Method of Administering Soluble T4 For Treatment of Human Immunodeficiency Virus Infection

- ^{• '} Field of the Invention

This invention relates to a pharmaceutical formulation for parenteral administration and more particularly to a pharmaceutical formulation for treatment - of human immunodeficiency virus (HIV) infection.

Background of the Invention

HIV, the etiological agent of acquired immune ⁵ deficiency syndrome (AIDS), shows a marked affinity for CD-4 lymphocytes. The human T-cell glycoprotein CD4, sometimes previously referred to as "T4", is one of several non-polymorphic T lymphocyte surface receptor proteins that have been implicated in the mediation of 0 efficient interactions of lymphocytes with other cells. Analysis of these surface proteins indicates that mature

l T lymphocytes segregate into two classes on the basis of their predominant expression of either the T4 or T8 surface glycoprotein. The CD-4 molecule is predominantly expressed on helper T lymphocytes whereas T8 is expressed 5 on cytotoxic and suppressor T cells. The CD-4 lymphotropic character of the virus can be explained by its specific binding to the CD-4 receptor. Monoclonal antibodies directed against CD-4 block HIV infection of CD-4 cells in vitro. Human cells lines, nonlymphoid as 10 well as lymphoid, which lack the CD-4 receptor cannot be infected by HIV, but these cells become susceptible to infection upon introduction and expression of the cloned CD-4 (T4) gene. AIDS results in the impairment, and ultimately the depletion, of CD-4 lymphocytes with τ_5 consequent dysfunction of the cellular immune response.

Infection of cells by HIV is believed to occur following binding of the viral envelope glycoprotein, gpl20, to cellular CD4. sT4, a soluble (i.e. secreted) recombinant form of CD4, binds gpl20 and inhibits both 0 viral infectivity and HIV-mediated εyncytia formation.

A cDNA sequence of the human CD-4 (T-4) receptor has been described (Maddon, et al. , Cell 43 _^ :93 (1985)). The complete CD-4 pre-protein sequence is 458 amino acids in length comprising the putative 23 amino acid secretory 5 leader, 372 amino acid surface ^,-V.) , 23 amino acid transmembrane and 40 amino acid cytoplasmic domains. The surface domains shows four regions of limited homology, 20-30%, to immunoglobulin variable (V) and joining (J) regions. Four of the five intron-exon boundaries in the _Q surface domain occur near the junctions of these V-J regions. On the basis of partial protein sequence information for the mouse and sheep T4 proteins (Classon, et al. , Immunogen. 23 _^ :129 (1986), it appears that the 6 cysteines in the surface domain are paired sequentially to ₅ give three disulfide bonds. There are two possible sites for N-linked glycosylation based on amino acid sequence.

l The V-J homology, cysteine pairing and intron-exon structure suggest that CD-4(T-4) shares some structural similarities with the immunoglobulins.

As a prophylactic, sT4 is administered to individuals at high-risk for the disease or individuals who show exposure to HIV by the presence of antibodies to virus. Administration of an effective amount of sT4 at an early stage of the disease or prior to its onset acts to inhibit infection of T4 lymphocytes by HIV. As a therapeutic, administration of sT4 to persons infected with HIV acts to inhibit extracellr ir spread of the virus.

Recently, a number of scientific investigators have reported their findings related to the interaction between soluble forms of CD-4 and the AIDS infection. Deen, et al. , Nature 331:82 (1988) report the isolation and expression of sCD-4 in several cellular environments.

Capon, et al. , Nature 33 : 525-531, (9 Feb. 1989) reported hybrid antibody-like molecules containing the gpl20-binding domain of the receptor HIV. These molecules block HIV-1 infection of T cells and monocyteε, have a long plasma half-life and other antibody-like properties.

Watanabe et al. , Nature 337: 267-270, (19 Jan. 1989) reports effects of recombinant soluble CD4 in rhesus monkeys infected with simian immunodeficiency virus of macaques. Monkeys were given a 50 day course of treatment, receiving daily 2 mg intramuscular (i.m.) inoculations of recombinant CD4. Virus was readily isolated from peripheral blood lymphocytes and bone marrow cells of the animals before starting treatment with soluble CD4, but became difficult to isolate soon after treatment began.

U.S. Patent number 4,597,966 issued July 1, 1986 to Zolton discloses histidine-stabilized immunoglobulin preparations and a method for their manufacture. The immunoglobulin preparations comprise immunoglobulin in a

1 histidine buffer. Histidine is present in the preparations at a concentration sufficient to inhibit aggregation of the immunoglobulin.

Because sT4 proteins have shown promise in early 5 studies as a useful agent for the prevention, treatment, and delay of progression of HIV-related disease states, there now exist needs for pharmaceutical formulations of sT4 and for methods for administering sT4 to people. Obtainment of these and other objects of the τ_0 invention are fully disclosed herein below. Summary of the Invention

The invention provides a method of inhibiting onset or progression of immune disorders associated with HIV infection in a human which comprises subcutaneously administering a soluble T4 protein to the person. Soluble T4 is preferably subcutaneously administered to the affected individual in an amount of from about 0.1 to about 3.0 mg/kg/day. Detailed Description of the Invention o Subcutaneous administration of sT4 provides a higher sustained blood level of sT4 and an extended apparent circulating half life of sT4 when compared with intravenous administration. Administration of soluble T4 is convenient for patients. Administration can be 5 accomplished in minutes, in contrast to the hours currently needed for administration of CD4 by continuous infusion. Administration of sT4 subcutaneously avoids the pain and bruising that often accompany intramuscular injection. This can be a significant advantage for 0 persons who may have to receive sT4 daily, or at other frequent intervals, in addition to other treatments for HIV infection and related illnesses.

When administering subcutaneously, a patient will typically receive a dosage of 0.1 to 3.0 mg/kg/day of an 5 sT4 protein in a single dose per day, preferably a dosage of 0.1 to 1.0 mg/kg/day of an sT4 protein in a single dose per day. A pharmaceutical composition of sT4 in a single

dose per day. A pharmaceutical composition of sT4 may be injected into the anterior abdominal wall. If the total amount of the dose exceeds about 1.3 to 1.5 ml, the dose may be divided into two or more portions and injected into separate sites.

Suitable pharmaceutical compositions for administration comprise an sT4 protein, in combination with histidine, and, preferably, a non-ionic surfactant. The pharmaceutical cc. positions of the invention may also optionally include one or more of a bulking agent, a bacteriostatic agent and a cryoprotective agent. The pharmaceutical compositions of the invention are provided in aqueous and lyophilized forms. The lyophilized form is preferred for storage and is reconstituted, such as with sterile water for injection, prior to use. An "sT4 protein" is a protein or polypeptide which has substantiallly the same HIV gpl20-binding function and structure as the CD4 receptor on T4 lymphocytes. The preferred sT4 protein is sT4. εT4 can be produce by standard recombinant DNA techniques. A DNA coding sequence and amino acid sequence of sT4 are illustrated below.

10 30 50

CAAGCCCAGAGCCCTGCCATTTCTGTGGGCTCAGGTCCCTACTGCTCAGCCCCTTCC TCC

70 90 110

CTCGGCAAGGCCACAATGAACCGGGGAGTCCCTTTTAGGCACTTGCTTCTGGTGCTG CAA MetAsnArgGlyValProPheArgHisLeuLeuLeuValLeuGln

130 150 170

CTGGCGCTCCTCCCAGCAGCCACTCAGGGAAAGAAAGTGGTGCtGGGCAAAAAAGGG GAT LeuAlaLeuLeuProAlaAlaThrGlnGlyLysLysValValLeuGlyLysLysGlyAap -9 -1 +1

190 210 230 ACAGTGGAACTGACCTGTACAGCTTCCCAGAAGAAGAGCATACAATTCCACTGG AAAAC ThrValGluLeuThrCysThrAlaSerGlnLysLysSerlleGlnPheHisTrpLysAsn

250 270 290

TCCAACCAGATAAAGATTCTGGGAAATCAGGGCTCCTTCTTAACTAAAGGTCCATCC AAG SerAsnGlnlleLysIleLeuGlyAsnGlnGlySerPheLeuThrLysGlyProSerLys

310 330 350

CTGAATGATCGCGCTGACTCAAGAAGAAGCCTTTGGGACCAAGGAAACTTCCCCCTG ATC LeuAsnAspArgAlaAspSerArgArgSerLeuTrpAspGlnGlyAsnPheProLeuIle

370 390 410

ATCAAGAATCTTAAGATAGAAGACTCAGATACTTACATCTGTGAAGTGGAGGACCAG AAG IleLysAsnLeuLysIleGluAspSerAspThrTyrlleCysGluVAlGluAspGlnLys 430 450 470

GAGGAGGTGCAATTGCTAGTGTTCGGATTGACTGCCAACTCTGACACCCACCTGCTT CAG GluGluValGlnLeuLeuValPheGlyLeuThrAlaAsnSerAspThrHisLeuLeuGln

104

490 510 530

GGGCAGAGCCTGACCCTGACCTTGGAGAGCCCCCCTGGTAGTAGCCCCTCAGTGCAA TGT GlyGlnSerLeuThrLeuThr euGluSerProProGlySerSerProSerValGlnCys

550 570 590

AGGAGTCCAAGGGGTAAAAACATACAGGGGGGGAAGACCCTCTCCGTGTCTCAGCTG GAG ArgSerProArgClyLysAsnlleGlnGlyGlyLysThrLeuSerValSerGlnLeuGlu

610 630 650

CTCCAGGATAGTGGCACCTGGACATGCACTGTCTTGCAGAACCAGAAGAAGGTGGAG TTC LeuGlnAspSerGlyThrTrpThrCysThrValLeuGlnAsnGllnLysLysValGluPh 151

670 690 710

AAAaTAGACATCGTGGTGCTAGCTTTCCAGAAGGCCTCCAGCATAGTCTATAAGAAA G LysIleAspIleValValLeuAlaPheGlyLysAlaSerSerlleValTyrLysLysG

183

730 750 770 GGGGAACAGGTGGAGTTCTCCTTCCCACTCGCCTTTACAGTTGAAAAGCTGACGGGCA GlyGluGlnValGluPheSerPheProLeuAlaPheThrValGluLysLeuThrGlyS

790 810 830

GGCGAGCTGTGGTGGCAGGCGGAGAGGGCTTCCTCCTCCAAGTCTTGGATCACCTTT G GlyLGluLeuTrpTrpGlnAlaGluArgAlaSerSerSErLysSerTrpIleThrPhe 850 870 890

CTGAAGAACAAGGAAGTGTCTGTAAAACGGGTTACCCAGGACCCTAAGCTCCAGATG GG Leu ysAsnLysGluValSerValLysArgValThrGlnAspProLysLeuGlnMetGl

910 930 950

AAGAAGCTCCCGCTCCACCTCACCCTGCCCCAGGCCTTGCCTCAGTATGCTGGCTCT GG LysLysLeuProLeuHisLeuThrLeuProGlnAlaLeuProGlnTyrAlaGlySerGl 970 990 1010

AACCTCACCCTGGCCCTTGAAGCGAAAACAGGAAACTTGCATCAGGAAGTGAaCCTG GT AsnLeuThrLeuAlaLeuGlyAlaLysThrGlyLysLeuHisGlnjGluValAsnLeuV

1030 1050 1070

GTGATGAGAGCCACTCAGCTCCAGAAAAATTTGACCTGTGAGGTGTGGGGACCCACC TC ValFMetArgAlaThrGlnLeuGlnLysAsnLeuThrCysGluValTrpGlyProThrS

1090 1110 1130

CCTAAGCTGATGCTGAGCTTGAAACTGGAGAACAAGGAGGCAAAGGTCTCGAAGCGG GA ProLysLeuMetLeuSerLeuLysLeuGluAsnLysGluAlaLysValSerLysArgGl

1150 1170 1190

AAGGCGGTGTGGGTGCTGAACCCTGAGGCGGGGATGTGGCAGTGTCTGCTGAgTGAC TC LysAlaValTrpValLeuAsnProGluAlaGlyMetTrpGlnCysLeuLeuSerAspSe

1210 1230 1250

GGACAGGTCCTGCTGGAATCCAACATCAAGGTTCTGCCCACATGGTCCACCCCGGtg ta GlyGlnValLeuLeuGli.SerAsnlleLysValLeuProThrTrpSerThrProValEn 351 369

1270 tggcgcctctaga

The above sT4 protein is illustrative only. For example, amino acids can be added, deleted or substituted for residues illustrated above. Such added or substituted amino acids can be homologous, i.e. derived for CD4 receptor or alleles or other naturally-occurring variants thereof, or heterologous, i.e., derived from other proteins or polypeptides. The added or substituted amino acids can, but are not required to, serve to add a function to the protein, such as molecular targeting or cell killing, or to enhance gene expression or protein stability. Amino acids can also be deleted so long as GP120 binding activity is not diminished beyond the point at which the protein ceases to be useful in preventing, treating or delaying the onset of disease states associated with HIV infection.

The above-illustrated sT4 Protein, or variants or derivatives thereof as discussed above, can also be modified post-translationally, such as by chemically conjugating other polypeptides or other functional compounds to the sT4 or variant thereof.

Thus, this invention also encompasses sT4 variants and derivatives of sT4, including genetically-made and chemically-made variants and derivatives. It has been found that in order to preserve HIV GP120 binding, it is important to retain at least a part of the VI domain, and preferably, also a part of the Jl and/or V2 domains. Thus, an sT4 Protein which may be used in this invention preferably substantially comprises, with reference to the above-illustrated sequence, at least about amino acids 16 to at least about amino acid 104. In the description which follows, this invention is described in terms of sT4, the preferred sT4 Protein. However, it should be understood that the invention also encompasses other sT4 proteins. Such sT4 derivatives, and methods for their production by recombinant DNA techniques are disclosed for

example in PCT WO/US87/02050; U.S. patent application Serial Number 112,800, filed October 23, 1987; and U.S. patent application Serial Number 160,463, filed February 24, 1988, all of which are specifically incorporated by reference as if fully set forth herein. The concentration of histidine buffer in the pharmaceutical composition of the invention is selected to maintain approximately neutral pH, e.g., pH 6.7 to 7.3, preferably pH 6.8 to 7.2, and more preferably at pH 7. Typically the concentration of histidine is 20 mM to

200 mM, preferably about 30 mM to about 75 mM, and more preferably about 50 mM. Histidine buffer is prepared by standard techniques, e.g., adding hydrochloric acid to 50 mM (7.8 mg -histidine/ml) in water to a selected pH within the range useful in the invention.

Additional buffering agents, organic and inorganic, can also be employed. For example, the formulation can comprise a phosphate buffer at a concentration of about 50 mM. However, it has 1 found, unexpectedly, that use of histidine at the lower •_.-.___ of the above concentration range, in an absence of phosphate buffer, results in fewer precipitation problems than otherwise.

It is also contemplated that additional amino acids, such as basic amino acids, can also be employed in the pharmaceutical composition of the invention. Amino acids which have been used in protein formulations include, e.g., glycine, alanine, lysine, ornithine and arginine. See, e.g., U.S. 4,597,966 (histidine and glycine in immunoglobulin formulations); U.S. 4,496,537 (alanine or glycine in alpha-interferon formulations); EP-A-156,169 (lysine or ornithine in tPA formulations; JP 125,306 (Derwebt 88-024381/04) (arginine in tPA formulation).

Depending on the method used to purify sT4, it may be necessary to remove buffers containing undesired components before preparing the pharmaceutical compositions. Removal of other buffers may be readily

accomplished by conventional techniques such as conventional buffer exchange techniques. It may also be necessary to dilute or concentrate the sT4 before preparing the pharmaceutical compositions of the invention if the method used to prepare sT4 results in a solution of sT4 in buffer having a greater or smaller concentration of sT4 than is used in the invention.

Non-ionic surfactants suitable for use in the invention preferably have little toxicity to humans and do not cause hemolysis of red blood cells to a significant extent. Suitable non-ionic surfactants include, but are not limited to, polysorbates (or polyoxyethylenesorbitans) such as polysorbate 20 (monolaurate) , polysorbate 60 (monostearate) and polysorbate 80 (monoloeate) . A preferred non-ionic surfactant is polysorbate 80.

Polysorbate 80 is generally sold under the trade name of Tween 80 others. The non-ionic surfactant is prefereably present in the pharmaceutical composition in the amount of from about 0.01% to about 0.6%, preferably in the amount of about 0.05%. For example, use of 0.05% Tween 80 (i.e., 0.5 mg/ml)has been shown to enhance solubility of sT4 and reduces nephrotoxicity.

Sugars useful in the pharmaceutical compositions of the invention serve as bulking agents and tonicity modifiers. Suitable sugars include sugars such as mannitol, sucrose, trehalose and sorbitol. A preferred sugar is the sugar alcohol mannitol. It has been found that mannitol produces an isotonic formulation and protects against hemolysis. The sugar is present in the pharmaceutical composition in an amount of about 3% to about 7% w/w, preferably in the amount of about 4.5% w/w.

In addition to sT4 and buffer, the pharmaceutical compositions of the invention may optionally contain other agents suitable for parenteral administration, such as bacteriostatic agents, tonicity modifiers, and cryoprotective agents. Suitable bacteriostatic include

1 benzyl alcohol and methyl and propyl parabens. Sodium chloride, which has in the past been used to modify tonicity, has been shown to adversely affect the solubilit of sT4. A hydrophilic polymeric cryoprotective agent such as hydroxyalkyl cellulose, gelatin, acacia gum, polyvinylpyrrolidone (e.g. molecular weight 10,000 to 60,000) and polyalkylene glycols, such as polyethylene Glycols (e.g. molecular weight 4,000 to 40,000) may be 10 included in the pharmaceutical compositions of the invention. Use of such agent increases stability (that is, minimizes loss of activity and protein degradation) in solution, on lyophilization and upon reconstitution following lyophilization. ■ _j c The stability of the pharmaceutical composition of the invention is increased at low temperature. Thus, they are preferably stored at temperatures in the range of -70°C to 15C, preferably at about -40°C or at about 4°C to about 8°C, more preferably at about 4°C to about 8°C. The o lyophilized compositions are preferably administered within eight hours after reconstitution and are preferably kept at 4°C to 8°C as described above after reconstitution.

The pharmaceutical composition of the invention can be contained within a pharmaceutical dosage unit, i.e. 5 a sterile container, such as an ampoule, syringe, vial, bottle or bag, prepared so as to deliver to a patient, especially a human patient, in need of treatment or prevention for human immunodeficiency virus infection an effective amount of sT4 parenterally, especially ₀ intravenously, subcutaneously, and intramusculary. The precise concentration of sT4 in the pharmaceutical dosage unit as well as the precise dose volume of a given dose will depend on the such factors as the severity of symptoms of HIV infection and weight of the patient. Optimization of a given dose of the pharmaceutical compositions of the invention can be carried out in accordance with standard pharmaceutical and medical practice. The concentration of

sT4 in each pharmaceutical dosage unit can exceed

100 mg/ml. Preferably the concentration of sT4 is in the range of about 5 to about 50 mg/ml, more preferably, to 10 to 40 mg/ml. A patient will typically receive a dosage of 0.1 to 3.0 mg/kg/day of sT4, preferably a dosage of about 0.1 to about 1.0 mg/kg/day. Such treatment can be continued indefinitely, as indicated by monitoring of clinical parameters, e.g., T4 and T8 cell counts and T4:T8 cell ratios. For intramuscular administration, the pharmaceutical composition of the invention is administered by injection into a large muscle, such as the anterior thigh. If the total volume of the dose exceeds about 5 ml, the dose may be divided into portions and injected into two or more sites. For subcutaneous administration the pharmaceutical compositions may be injected into the anterior abdominal wall. If the total amount of the dose exceeds about 1.3 to 1.5 m., the dose may be divided into two or more portions and injected into separate sites. It may be necessary to use multiple pharmaceutical dosage units of the invention for each administration of an sT4 protein.

In a preferred embodiment of the invention, the pharmaceutical compositions are stored in lyophilized form for eventual reconstitution with a reconstitution solution such as sterile water or 5% dextrose in sterile water. The lyophilized pharmaceutical compositions are prepared by lyophilizing the aqueous form of the pharmaceutical composition using conventional techiqueε. The lyophilized pharmaceutical compositions are preferably stored in single dose units for convenience of administration, however, it may be stored in larger quantities in the lyophilized form. The lyophilized composition can be stored in a sterile vial or other container for dispensation with a sterile container of a solution for reconstitution and eventual or immediate parenteral administration. In preparing the pharmaceutical formulation for lyophylization, the aqueous solution can be dilute than the

final reconstituted pharmaceutical compositions. For example, 1 ml of an aqueous solution having 12.5 mg/ml of sT4 is lyophilized, and later reconstituted with 0.5 ml sterile water to provide a solution having 25 mg/ml sT4. In another preferred embodiment of the invention, the invention is a kit comprising one or more sterile containers of the pharmaceutical composition in lyophilized form and one or more separate sterile containers of solution for reconstitution. The reconstitution solution may also be contained within a different compartment of a multi-compartment container, e.g., a dual compartment syringe designed for convenient mixing and administration. In .such syringe or other dual compartment container, the lyophilized sT4 and the solution for reconstitution are separated by a membranous barrier which can be ruptured, e.g., by squeezing the syringe or container, thereby mixing the sT4 and the solution for reconstitution. The solution for reconstitution, the amount of sT4 and the amount of solution for reconstitution in a single kit are selected so as to provide a final reconstituted product having from about 5 to about 50 mg/ml of sT4, preferably 10 to 45 mg/ml of sT4 at a pH selected in accordance with this invention. A preferred solution for reconstitution is sterile water. The solution for reconstitution may also contain bacteriostatic agents or other substances suitable for parenteral administration.

Examples

Examples 1-4 below illustrate pharmaceutical dosage units of the invention.

Example 1

A sterile syringe is filled with a sterile solution of:

Example 2

A sterile vial is filled with a sterile solution of:

Example 3

A sterile syringe is filled with a sterile solution of

sT4 12.5 mg 25 mg/ml L-histidine 3.9 mg 50 mM water 0.5 ml hydrochloric acid (to pH7.3)

Example 4

A sterile vial is filled with a sterile solution of:

sT4 5.0 mg 10/mg/ml

L-histidine 3.9 mg 50 mM water 0.5 ml hydrochloric acid (to pH 6.8)

Example 5 - Lyophilization

A bulk, sterile solution is prepared containing sT4 (10 mg/ml), L-histidine (7.8 mg/ml), mannitol (45 mg/ml), polysorbate 80 (0.5 mg/ml), hydrochloric acid (to pH 7) and water. 0.5 ml of the bulk solution is placed into a 3ml glass vial. The bulk solution is then lyophilized. Vials containing the bulk solution are placed into a freeze dryer (Hull, Hatboro, Pennsylvania) and frozen overnight on a -40°C shelf and then dried according to the appropriate cycle. The vials were then sealed. For reconstitution, 0.5 ml of sterile water is added to the vial to provide sT4 at 10 mg/ml in 50 mM histidine buffer with mannitol 4.5% w/w and 0.05% polysorbate 80.

Example 6

A bulk solution of the formulation of Example 2 is prepared containing 12.5 mg/ml sT4, L-histidine 3.9 mg/ml, mannitol 22.5 mg/ml, polysorbate 80 0.25 mg/ml, hydrochloric acid (to adjust pH) and water. 1 ml of the bulk solution is placed into a 3ml glass vial. The bulk solution is then lyophilized. Vials containing the bulk

solution are placed into a freeze dryer (Hull, Hatboro, Pennsylvania) and frozen overnight on a -40°C shelf and then dried according to the appropriate cycle. The vials were then sealed. For reconstitution, 0.5 ml of sterile water is added to the vial to provide sT4 (25 mg/ml) in 50 mM histidine buffer with mannitol (4.5% w/w) and 0.05% polysorbate 80.

Example 7 - Stability Studies The chemical stability of the lyophilized formulation of sT4 in Example 5 at temperatures ranging from -70C to 40C is shown in Table 1. Chemical stability was tested by a binding assay (OKT4aELISA) and a cellular assay (inhibition of synctyia formation). The chemical stability of an injectable solution of sT4 was also subjected to storage at various temperatures and tested by the same assays for activity at different times. At -70°C, and at 5°C no deterioration in activity of sT4 was noted after 9 months of storage. At -15°C, one third of the initial activity was lost after 9 months storage. At 25°C, over one third of the initial activity was lost after 9 months of storage. At 30°C, half the initial activity was lost after 6 months of storage, and nearly two thirds of the initial activity was lost after 9 months of storage. At 40°C, only a small amount of activity was detectable after two months and six days of storage. In diffused light, over two thirds of the initial activity was lost after fourteen days of storage.

Table 1 The Chemical Stability of sT4 Injectable Solution STORAGE CONDITIONS RESULTS OF ANALYSES

Specific Activity

Temperature Time Binding Assay Cellular Assa (C) (OKT4a ELISA) (Syncytia)

Initial 1.04 0.81

-70

0.98

04 16 8

-15

1.07 0.14

1.02

0.82

1.05

0.7 5

0.87

0.63 0.68 0.22

0.780

0.334 0.426 0.12

0.16 0.083

Table 2 The Chemical Stability of sT4 Lyophilized Product (sT4 in 50 mM histidine, mannitol (4.5% w/w) and Tween 80 (0.05%).

-70

6.0 7

5.1 7

30

5.7 6

40

5 8

- Solubility o sT4 n p osp ate uffer with excipients added

Excipients were added to sT4 (2.16 mg/ml) in 50mM Na3Pθ (pH 7.0). The initial solution appeared hazy with paticulates visible. The initial solution was divided into two portions for the purpose of adding selected additional excipients in order to determine the effect of the additional excipients on the solubility of sT4. To one portion, the additional excipients were added after filtering out of the initial precipitate. The other portion was not filtered prior to adding of the additional excipients. The filtered portion was filtered through a .22 unfiltered or filtered initial solution and the ampoules were shaken for 16 hours at 5C. At the end of 16 hours, each ampoule was visually inspected for precipitate and was given a score according to the amount of precipitate present, with 0 being clear and +4 being milky with precipitate.

UNFILTERED FILTERED

SAMPLE +1 0

NO ADDITIONS +4 +4 1% MANNITOL +1 0

1% ARGININE +1 +1

1% GLYCINE +1 +1

0.05% TWEEN 80 +1 0

0.4% HSA* +2 +3 0.5% PVP* +2 +2

*HSA is human serum albumin, PVP is polyvinylpyrrolidone

These data show that Tween 80 and mannitol (1%) are effective in reducing precipitation of aggregated sT4.

Example 9 Solubility of sT4 in phosphate buffer and histidine buffer with excipients added. An initial solution sT4 (7.9 mg/ml) in 50 mM phosphate buffer (pH7.0) was filtered through a 0.22 to addition of excipients. The filtered initial solution was clear prior to addition of excipients. The filtered initial solution was then divided into portions. Histidine was added to aliquots of one portion to provide concentrations of 50, 100, 150 and 200 mM histidine. Aliquots of another portion of the initial filtered solution was dialyzed against the appropriate concentration of histidine buffer to give sT4 in 50, 100, 200 and 250 mM histidine buffer. A third portion was dialyzed against 50 mM histidine buffer to give sT4 in histidine buffer and excipients were added to aliquots of this portion. Excipients were added to samples of the

initial solution (as treated above) in ampoules and the ampoules were shaken for 16 hours at 5°C. The ampoules were then visually inspected and the presence of precipitate was noted and scored with 0 being clear and +4 being milky with precipitate.

BUFFER and EXCIPIENT APPEARANCE

50 mM Phosphate +4 50 mM Phosphate and 50 mM Histidine +3

50 mM Phosphate and 100 mM Histidine +3

50 mM Phosphate and 150 mM Histidine +3

50 mM Phosphate and 200 mM Histidine +3

50 mM Histidine +2

100 mM Histidine 0

200 mM Histidine 0

250 mM Histidine 0

50 mM Histidine and 1% Mannitol +1

50 mM Histidine and 5% Mannitol +1

50 mM Histidine and 5% Sorbitol 0

50 mM Histidine and 1% Twe n 80 0

50 mM Histidine and 1% Glutamic Acid +4

These data show that histidine buffer, and histidine buffer with sorbitol or Tween 80 are effective in reducing precipitation of aggregated sT4.

Example 10 - Hemolysis of red blood cells by sT4 in combination with various buffer systems.

Approximately 12 ml fresh venous blood was drawn from a volunteer. The blood was defibrinated by slowly swirling in an Erlenmeyer flask containing glass donuts.

After allowing the fibrin to clot on the glass beads 3 x

600 ul aliquots of blood were drawn and combined with

500 ul of dextrose (D5W) . The 50:50 mixture was gently mixed and then centrifuged for ten minutes. The

1 supernatant was discarded and this process was repeated two more times. 600 ul D5W was added to each vial containing the isolated RBC's and inverted to mix. 25 ul of the RBC-D5W solution was pipetted into tubes each 5 containing 1000 uls of one of the following solutions:

50 mM histidine pH 7.0,

100 mM histidine ph 7.0

0.9 % normal saline (NS) deioned water, 0 ST4* and 0.05% Tween

ST4* and 0.05% Tween, 5% mannitol

ST4*, 4% mannitol

ST4*, 5% mannitol

ST4*, 20% dextrose 5 ST4*, 10% dextrose

4% mannitol

ST4*

5% mannitol sT4* and 4.5% mannitol o 4.5% mannitol

*7.7 mg/ml in 50mM histidine buffer

The solutions were allowed to stand for thirty minutes, and then were centrifuged for ten minutes. The supernatants were decanted and analyzed by ultraviolet absorption (Perkin-Elmer Lambda 7 UV Spectrophotomer) . The spectrophotometer was blanked against air. Samples were scanned from 500-620 nm (A ax = 575 nm) . A 1.0 ml cell was used for all readings. In samples in which hemolysis occurred, two absorbance peaks appeared at

538 nm and 575 nm due to hemoglobin. Per cent hemolysis was calculated using the absorbance for normal saline (NS) as 0% hemolysis and the absorbance from deionized water as 100% hemolysis. All other per cent hemolysis values were determined by plotting on this two-point curve.

SAMPLE

1 Normal Saline

2 4% Mannitol

3 5% Mannitol 4 4.5% Mannitol

5 4% Mannitol + ST4

6 ST4 + 20% Dextrose

7 4.5% Mannitol + ST4

8 ST4 + 0.05% TWEEN + 5%

9 5% Mannitol + ST4

10 ST4 + 10% Dextrose

11 Histidine 50mM

12 Histidine lOOmM

13 ST4

14 ST4 + 0.05% TWEEN

15 DEIONIZED WATER Equation Of 2 point line y = (340,136) x - 3-401 where x = absorbance units.

The x values on the chart above were inserted into this equation and the % hemolysis values were generated.

The data show that the addition of mannitol sT4 in 50mM histidine buffer substantially reduces hemolysis of red blood cells when compared to hemolysis of red blood cells by sT4 in 50mM histidine buffer alone.

Example 11 - Nephrotoxicity of sT4 The nephrotoxicity of sT4 prepared as two different formulations was tested. Vehicle A consisted of sT4 formulated as a 10 mg/ml solution in 50 mM L-histidine pH7, 0.05% Tween 80 and 4.5% mannitol. Vehicle B consisted of sT4 formulated as a 10 mg/ml solution in 35 mM L-histidine pH7, 0.3% saline. Other vehicles containing varying concentrations of histidine were used in previous toxicity studies in rats.

sT4 was administered to four groups (I, II, III and IV) of CD received two intravenous bolus doses via tail vein, approximately 24 hours apart. Two groups (II and III) received sT4 in Vehicle A at 50 and 200 mg/kg/day, respectively. A third group (IV) received sT4 in Vehicle B at 200 mg/kg/day. A fourth group (I) received 20 ml/kg/day of Vehicle A in a dose volume equivalent to that received by the 200 mg/kg/day (Vehicle A) group (III). The rats were dosed on days 1 and 2 and were killed and necropsied on day 3.

The results of the histopathologic examination of the kidneys are summarized in Table 5. Tubular cast nephropathy was observed in 6 of 12 rats that received 2 doses at 200 mg/kg/day of sT4 in Vehicle B. The lesions were similar to those observed in a previous single dose study in rats but were more severe. In contrast, examination of the kidneys from rats in Groups I, II and III revealed no evidence of tubular cast nephropathy or any other drug-associated change. These data show that formulating sT4 in 50mM L-histidine pH7, 0.05% Tween 80 and 4.5% mannitol substantially attenuates nephrotoxicity of sT4 in rats.

Table 5 Incidence of Tubular Cast Nephropathy after 2 doses of ST4

The above disclosure and examples fully disclose the invention and preferred embodiments thereof. However, the invention is not limited to the particular constructions illustrated herein but rather encompasses all modifications coming within the scope of the following claims.

Example 12 - Human Study sT4 was administered subcutaneously to AIDS patients using either a solution (7.7 mg/ml sT4 in 50 mM histidine buffer) or a lyophlized formulation (10.0 mg/ml sT4, mannitol (4.5% w/w), Tween 80 (0.05%) in 50mM histidine buffer) . Plasma sT4 concentration was monitored using a gpl20 domain specific anti-Leu3A ELISA assay. Data collected in four patients receiving a dose of 0.3 mg/kg indicated that the plasma sT4 concentration versus time profiles were very similar for both aqueous and lyophy ^{* '} ed formulations. As shown in Table 6, sT4 was readily absorbed and a peak concentration of 72 ng/ml was observed at four hours post-dosing. There was measurable sT4 in plasma up to 48 hours post-dosing. The circulating t _1/2 was extended from forty-five minutes (following intravenous administration) to 13.88 hours. Subcutaneous administration of sT4 results in a sustained blood level and an extended circulation t. _/2 of about fourteen hours.

Table 6

Pharmacokinetics of sT4 in AIDS patients following subcutaneous dose of 0.3 mg/kg

a: Patient received the lyophilyzed formulation of sT4