stepwise when the cells were transferred onto another agar plate or into liquid culture (for kanamycin from initially 5 to 150 μg/ml BGIl, for chloramphenicol from initially 1 to 15 μg/ml BGIl medium and for gentamycin from initially 1 to 5 μg/ml BGIl) in order to get fully segregated (homozygous) mutants. Transfers were done every week.

When mutants grew on the final antibiotic concentration, individual clones were checked for full segregation of the mutant gene by PCR.

BGIl media recipe:

NaNO 3 : 1.5 g

K 2 HPO 4 : 0.04 g

MgSO 4 -7H 2 O: 0.075 g

CaCl 2 -2H 2 O: 0.036 g

Citric acid: 0.006 g

Ferric ammonium citrate: 0.006 g EDTA (disodium salt): 0.001 g

NaCO 3 : 0.02 g

Trace metal mix A5 1.0 ml (see below)

Distilled water: 1.0 L

Trace metal mix A5 :

H 3 BO 3 : 2.86 g

MnCl 2 -4H 2 O: 1.81 g

ZnSO 4 -7H 2 O: 0.222 g

NaMoO 4 -2H 2 O: 0.39 g

CuSO 4 -5H 2 O: 0.079 g

Co (NO 3 ) 2 - 6H 2 O: 49.4 mg

Distilled water: 1.0 L 2. General Protocol for conjugation

All pVZ self replicating plasmids were transferred into cyanobacterial cells by conjugation. Protocol:

Cyanobacterial culture:

- Synechocystis PCC6803 wild type or mutants strains (with the appropriate antibiotic) cultivated in BGIl medium until OD750nm 0.2-0.8

E. coli cultures:

- inoculation of overnight cultures of strains E. coli XL-I carrying plasmid (pVZ) and E. coli J53(RP4) in LB medium containing the appropriate antibiotics (50μl/ml ampicillin for J53 and antibiotic for pVZ) .

- preparation of well growing culture (for each conjugation 10 ml of XL-I (pVZ plasmid) and 10 ml of J53 (RP4) is needed) : inoculate 0.25 ml overnight culture in 9.75 ml LB + antibiotic, grow for 2.5 h / 37°C - spin down the well grown E. coli cultures (10 min at 2500 rpm) .

- "wash" / resuspend cells in ImI of LB without antibiotics.

- for each conjugation mix 1 ml of resuspended XL-I (pVZ) and 1 ml J53 (RP4), spin down, remove supernatant and resuspend

-pellet in lOOμl LB medium and incubate without shaking Ih at 30 0 C.

- then add 1.9 ml Synechocystis culture, shake slightly and centrifuge .

Resuspend the pellet in 30μl BG-Il and drop it on an HATF (nitrocellulose membrane) filter, which is located on a prepared dried plate (of 20ml 2x BG-Il and 20ml 2 % cyanoagar and 2ml LB medium) .

Leave the plate for 2 days under low light conditions in cyano cultivation chamber at 28 0 C.

After incubation splash the bacteria on the filter with 300μl BG-Il and plate it carefully on 1%-cyano agar plate with antibiotic (for pVZ) . After 10 days (or a little more) first transconjugants are visible. 3. Protocols for generation of Synechocystis sp. PCC 6803 mutants overexpressing the following genes as first metabolic enhancements :

3a) co-overexpression of both malic enzyme and malate

dehydrogenase and single overexpression of either malic enzyme or malate dehydrogenase

3b) co-overexpression of both phosphoketolase and phosphor- acetyltransacetylase

3c) aldehyde dehydrogenase 3a) Construction of DNA-vectors for overexpression of malic enzyme and malate dehydrogenase

3a.1) Construction of DNA-vectors for over-expression of malic enzyme

ORF slrO721 encoding malic enzyme 1 (EC 1.1.1.38), Ac. No P72661, has the amino acid sequence as shown in Figure 4. For over-expression of malic enzyme, the encoding me gene together with its gene-specific terminator region was PCR- amplified using the following primer:

Mae-Ndel.fw: S'-CATATGGTTAGCCTCACCCCCAAT-a', primer contains a Ndel restriction site for cloning (marked in bold letters) (SEQ ID NO. 2)

MeLongClal.rv: 5'-ATCGATCGGGATGGCCTATTTATGG -3', primer contains a CIaI restriction site for cloning (marked in bold letters)

(SEQ ID NO. 3)

The PCR fragment was amplified by a High-Fidelity DNA Polymerase (Phusion™; Finnzymes) , adenylated (BIOTAQ™ DNA- Polymerase; BIOLINE), cloned into the pDrive vector (Qiagen) and restricted with Ndel/CIaI (Fermentas) . This fragment was cloned into the pSK9 vector, digested with Ndel /CIaI . The gene is incorporated into a non-coding genome region of Synechocystis sp . PCC 6803 via the integrated platform. The expression of the enzyme is under control of the copper dependent promoter PpetJ. (The nucleotide sequence and a schematic representation of the non-public pSK9 vector are given on Figures 4-1A and 4-1B, respectively.) The construct used, designated as pSK9/me-long, has the structure depicted in Figure 5. The sequence of the insert of construct pSK9/me-long is shown in Figure 6. 3a.2) Construction of DNA-vector for over-expression of malate dehydrogenase

ORF S110891 encodes malate dehydrogenase (EC 1.1.1.37), Ac. No Q55383 with the amino acid sequence as depicted in Figure 7.

For over-expression of malate dehydrogenase a construct was generated including start-codon and the gene specific termination loop of the mdh gene using the following primers:

Mdh-Ndel.fw: 5'-CATATGAATATTTTGGAGTATGCTCC-S, primer contains a Ndel restriction site for cloning (marked in bold letters) (SEQ ID NO. 6) Mdh-Clal.rv : 5'-ATCGATAAGCCCTAACCTCGGTG-S, primer contains a CIaI restriction site for cloning (marked in bold letters) (SEQ ID NO. 7)

The PCR fragment was amplified by a High-Fidelity DNA Polymerase (Phusion™; Finnzymes) , adenylated (BIOTAQ™ DNA- Polymerase; BIOLINE), cloned into the pDrive vector (Qiagen) and restricted with Ndel /CIaI (Fermentas) . This fragment was cloned into the pSK9 vector, digested with Ndel /CIaI . The expression of the enzyme is under the control of the copper dependent promoter PpetJ. The construct used, designated as pSK9/mdh has the general structure as presented in Figure 8 and the sequence of the insert of construct pSK9/mdh is shown in Figure 9. 3a.3) Construction of DNA-vector for co-over-expression of malic enzyme and malate dehydrogenase

This construct was generated for co-over-expression of malic enzyme and malate dehydrogenase. These genes were amplified by PCR using primers including the start and stop-codon of the me gene (PCR fragment I) and including the ribosome binding site (RBS) and termination loop of the mdh gene (PCR fragment II) . The co-expression of the enzymes is under the control of the copper dependent promoter PpetJ.

The following primers were used for amplification

• PCR fragment I :

Mae-Ndel.fw: S'-CATATGGTTAGCCTCACCCCCAAT-a', primer contains a Ndel restriction site for cloning (marked in bold letters) (SEQ ID NO. 9)

MeShortClal.rv: 5'-ATCGATACAATTCCCGATTAACTATTGACC -3', primer contains a CIaI restriction site for cloning (marked in bold letters)

(SEQ ID NO. 10)

• PCR fragment II:

MdhRBSClal.fw: 5'-ATCGATTTTTCTCCACCATCAACACC -3', primer contains a CIaI restriction site for cloning (marked in bold letters)

(SEQ ID NO. 11)

MdhBglll.rv: 5'-AGATCTAAGCCCTAACCTCGGTG-S', primer contains a BgIII restriction site for cloning (marked in bold letters) ( SEQ I D NO . 12 )

The PCR fragments were amplified by a High-Fidelity DNA Polymerase (Phusion™; Finnzymes) , adenylated (BIOTAQ™ DNA- Polymerase, BIOLINE) , cloned into the pDrive vector (Qiagen) and restricted with Ndel/CIaI and CIaI/BgIII (Fermentas) , respectively. These fragments were cloned into the pSK9 vector, first digested with Ndel/CIaI for integration of malic enzyme and secondly with CIaI /BgIII for integration of malate dehydrogenase.

The construct used, designated as pSK9/me-mdh has the

structure depicted in Figure 10. The sequence of the insert of construct (pSK9/me-mdh) is as presented in Figure 11.

3a.4) Plasmid pSK9 structure and sequence

The non-public pSK9 vector was generated in the lab of V. V. Zinchenko (Moscow, Russia) and is shown in Figure 12. Figure 13 depicts the nucleic acid sequence of the vector.

Using the plasmids coding for the ethanologenic enzymes and the methods as described in the section 5) "Generation of self-replicating (extrachromosomal) vectors for the inducible overexpression of ethanologenic enzymes in cyanobacterial mutant strains" the following mutants have been generated comprising a first metabolic mutation and as second metabolic enhancements overexpressed Pdc enzymes and SynAdh enzymes: PCC6803 PpetJ-me: Synechocystis spec. PCC6803 was first transformed with pSK9/me-long, resulting in a fully

segregated mutant PCC6803 PpetJ-me. PCC6803 PpetJ-me/pVZ325-PpetJ-PDC-synADH: Self-replicating plasmid pVZ325-PpetJ-PDC-synADH was then introduced into mutant PCC6803 PpetJ-me by conjugation, thereby creating a mutant cyanobacterial strain harboring overexpressed malic enzyme as a first metabolic enhancement and overexpressed Pdc enzyme and SynAdh enzyme as second metabolic enhancements.

PCC6803 PpetJ-mdh: Synechocystis spec. PCC6803 was first transformed with pSK9/mdh, resulting in a fully segregated mutant PCC6803 PpetJ-mdh.

PCC6803 PpetJ-mdh/pVZ325-PpetJ-PDC-synADH: Self-replicating plasmid pVZ325-PpetJ-PDC-synADH was then introduced into mutant PCC6803 PpetJ-mdh by conjugation, thereby creating a mutant cyanobacterial strain harboring overexpressed malate dehydrogenase enzyme as a first metabolic enhancement and overexpressed Pdc enzyme and SynAdh enzyme as second

metabolic enhancements.

PCC6803 PpetJ-me-mdh: Synechocystis spec. PCC6803 was first transformed with pSK9/me-mdh, resulting in a fully segregated mutant PCC6803 PpetJ-me-mdh.

PCC6803 PpetJ-me-mdh/pVZ321b-PpetJ-PDC-ADHII: SeIf- replicating plasmid pVZ321b-PpetJ-PDC-ADHII was then

introduced into mutant PCC6803 PpetJ-me-mdh by conjugation, thereby creating a mutant cyanobacterial strain harboring overexpressed malic enzyme and malate dehydrogenase as first metabolic enhancements and overexpressed Pdc enzyme and

SynAdh enzyme as second metabolic enhancements. PCC6803 pVZ321b-PpetJ-PDC-ADHII and PCC6803 pVZ325-PpetJ-PDC- synADH: Self-replicating plasmids pVZ321b-PpetJ-PDC-ADHII or pVZ325-PpetJ-PDC-synADH, respectively, were introduced into Synechocystis spec. PCC6803 wild type by conjugation, thereby creating a mutant cyanobacterial strain harboring over- expressed Pdc enzyme and either AdhII or SynAdh enzyme as second metabolic enhancements, but lacking the first

metabolic enhancement.

3b) Generation of a Synechocystis PCC6803 mutant overexpressing phosphoketolase and phosphoacetyltrans- acetylase as first metabolic enhancements A DNA-vector for co-overexpression of phosphoketolase and phosphoacetyltransacetylase was constructed as follows:

Figure 14 shows the amino acid sequence of ORF slrO453 encoding the probable phosphoketolase (phk) , (EC 4.1.2.-), Ac. No P74690. ORF slr2132 encodes a phosphoacetyltransacetylase (pta),EC 2.3.1.8, Ac No. P73662, having the amino acid sequence depicted in Figure 15.

The phosphoketolase and phosphoacetyltransacetylase genes were amplified by PCR using the following primers: phosphoketolase (phk)

#phkl 5' -GTGTCTCATATGGTTACATCCCCCTTTTCCCTT-S' (Ndel site inserted)

(SEQ ID NO. 17)

#phk-BglII-rev 5' -GGTCACAGATCTGTTGTCCCCCATGGCCTAGCTA-S' (SEQ ID NO. 18) phosphoacetyltransacetylase (pta)

#pta-BglII-fw 5'-CCTTGCAGATCTGGATACGTTGAGGTTATTTAAATTATGA-S' (SEQ ID NO. 19)

#pta pPETJ2-XhoI 5'-CGGTTGCTCGAGCATCTGGAACGGTTGGGTAAAT-S' ( SEQ I D NO . 2 0 )

All primers contain restriction sites for cloning (marked in bold letters) .

PCR fragments were cut with the appropriate restriction enzymes and ligated downstream of the PpetJ promoter into pIC-PpetJ as followed:

5' -XhoI-pIC-PpetJ-NdeI-3'

5' -NdeI-phk-BglII-3'

5' -BglII-pta-XhoI-3'

The entire PpetJ-phk-pta fragment was cut out of the cloning plasmid pIC20H with Smal/Nrul and ligated into Smal site of the E. coli-Synechocystis shuttle vector pVZ322 (self replicating plasmid) .

The construct named pVZ322-PpetJ-phk-pta, has the structure shown in Figure 16 and the nucleic acid sequence of the insert of pVZ322-PpetJ-phk-pta is as presented in Figure 17.

Plasmid pVZ322-PpetJ-phk-pta was transferred into

Synechocystis PCC6803 by conjugation as described.

Confirmation of the resulting mutant, PCC6803 pVZ-PpetJ-phk- pta, was performed by PCR.

3c) Generation of a Synechocystis PCC6803 mutant overexpressing aldehyde dehydrogenase as a first metabolic enhancement

A DNA-vector for overexpression of aldehyde dehydrogenase was constructed as follows: The amino acid sequence of ORF slr0091 encoding an aldehyde dehydrogenase (aldh) , EC 1.2.1.3, Ac No. BAA10564 Q55811 is shown in Figure 18. A construct was generated for overexpression of aldehyde dehydrogenase under control of the inducible promoter PpetJ. The construct includes the petJ promoter, the 1369 bp aldehyde dehydrogenase fragment containing the entire coding sequence from ORF slr0091 and 205 bp downstream of the gene (terminator region) . The aldehyde dehydrogenase (aldh) gene was amplified by PCR using the following primer:

#aldhl-NdeI-fw 5' -GTGCCTCATATGAATACTGCTAAAACTGTTGTTGC-S' (SEQ ID NO. 23)

#aldh2-XhoI-rev 5' -GATCTCCTCGAGGTAAAGAATCAGCATAGGTCTGG-S' (SEQ ID NO. 24)

Primers contain a Ndel or Xhol restriction site, respectively, for cloning (marked in bold letters) .

The PCR fragment was digested with Ndel/Xhol and ligated downstream of the PpetJ promoter into pIC-PpetJ. The entire PpetJ-aldehyde dehydrogenase fragment was cut out of this plasmid with Pstl/Xhol and ligated into the E. coli- Synechocystis shuttle vector pVZ322 (self replicating plasmid) .

The construct used, named pVZ322-PpetJ-aldh, has the structure as depicted in Figure 19. The sequence of the insert of construct pVZ322-PpetJ-aldh is presented in Figure 20. Plasmid pVZ322-PpetJ-aldh was transferred into Synechocystis PCC6803 by conjugation as described. Confirmation of the resulting mutant, PCC6803 pVZ-PpetJ-aldh, was performed by PCR

4) Protocols for generation of Synechocystis sp. PCC 6803 triple Δack/Δpta/Δldh knock-out mutant affecting lactate dehyrogenase (ldh) , acetate kinase (ack) and phospho- acetyltransacetylase (pta) as first metabolic enhancements In the following the construction of DNA-vectors for generation of the Δack/Δpta/Δldh triple knock-out mutant is described:

4a) Construction of a DNA-vector for generation of an acetate kinase mutant

ORF S111299 encodes a putative acetate kinase (EC 2.7.2.1),

Ac No. P73162, with the amino acid sequence as shown in

Figure 21.

A 2316 bp fragment containing the entire coding sequence from acetate kinase (slll299) was amplified by PCR using the following primer:

#ack-l fw: 5 ' -CCGGGACGTGACAGAACGGGTGG -3'

(SEQ ID NO. 27)

#ack-2 rv: 5'-GCGTTGGCGATCGCCGTCACTAG-S'

(SEQ ID NO. 28) The PCR fragment was digested with Spel and cloned into pBluescript SK+ vector. Cloning vector pBluescript II® SK+

(Ac. No X52328) was from Stratagene, La Jolla, CA, USA. The kanamycin resistance cassette was used from the DNA vector pUC4K (Ac. No X06404) and ligated into the Hpal restriction sites of slrl299. Figure 22 depicts the structure of the knock-out-construct, named pBlue-ack-Km and the nucleic acid sequence of the insert of construct pBlue-ack-Km is shown in Figure 23.

4b) Construction of a DNA-vector for generation of a phosphoacetyltransacetylase (phosphoacyltransferase) mutant

ORF slr2132 encodes a phosphoacetyltransacetylase (EC 2.3.1.8), Ac No. P73662 having the amino acid sequence as shown in Figure 24.

A 2869 bp fragment containing the entire coding sequence from phosphoacetyltransacetylase (slr2132) was amplified by PCR using the following primer:

#pta-lfw: 5'- GCCATTGTGGGGGTGGGTCAG -3'

(SEQ ID NO. 31)

#pta-2rv: 5'- CAGTTTATGCCCCGCTACCGGG -3',

(SEQ ID NO. 32)

The PCR fragment was digested with Mfel/ HindIII and cloned into EcoRI/Hindlll sites of cloning vector pUC19 (Ac. No M77789). The chloramphenicol resistance cassette was used from plasmid pACYC184 (Ac. No X06403) and ligated into the

Clal/Pstl restriction sites of slr2132.

The knock-out-construct pUC-pta-Cm has the structure depicted in Figure 25 and the sequence of the insert of plasmid pUC- pta-Cm is presented in Figure 26. 4c) Construction of DNA-vectors for generation of a lactate dehydrogenase mutant

ORF sir 1556 encodes a putative lactate dehydrogense (EC 1.1.1.28), annotated as 2-hydroxyaciddehydrogenase homolog (P74586) with the amino acid sequence shown in Figure 27.

A 1931 bp fragment containing the entire coding sequence from lactate dehydrogenase (slrl556) was amplified by PCR using the following primers:

#ldh-lfw: 5 ' -GCGAACTACCCAACGCTGACCGG-3 '

(SEQ ID NO. 35)

#ldh-2rv: 5'-GCATCAAGTGTTGGGGGATATCCCTG-S' ,

(SEQ ID NO. 36) containing an EcoRV restriction site for cloning (marked in bold letters) .

The PCR fragment was digested with Nhel/ EcoRV and cloned into pBluescript SK+ vector using Xbal/ EcoRV. A kanamycin resistance cassette was cut out of vector pUC4K with BamHI and ligated into the Bglll/Bcll restriction sites of slrl556, resulting in plasmid pBlue-ldh-Kan (see Figure 28) .

Plasmid pBlue-ldh-Kan was used for construction of an

alternative lactate dehydrogenase knock-out vector, in which the kanamycin resistance cassette was substituted by a gentamycin resistance cassette. The Gm cassette was cut out of plasmid pSK-PisiA-PDC-synADH (shown in Fig. 29) by Pstl and Smal (1135bp fragment) and ligated into the Pstl and Hpal sites of pBlue-ldh-Kan .

The knock-out construct pBlue-ldh-Gm has the structure as shown in Figure 30 and the sequence of the insert of pBlue- ldh-Gm is depicted in Figure 31. 4d) Generation of the triple knock out mutant Δack/Δpta/Δldh by transformation of the DNA-vectors (knock-out-constructs) using the natural competence of Synechocystis spec. PCC 6803 for DNA uptake and its system for homologous recombination.

The generation of a triple Δack/Δpta/Δldh knock-out mutant was done in three steps. In a first transformation with construct pBlue-ack-Kan gene slll299 encoding the putative acetate kinase was knocked out in the wild type of Synechocystis, and the corresponding mutant Δack was selected. In a second step, gene slr2132 encoding a phosphoacetyltransacetylase was knocked out in the Δack mutant by transformation with construct pUC-pta-Cm and Δack/Δpta double mutants were selected. Finally a Δack/Δpta double mutant was transformed with construct pBlue-ldh-Gm in order to generate the triple knock-out mutant Δack/Δpta/Δldh. The transformations were done as described above in the "General Protocol for transformation" ( .

When mutants grew on the final antibiotic concentration, individual clones were checked for full segregation of the mutant gene by PCR. In mutant Δack/Δpta/Δldh no wt genes of either ack, pta or ldh could be detected. 5) Generation of self-replicating (extrachromosomal) vectors for the inducible overexpression of ethanologenic enzymes in cyanobacterial mutant strains as second metabolic

enhancements The construction of certain vectors including the petJ promoter were done by using the following general protocol: • EcoRI/BamHI restriction of the pCB4-LR (TF) pa shuttle vector in order to cut off the pdc and adh genes. This shuttle vector was constructed by Dr. John Coleman, University of Toronto, Toronto, Canada. • ligation of the pdc/adh containing EcoRI/BamHI fragment into the cloning vector pDrive (EcoRI/BamHI) . The pDrive vector (Qiagen, Hilden, Germany, GenBank no.: DQ996013) was already described above.

• amplification of the petJ-promoter using chromosomal DNA from Synechocystis sp . PCC 6803 and the following primers (amplified promoter sequence include the ribosome binding site of the petJ-gene) :

petJ-fw-Sall 5' -GTCGACGGGAATTGCTCTGGCAAC-3' (SEQ ID NO. 38)

petJ-rev-EcoRI 5 ' -GAATTCATTAGTTCTCCTTTCAAGG-3'

(SEQ ID NO. 39)

The forward primer included the Sail restriction site and the reverse primer included a EcoRI restriction site for cloning.

• ligation of the Sall/EcoRI cut petJ-promoter fragment into the pDrive-pdc/adh (Sall/EcoRI) generating the construct pDrive-PpetJ-pdc/adh

• Sall/Pstl restriction of pDrive-PpetJ-pdc/adh and ligation of the corresponding promoter-pdc/adh fusions into the self replicating broad-host range vector pVZ321b (Sall/Pstl), a derivate of the pVZ321

(constructed by V. V. Zinchenko Moscow, Russia; described above) with an additional streptomycin resistance cassette/cartridge introduced into the Xbal site of pVZ321.

pVZ321 Gen Bank no.: AF100176 available in the NCBI data base (http : //www . ncbi . nlm. nih . gov/entrez/viewer . fcgi?db=n uccore&id=4323382)

• endproduct of the cloning procedure is the pVZ-vector pVZ321b-PpetJ-pdc/adh (plasmid map and sequences see Fig. 32)

Remark: In all following nt sequences of genes restriction sites (marked in yellow or blue) for clonings as well as translation starts (start codons, marked in green) and translation stops (stop codons, marked in red) are color coded.

Nucleotide and amino acid sequences of adhll and pdc genes from Zymomonas mobilis (source shuttle vector pCB4-LR (TF) pa

[John Coleman] ; fully sequenced by Allen Place on demand of

Algenol Inc. and shown in Figure 33) . The restriction sites in the Adhll and Pdc encoding genes are shown in Figure 34.

The amino acid sequences of Zymomonas mobilis ZmPdc protein and Zymomonas mobilis ZmAdhII protein are depicted in Figures

35 and 36, respectively.

The nucleic acid sequence of the petJ promoter (Synechocystis sp. PCC6803) is shown in Figure 37 (petJ gene: slll796

(encoding for cytochrome c553) ; induced expression under copper starvation) .

Reference :

J Biol Chem. 2004 Feb 20 ; 279 (8) : 7229-33. Epub 2003 Dec 5.

The efficient functioning of photosynthesis and

respiration in Synechocystis sp . PCC 6803 strictly requires the presence of either cytochrome c6 or

plastocyanin .

Duran RV, Hervas M, De La Rosa MA, Navarro JA. The pVZ321b vector (derivate of pVZ321) was constructed by Anne Karradt, Humboldt-University Berlin, Plant Biochemistry Department (Prof. Lockau) , Berlin and has the nucleic acid sequence as depicted in Figure 38 and the structure as shown in the plasmid map of Figure 39.

Introduction of Adh from Synechocyst±s sp. PCC 6803(SynADH) In order to create expression construct as described above but with a different alcohol dehydrogenase, the adh encoding sequence was cut out by Sacl/Pstl digestion of the corresponding pVZ321b-PpetJ-pdc/adh construct. The adh-gene of Synechocystis containing the restriction sites Sacl/Pstl that were introduced by used primer (see below) was ligated into the "adh free" pVZ construct (Sacl/Pstl) resulting in a derivate that expresses the ZmPdc together with SynAdh under control of the petJ-promoter (shown in Fig. 40) .

SynADH-SacI-fw 5 '-ATGAGCTCTCTGGATAAAACTAATAAAC-S'

(SEQ ID NO. 45)

SynADH-Pstl-rev 5' -ATCTGCAGATCGAATGTCAAGCTTTCC-3'

(SEQ ID NO. 46)

The alcohol dehydrogenase SynAdh (Zn-dependent alcohol dehydrogenase) adh gene (slrll92) from Synechocystis sp. PCC 6803 is depicted in Figure 41 and the corresponding amino acid sequence Syn Adh is shown in Figure 42.

Generation of pVZ325 (introduction of Gm resistance cassette into pVZ321b) For the ethanologenic pVZ321b constructs described above, which mediate Streptomycin (St) as well as Kanamycin (Km) resistance, a derivate was created in which the Km resistance was replaced by introduction Gentamycin (Gm) resistance cassette.

The Gm resistance cassette from pVZ322 (V. Zinchenko) was amplified by PCR using the following primer pair:

Gm-Clal-fw 5' -ATCGATGCTCGAATTGACATAAGC-3'

(SEQ ID NO. 48)

Gm-XhoI-rev 5'-ACTCGAGACCGAGCTCGAATTGGC-S'

(SEQ ID NO. 49)

The resultant PCR product was ligated into the pJETl .2/blunt cloning vector (Fermentas) . The Gm resistance cassette was cut out from pJET-Gm using the restriction sites CIaI and Xhol (introduced by the forward and reverse primer, respectively) and ligated into the pVZ321b-PpetJ-PDC-SynADH (Clal/Xhol) . Note: The CIaI restriction site within the PDC coding sequence is methylated by Dam-methylase system of E. coli and therefore not cleavable by CIaI restriction endonuclease .

Due to the introduction of the Gm resistance cassette into the pVZ321b the Km resistance is inactivated but the

resultant pVZ-derivate (pVZ325) now confers resistance against Gm as well as Streptomycin to the recipient (see Fig. 43) .

6. Characterization of the mutant strains harboring at least one first metabolic enhancement regarding pyruvate levels and characterization of mutant strains additionally containing second metabolic enhancements regarding the ethanol

production rate Metabolic mutant strains having a first metabolic enhancement were characterized regarding their growth properties and the extra-cellular metabolite pyruvate in comparison to wild type strains .

Metabolic mutant strains having a first metabolic enhancement and in addition also transformed with Pdc and Adh enzyme as a second metabolic enhancement were characterized regarding growth properties and ethanol production rates in comparison to the appropriate reference strain (s) expressing Pdc and Adh enzyme, but lacking the metabolic mutation (first metabolic enhancement) .

6.1 Cultivation of cyanobacterial wild type and mutant strains

Wild type and mutant strains of Synechocystis PCC 6803 were grown as batch cultures in BGIl medium at 27-28°C. For cultivation of mutants the appropriate antibiotics were added to the medium (kanamycin 75 mg/1; chloramphenicol 10 mg/1; gentamycin 3 mg/1 or streptomycin 10 mg/1) . In order to avoid premature induction of gene expression in mutants having constructs with the PpetJ promoter, these mutants were grown in culture medium supplemented with excess copper (5 x Cu) . Prior to the characterization experiments, two rounds of pre- cultures were grown in BGIl medium (no excess of Cu) , aerated with 0,5% CO2 in air and stirred with a magnetic stir bar (150 rpm) . In each round, the pre-culture was started at an OD750 of 0.5 and grown up to an OD750 of 2.0.

For characterization experiments, wild type and mutant strains were grown in BGIl medium. Mutants having constructs with PpetJ (overexpression or mutants expressing Pdc and Adh enzymes) were transferred to BGIl lacking Cu in order to induce gene expression. The total culture volume was 300 mL in a 500 mL Schott-Flask; the initial OD750 was 1.0. Cultures were aerated with 0,5% CO2 in air and stirred with a magnetic stir bar (150 rpm) .

All mutants were characterized under constant light

conditions (75 - 100 μE m "2 s "1 ) . The length of the light path through the culture for a 300 mL culture in a 500 mL Schott-Flask was 7.5 cm (diameter of the vessel; illumination took place from one side) . In fast growing cultures, the light intensity was increased during the growth experiment (75 - 100 μE m "2 s "1 up to OD4; then 200 μE m "2 s "1 ) .

6.2 Characterization of the growth properties For characterization experiments, metabolic mutants and the appropriate reference strains were cultured as described. Growth was followed for about 14 days by measuring optical density (daily) and chlorophyll concentration (every second day) . Photosynthetic O2 production was determined several times during the exponential growth phase using a Clark electrode as followed:

6.3 Measurement of photosynthetic oxygen evolution and ethanol production rate (short term experiment)

Cells are washed 2x with fresh growth medium by centri- fugation (3000 x g, 10 min, room temperature) and

resuspension . The cells are finally resuspended in growth medium to a chlorophyll concentration of 10 to 15 μg

chlorophyll/ml. Chlorophyll is measured as described by N. Tandeau De Marsac and J. Houmard in: Methods in Enzymology, Vol. 169, 318-328. L. Packer, ed., Academic Press, 1988. The cells are filled into the chamber of a Rank Brothers oxygen electrode (Digital Model 10, Rank Brothers, Cambridge,

England) and sodium bicarbonate is added to a final

concentration of 25 mM. The thickness of the culture was 1 cm so that the length of the light path travelling through the cultures was also 1 cm. (

and the rate of the photosynthetic oxygen evolution is measured for example with a chart recorder REC 112, Amersham Pharmacia Biotech connected to the electrode. The chamber of the oxygen electrode is maintained at a constant temperature (in most cases 28°C) with a circulating, temperature- controlled water bath (RM6, Lauda Brinkmann) . The chamber is translucent and illuminated from the outside. The excitation light for photosynthesis experiments is provided by a slide projector with a 150-watt lamp (Osram, Xenophot HLX Germany). For measurements under standard conditions the light

intensity was adjusted to 400 μE m ~2 s "1 . Light intensities at the oxygen electrode were determined and the distance between light source and the chamber of the oxygen electrode were adjusted accordingly. When the illumination is switched on, photosynthesis starts and an increase of oxygen concentration in the chamber can be observed. After a short period of time the plotted curve is linear. From the linear part of the plotted curve the rate (=photosynthetic oxygen evolution vs. time) is determined. The entire measurement of oxygen is finished after not more than 10 minutes. After completion of this measurement illumination of the sample in the chamber is continued under unchanged conditions. Over a period of one hour samples of 0.15 ml are taken in defined intervals (in most cases every 10 minutes) . Immediately after removal samples are centrifuged (14,000 x g, 10 min, 4°C) and the supernatant is stored on ice. After completion of the

sampling, the ethanol concentration in the supernatants is measured as described herein. The ethanol concentration versus time is plotted. Using the linear equation the rate of the increase of the ethanol content in v/v in the assay per hour is calculated. The rate of ethanol production is usually given in the dimension μmol ethanol * h "1 * mg chlorophyll "1 , the chlorophyll content measured at the beginning of the experiment is then used.

For the calibration of the electrode the signal difference of air-saturated water (100% saturation) and oxygen free water (zero point) is measured. Oxygen free water is obtained by adding sodium dithionite (approximately 1 mg/ml) . The

measured amplitude is equated with the solubility of oxygen in water at 28°C and a pressure of 1013.5 hPa (7.75 mg oxygen/L) .

6.4 Determination of ethanol production

For characterization of mutants expressing PDC and ADH, ethanol was measured daily during the growth experiment according to the afore described optical enzymatic method ("Ethanol UV method" test kit by Boehringer Mannheim / R- Biopharm, Darmstadt, Germany) . Ethanol production of

metabolic mutants expressing PDC and ADH was compared to the appropriate reference strain expressing PDC and ADH as a second metabolic enhancement, but lacking the respective metabolic mutation, the first metabolic enhancement.

Principle of ethanol quantification: Ethanol is oxidized by nicotinamide-adenine dinucleotide (NAD + ) to acetaldehyde in a reaction, which is catalyzed by the enzyme alcohol dehydrogenase (ADH) (reaction 1) . The acetaldehyde, which is formed in the reaction, is quantitatively oxidized to acetic acid by the enzyme aldehyde dehydrogenase (Al-DH) (reaction 2).

(1) ethanol + NAD + 5==~=→ acetaldehjde + NADH+H 4

(2) acetaLdehyde+NAD* + H 2 O fJlEE ». icetic icid + NADH+H*

In reactions ( 1 ) and ( 2 ) reduced nicotinamide-adenine dinucleotide (NADH) i s formed . The amount of NADH formed i s proportionate to the amount of ethanol in the sample . NADH i s eas i ly quanti f ied by means of its l ight absorbance . The absorbance i s usual ly measured at 340 nm, Hg 365 nm or Hg 334 nm .

Procedure : Preparation of solutions: Solution 1: 1.3 mg/ml NAD and 0.27 U aldehyde dehydrogenase in potassium diphosphate buffer, pH 9.0. Solution 2: Suspension of alcohol dehydrogenase (ADH) with approx. 4000 U/ml . Alternatively, the chemicals and solutions of the ethanol determination kit of Boehringer Mannheim/R-Biopharm (Cat. No. 10 176 290 035) can be used.

Sample and solution 1 are mixed in a ratio of 3 ml solution 1 and 0.1 ml sample (if necessary the sample is diluted with water) . After approx. 3 min the absorbance is measured (Ai) . The reaction is then started by the addition of ADH suspension (solution 2, 0.050 ml for 3 ml solution 1 and 0.1 ml sample) . After completion of the reaction (approx. 5 to 10 min) the absorbance is measured again (A 2 ) . The absorption measurements can be performed using a photometer or a microplate reader. For plate reader measurements all volumes are downscaled. From the measured absorbance difference ΔA = (A 2 -Ai) the ethanol concentration in the sample is calculated with the equation :

¥ K MG

c = :ΔA

U sc d x w jt 2 ic 1000 c, ethanol concentration [g/L] ; V, total volume [mL] ; MG, molecular weight of ethanol (46.07 g/mol) ; e, extinction coefficient (6.3 L x mmol "1 x cm "1 at 340 nm) ; d, light path [cm] ; v, sample volume [mL]

Literature:

Protocol of the kit Ethanol, UV method for the determination of ethanol in foodstuff and other materials, Cat. No. 10176290035, R-Biopharm AG, Darmstadt, Germany.

H. -O. Beutler (1984) in: Methods in Enzymatic Analysis (Bergmeyer, H. U. ed.) 3 rd ed. Vol. VI, pp. 598-606, Verlag Chemie, Weinheim, Germany.

6.5 Determination of extracellular pyruvate

The extracellular content of pyruvate was measured at 3 times during a 14 days cultivation periode (usually at day 5, 9,

14) using the optical enzymatic test of Hausler et al .

(2000), Anal. Biochem, 281:1-8.

This method allows for the quantification of pyruvate and phosphoenolpyruvate in one test.

Protocol : Quantifications are based on the reduction of pyruvate to lactate by lactate dehydrogenase (LDH) at the expense of NADH which is oxidized to NAD+. In the first step, pyruvate was assayed. After completion of this reaction, pyruvate kinase is added. Pyruvate kinase converts phosphoenolpyruvate to pyruvate and thus allows for determination of

phosphoenolpyruvate .

To 450 μl master mix (9 μl 20 mM NADH, 12 μl 1 M MgC12, 46 μl 1 M KCl, 12 μl 100 mM ADP, 360 μl 100 mM HEPES, 10 μl H2O) 520 μl sample (if necessary diluted with H2O) are added. Two μl LDH are added to start the reaction. The oxidation of NADH is observed as a decrease of absorbance at 340 nm. Either the difference of the absorbances at 340 nm minus 380 nm is measured by difference spectroscopy (turbid or colored samples; ε340-380 = 4.83 1 x cm x mmol-1) or the absorbance at 340 nm is measured against water (ε 340 = 6.28 1 x cm x mmol-1). After complete reaction of pyruvate, 2 μl pyruvate kinase are added to the assay. NADH oxidation is measured as before. From the differences of the absorbances at the start and the end of the reactions, the amount of oxidized NADH (= amount of pyruvate, and phosphoenolpyruvate, respectively) is calculated.

Chemicals and solutions:

1. Lactate dehydrogenase suspension from bovine heart (L- LDH, Sigma L2625-2.5KU, suspension with 5629.5 U/ml) , diluted 1:10

2. Pyruvate Kinase from rabbit muscle (PK, Serva 34085, suspension with 4000 U/ml), diluted 1:20

3. 100 mM HEPES/NaOH (pH 7.5)

4. I M MgC12

5. 100 mM ADP 6. NADH (Sigma, N6005) 20 mM in H2O

7. I M KCl

6.6 Characterization of the metabolic mutants overexpressing both malic enzyme and malate dehydrogenase or overexpressing either malic enzyme or malate dehydrogenase

Mutants PCC6803 PpetJ-me, PpetJ-mdh and PpetJ-me/mdh were examined in comparison to the Synechocystis wild-type strain under constant light conditions as described. Expression of me and mdh genes was induced by copper starvation.

RESULTS:

No significant differences could be detected in cell growth, chlorophyll content and photosynthetic oxygen production between Synechocystis PCC6803 wild type and mutants PCC6803 PpetJ-me, PpetJ-mdh and PpetJ-me/mdh, respectively.

An enhanced extracellular pyruvate level was detected in the medium of all three mutants following induction of gene expression by copper starvation. The following table shows the extracellular pyruvate concentrations measured 7 and 14 days after induction in comparison to the wild type.

The higher extracellular pyruvate levels measured in the induced PCC6803 PpetJ-me, PpetJ-mdh and PpetJ-me/mdh mutants (compared to wildtype) suggest that overexpression of malic enzyme or malate dehydrogenase leads to a higher pyruvate level within the cyanobacterial cells. Mutants PCC6803 PpetJ-me/pVZ325-PpetJ-PDC-synADH, PCC6803 PpetJ-mdh/pVZ325-PpetJ-PDC-synADH and PCC6803 PpetJ- me/mdh/pVZ321b-PpetJ-PDC-ADHII expressing ethanologenic genes were examined regarding their growth properties and ethanol production rates in comparison to the reference strains

PCC6803 pVZ325-PpetJ-PDC-synADH and PCC6803 pVZ321b-PpetJ- PDC-ADHII. The expression of me, mdh and the ethanologenic genes was induced by copper starvation. The cultivation conditions under constant light were as described.

RESULTS

Mutants PCC6803 expressing me, mdh or both genes exhibited significantly higher ethanol production rates compared to the reference strains.

The following table shows the ethanol production rate

relative to cell growth (given as the slope of ethanol production [ % ] per OD 750n In and day .

At two consecutive days during the logarithmic growth phase, photosynthetic capacity and ethanol production was measured in the oxygen electrode as described.

In these short-term measurements photosynthetic activity is measured under optimized conditions (saturating light and carbon supply) . Results represent the maximal photosynthetic capacity of cells rather than the real photosynthetic activity during cultivation.

Values are the means of two consecutive measurements.

These results clearly show that by increasing the enzymatic activity of either malic enzyme or malate dehydrogenase by overexpression or co-overexpression of both enzymes (first metabolic enhancements) , the ethanol production rate of photoautotrophic host cells, in particular cyanobacterial cells can be increased compared to the respective wild-type cyanobacterial cells lacking these first metabolic

enhancements .

6.7 Characterization of the metabolic mutant overexpressing both phosphoketolase and phosphoacetyltransacetylase The mutant PCC6803 pVZ-PpetJ-phk-pta was characterized regarding its growth properties and extracellular pyruvate in comparison to wild type strain Synechocystis PCC6803.

RESULTS:

No significant differences could be detected in cell growth, chlorophyll content and photosynthetic oxygen production between the Synechocystis PCC6803 wild type and the mutant. Excretion of pyruvate into the medium could be detected at the end of the log phase and was increased in the mutant compared to the wild type. The optical density at 750nm (OD 7 50nm) and the concentration of pyruvate in the medium are given at two time points at the end of the log phase. These results clearly indicate that overexpression of both phosphoketolase and phosphoacetyltransacetylase as first metabolic enhancements results in an enhanced level of pyruvate, which can be used by ethanologenic enzymes (second metabolic enhancement) for enhanced ethanol production.

9 days 14 days

OD 7 50nm pyruvate [ mM] OD 7 50nm pyruvate [ mM]

PCC 68 03 wt 7 85 0 . 00 6 9 . 52 0 . 010

PCC 68 03 pVZ - 7 37 0 . 00 9 9 . 38 0 . 020

Ppet J-phk-pta

6.8 Characterization of the metabolic mutant overexpressing aldehyde dehydrogenase The mutant PCC6803 pVZ-PpetJ-aldh was characterized regarding its growth properties and extracellular pyruvate in

comparison to wild type strain Synechocystis PCC6803. RESULTS:

No significant differences could be detected in cell growth, chlorophyll content and photosynthetic oxygen production between the Synechocystis PCC6803 wild type and the mutant. Excretion of pyruvate into the medium could be detected at the end of the log phase and was increased in the mutant compared to the wild type. The optical density at 750nm (OD 7 50nm) and the concentration of pyruvate in the medium are given at two time points at the end of the log phase. These results show that an enhancement in pyruvate production can be achieved by overexpressing aldehyde dehydrogenase as a first metabolic enhancement.

9 days 14 days

OD 7 50nm pyruvate [ mM] OD 7 50nm pyruvate [ mM]

PCC 68 03 wt 7 . 84 0 . 005 9 . 22 0 . 005

PCC 68 03 pVZ - 8 . 14 0 . 005 8 . 50 0 . 021

PpetJ-aldh

6.9 Characterization of the metabolic triple Δack/Δpta/Δldh knock-out mutant affecting lactate dehyrogenase (ldh) ,

acetate kinase (ack) and phosphoacetyltransacetylase (pta) as first metabolic enhancements

The triple knock-out mutant Δack/Δpta/Δldh was characterized regarding its growth properties and extracellular pyruvate in comparison to wild type strain Synechocystis PCC6803. RESULTS:

No significant differences could be detected in cell growth, chlorophyll content and photosynthetic oxygen production between the Synechocystis PCC6803 wild type and triple knockout mutant Δack/Δpta/Δldh.

Excretion of pyruvate into the medium could be detected at the end of the log phase and was increased in the mutant compared to the wild type. The optical density at 750nm (OD 7 50nm) and the concentration of pyruvate in the medium are given at two time points at the end of the log phase.

11 days 15 days

OD 7 5 Onm pyruvate [ mM] OD 750nm pyruvate [ mM]

PCC 6803 wt 8 . 3 0 . 003 11 . 5 0 . 005

Δack/Δpta/Δldh 6 . 7 0 . 010 9 . 8 0 . 015

The scope of protection of the invention is not limited to the examples given hereinabove. The invention is embodied in each novel characteristic and each combination of characteristics, which particularly includes every combination of any features which are stated in the claims, even if this feature or this combination of features is not explicitly stated in the claims or in the examples.