MODULATING THE CELLULAR STRESS RESPONSE

CLAIM OF PRIORITY

This application claims the benefit of U.S. Provisional Patent Application Serial Nos. 62/347,737, filed on June 9, 2016; 62/408,639, filed on October 14, 2016; and 62/433,770, filed on December 13, 2016. The entire contents of the foregoing are hereby incorporated by reference.

SEQUENCE LISTING

The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on June 9, 2017, is named 29539- 0246WO l_SL.txt and is 36,864 bytes in size.

FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

This invention was made with Government support under Grant Nos. R01-GM090278 awarded by the National Institutes of Health. The Government has certain rights in the invention.

This invention was also made with support from the German Research Foundation under grant number Zo 287/4-1.

TECHNICAL FIELD

Described herein are methods of using Alu or B2 nucleic acids, or antisense oligonucleotides that modulate the EZH2/B2 or EZH2/ALU interaction and have the capacity to alter cleavage of B2/ALU and its expression levels, for increasing or decreasing whole-organism or cell health, proliferation potential, functionality and viability, such as during various types of environmental stress (thermal (e.g., heat or cold), radiation, chemical, or hypoxic stress), inflammation, infection, and cancer.

BACKGROUND

Environmental stress is an everyday reality for all organisms. A rapid and effective response is essential for survival in the face of acute stress, such as those resulting from exposure to extreme temperatures (cold, heat), chemical toxin, radiation, and infection. Activation of the so-called stress response genes protects cells from conditions that would normally be lethal, and a failure to mount an effective or controlled stress response can lead to a variety of diseases, including cancer and autoimmunity. Cancer therapeutic agents often target components of the stress/heat shock response pathway to overcome unchecked growth of cancer cells, but cancer cells frequently respond by mutating these stress-control genes (Chircop and Speidel, 2014). A better understanding of how the stress response is controlled would therefore be beneficial towards human health.

SUMMARY

More than 98% of the mammalian genome is noncoding and interspersed transposable elements account for -50% of noncoding space. Because of their repetitive nature and relative lack of conservation, these elements have been termed "junk DNA". As demonstrated herein, an interaction between the Polycomb protein, EZH2, and RNA made from B2 SINE retrotransposons controls the stress response. Using the heat shock model, the present results show that B2 RNA binds stress genes and suppresses their transcription before stress. Upon stress, EZH2 is recruited and triggers cleavage of B2 RNA. B2 degradation in turn upregulates stress genes. Evidence indicates that B2 RNA operates as "speed bumps" to slow progression of RNA polymerase and stress rapidly releases the brakes on transcription. Thus, the present inventors have attributed a new function to EZH2 that is independent of its histone methyltransferase activity and revealed that EZH2 and B2 together control the activation of a large network of stress-response genes. In humans, the B2 element is known as ALU. As shown herein, ALUs are also subject to cleavage.

Thus, provided herein are methods for of modulating health, proliferation potential, functionality or viability of a cell or tissue, comprising contacting the cell with an antisense oligonucleotide (ASO) comprising at least one locked nucleotide that binds to an Alu or B2 RNA and alters levels of the Alu or B2 RNA, by promoting or blocking cleavage of the B2/Alu RNA. As used herein, functionality means the typical physiological function of the cell, e.g., a pancreatic beta cell that is alive but not producing insulin is viable but not functional. Neural or muscle cells with an ion channel disorder are still viable but cannot transmit or receive the message, thus they are not functional.

In some embodiments, the cell is in a subject who suffers from an inflammatory or autoimmune disorder affecting the cell. In some embodiments, the cell is in a subject who suffers from a degenerative disorder affecting the cell.

In some embodiments, the degenerative disorder is macular degeneration.

Also provided herein are methods for enhancing health or viability of a cell, comprising contacting the cell with an antisense oligonucleotide (ASO) comprising at least one locked nucleotide that binds to an Alu or B2 RNA and promotes cleavage of the Alu or B2 RNA, preferably wherein the ASO is an siRNA, shRNA or comprises at least one locked nucleotide, e.g., is a gapmer or mixmer.

In some embodiments, the cell is in a subject who suffers from an environmental stress.

In some embodiments, the environmental stress is infection, thermal (e.g., heat or cold), radiation, or chemical exposure or hypoxic stress.

Also provided herein are methods for promoting or inhibiting proliferation of a cell, comprising contacting the cell with an antisense oligonucleotide (ASO) that binds to an Alu or B2 RNA and reduces binding of EZH2 to the Alu or B2 RNA and inhibits or promotes cleavage of the Alu or B2 RNA.

Further provided herein are methods for promoting or inhibiting apoptosis in a cell, comprising contacting the cell with an antisense oligonucleotide (ASO) that binds to an Alu or B2 RNA and reduces binding of EZH2 to the Alu or B2 RNA and inhibits or promotes cleavage of the Alu or B2 RNA.

In some embodiments, proliferation is inhibited, or apoptosis is promoted, and the cell is a cancer cell. In some embodiments, the cancer cell is in a subject who has cancer; optionally, the ASO is administered locally to the cancer in the subject.

In some embodiments, the ASO is selected from the group consisting of peptide nucleic acids, N3',P5'-phosphoramidates, morpholino phosphoroamidates, 2'-0- methoxyethyl nucleic acids, or ribonucleic acids delivered through an RNA degradation protective carrier.

Also provided herein are compositions comprising a plurality of isolated antisense oligonucleotides (ASOs), preferably each comprising at least one locked nucleotide, that target a plurality of different Alu or B2 sequences and mediate or promote cleavage of the sequences, and a pharmaceutically acceptable carrier.

Also provided herein are compositions for use in a method of promoting viability of a cell, preferably a cell in a living subject, comprising a plurality of isolated antisense oligonucleotides (ASOs), preferably each comprising at least one locked nucleotide, that target a plurality of different Alu or B2 sequences and mediate or promote cleavage of the sequences, and a pharmaceutically acceptable carrier

In some embodiments, the subject suffers from an autoimmune disorder or a degenerative disorder.

Additionally, provided herein are compositions comprising a plurality of antisense oligonucleotides that target a plurality of different Alu or B2 sequences and inhibit cleavage of the sequences, and a pharmaceutically acceptable carrier.

In some embodiments, the ASO is selected from the group consisting of peptide nucleic acids, N3',P5'-phosphoramidates, morpholino phosphoroamidates, 2'-0- methoxyethyl nucleic acids, and ribonucleic acids delivered through an R A degradation protective carrier.

Further provided herein are compositions for use in a method of decreasing viability of a cell, comprising a plurality of antisense oligonucleotides that target a plurality of different Alu or B2 sequences and inhibit cleavage of the sequences, and a pharmaceutically acceptable carrier.

In some embodiments, the cell is a cancer cell in a subject.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.

DESCRIPTION OF DRAWINGS

Figures 1A-F. B2 RNA associates with PRC2 and can be detected as multiple shorter species in vivo.

A) Relative B2 representation (red pie slice) among SINEs in the mouse genome, among the female ES cell transcriptome (RNA-seq), and among the EZH2 interactome (RIP-seq), as indicated. Right pie chart is reproduced from (Zhao et al., 2010) and depicts relative representation of SINEs among all reads in the PRC2 interactome.

B) Top panel: Distribution of EZH2 RIP-seq reads around the start site (+/- 2000 bp) of two classes of SINE elements, B2 and B 1. Repeats of each class have been collapsed into a metagene with a common start site. B2 RNA is enriched but Bl is not, in spite of their relatively equal expression levels in ES cells, as shown by RNA- seq (bottom two panels).

C) Distribution of EZH2 RIP-seq reads within the B2 element. Upper panel:

Distribution of reads across a metagene profile inclusive of all B2 elements aligned to their start from nucleotides 1-201 (x-axis / absolute distance in nucleotides from repeat start is maintained in the metagene). Lower panel: Alignment of EZH2 RIP-seq reads within the B2 metagene. Sharp discontinuities implie existence of different B2 subfragments.

D) Distribution of short RNA-seq reads within the B2 element (upper panel) and alignment of these reads within the B2 metagene between nt 1-201 (lower panel).

E) Top panel: Map, structure, and critical domain of B2 RNA as determined previously (Espinoza et al., 2007); SEQ ID NO:73. Bottom panel: 5' ends of the short RNA-seq reads are plotted along the B2 locus (x-axis). Red X's (Top panel) and asterisks (Bottom panel) mark sites of discontinuity, as observed by the short RNA- seq analysis.

F) Top left: Binding isotherms of EZH2 generated from data obtained from double- filter binding experiments. Top right: Table of Kd and R ² values for EZH2-B2 RNA interactions. Bottom: Filter binding assay performed as previously described (Cifuentes-Rojas et al., 2014) for B2 RNA and EZH2. RepA I-IV and RepA I-II were used as positive controls and MBP and P4P6 as negative controls. Error bars within binding curves and standard deviations (SD) within the table represent three independent experiments. U, unbound; B, bound.

Figures 2A-K. EZH2 triggers cleavage of B2 RNA in vitro.

A) B2 sub-family consensus sequences of the 5 ' end, inclusive of the TSS, Box A and B motifs, and the major site of discontinuity at position 98 for B3 (SEQ ID NO:65), B2_Mmla (SEQ ID NO:66), B2_Mmlt (SEQ ID NO:67), and M2_Mm2 (SEQ ID NO:68). B) Incubation of in vitro-transcribed B2 RNA (200 nM) with purified recombinant EZH2 (25 nM) results in B2 cleavage and loss in vitro after 13 hours at 22°C in vitro. Arrowhead, full-length B2 RNA. Asterisks, cleaved B2 fragments.

C) Incubation with 25 nM purified control proteins, GST and EED, does not result in significant cutting after 13 hours at 22°C in vitro. Arrowhead, full-length B2 RNA.

Asterisks, cleaved B2 fragments.

D) Cleaved RNA fragments (asterisks) are purified, adapter ligated, reverse- transcribed, and subjected to deep sequencing. Start coordinates for the sequenced reads are mapped along the x-axis. Arrowhead, full-length B2 RNA.

E) Incubation of in vitro-transcribed RNAs (100 nM) with purified recombinant

EZH2 (50 nM) results in cleavage only of B2 RNA. RNAs were mixed with EZH2 and incubated at 37oC or 4oC for 30 min. B2 was also incubated with FLAG peptide (50 nM) at 37°C as control.

F) Kinetic analysis of B2 cleavage in the presence of EZH2 protein. 25 nM EZH2 was incubated with 200 nM B2 RNA at 37°C for 0-100 minutes and the products were run on a 6% TBE-Urea-PAGE. Arrowhead, full-length B2 RNA. Asterisks, cleaved B2 fragments.

G) Fraction of full-length B2 RNA at each time point from panel E (arrow) was plotted as a function of time. Cleavage rate constants were then determined by a linear fit using the differential form of the rate equation for an irreversible, first-order reaction. The slope is the observed cleavage rate constant (fobs). R ² values indicate that data points have an excellent fit to the curve. Two independent experiments have been used for this plotting.

H) Table of calculated ob fobs and RNA half-lives for B2 in the presence of various test proteins.

I) Rate of B2 cleavage depends on the concentration of EZH2 protein. 50 nM B2 RNA is incubated with increasing concentrations of EZH2 for 20 minutes at 37°C in vitro. The products were then run on a 6% TBE-Urea PAGE. Arrowhead, full-length B2 RNA. Asterisks, cleaved B2 fragments.

J) Kinetic analysis showing that the rate of B2 cleavage depends on the concentration of EZH2. 200 nM B2 RNA is incubated with increasing EZH2 concentrations (25-500 nM) at 37°C and the amount of remaining full-length B2 RNA is plotted as a function of time. Cleavage rate constants were then determined by a linear fit using the differential form of the rate equation for an irreversible, first-order reaction. The slope approximated observed rate constant (fobs). R ² values indicate that datapoints have an excellent fit to the curve. Two independent experiments have been used for this plotting.

K) fobs values from panel I are plotted as a function of EZH2 concentration. High R ² values indicate that data points have an excellent fit to the curve.

Figures 3A-D. Heat shock destabilizes B2 RNA in vivo.

A) Full-length B2 RNA was pre-incubated with 25 nM EZH2 for 7h at 37°C. The RNA was then gel purified and either the whole B2 or the subfragments were then transfected into NIH/3T3 cells and cells were grown at 37°C. Mock represents transfection without any RNA. Photographs were taken after 3 days.

B) NIH/3T3 cells transfected with either synthesized full-length B2 RNA or a synthesized B2 fragment starting at position 99. Cells were then allowed to recover for 2-5 days. Cell were photographed (left panels) and counted (right panels) at days 2 and 5.

C) Diagram of the heat shock response. Hundreds of genes are increased in expression ("upregulated"), and others are decreased in expression ("downregulated"). B2 expression increases within 15 minutes of heat shock.

D) Short RNA-seq of NIH/3T3 cells before and after heat shock (45 °C for 15 minutes). Two biological replicates yielded similar results. 5' ends of short RNA-seq reads are mapped to the B2 transcript and the relative number of 5 ' ends is plotted on the y-axis. The 5' end counts are normalized to the number of full length B2 RNAs to account for any possible changes in the general B2 levels during heat shock (KS test; i ^> <0.0001). Figures 4A-G. CHART-seq analysis: B2 RNA binds heat shock responsive genes in vivo.

A) For CHART-seq analysis, a cocktail of 17-base B2 capture probes is designed to span nt 87-103 and overlap the major cut site. Thus, the cocktail should only pull down chromatin regions associated with full-length B2 RNA. The cocktail contains a pool of oligos that would capture SNP variants for the vast majority of B2 elements.

B) Genome-wide peak annotation analysis (Galaxy) of the distribution of B2 CHART peaks with reference to UCSC RefSeq genes. C) Pie charts (PAVIS) showing relative distributions of B2 CHART hits genome-wide with reference to different mm9 RefSeq gene features. A comparison of the relative genomic representation for each feature is shown in the bottom pie chart. Satellites represent 0.1% of the total and in this resolution are not visible.

D) An exon/intron 1 -focused metagene analysis of B2 CHART reads shows a significant decrease of B2 binding within intron 1 after heat shock (KS test, P <0.0001).

E) IGV screenshots of B2 binding patterns for two H/S-upregulated and two H/S- downregulated genes, along with RNA-seq data. Pre- and post-H/S profiles are shown. Paired data are shown at the same scale (numbers in brackets, right) for comparison.

F) B2 binding across TSS-centered metagene profiles +/- 1000 bp of flanking sequence. Pre- and post-H/S traces are shown for all genes, upregulated genes (Table 1), and downregulated genes (Table 2), as indicated. Analysis from two biological replicates corresponds to an FDR<0.05 estimation of noise to input signal, and an E- value of 1000. Statistical significance (P) of the difference between pre- and post-H/S read counts is determined by KS test (P <0.0001).

G) Relative change in B2 binding after H/S. Relative change is indicated by the ratio of post- to pre-H/S CHART reads as described in methods. Positive and negative values represent an increase and decrease in B2 binding after heat shock, respectively. The metagene profiles are centered on the TSS of up- and down-regulated genes, as indicated (KS test, P <0.0001J for the read distribution changes between up- and down-regulated genes).

Figures 5A-F. Loss of B2 binding induces H/S- responsive genes.

A) Metagene analysis of changes in POL-II-S2P binding (ChlP-seq) at H/S- upregulated and -downregulated genes. Analysis corresponds two biological replicates and an FDR<0.05 estimation of noise to input signal. Statistical significance (P) between pre- and post-H/S read counts is determined by KS test (P <0.0001).

B) Metagene analysis of changes in POL-II-S2P binding at Type I (B2 binding in pre- H/S) and Type II (B2 binding in post-H/S) genes. Analysis performed as in (A) (KS test, P < 0.0001).

C) Metagene analysis showing relative changes in POL-II-S2P binding after H/S for Types I and II genes. Relative change is indicated by the ratio of post- to pre-H/S ChIP coverage. Positive and negative values represent an increase and decrease in POL-II-S2P density, respectively (KS test (P <0.0001) for the read distribution changes between Type I and Type II genes).

D) Cleavage of B2 RNA induced by B2-specific LNA. NIH/3T3 cells are transfected with B2 or Scr LNAs and short RNA-seq analysis is performed after 24 hours. 5' ends of short RNA-seq reads are mapped to the B2 transcript and the relative number of 5' ends is plotted on the y-axis (KS test, P <0.0001)

E) ChlP-seq analysis indicates that B2 LNA recapitulates increased POL-II-S2P density across H/S-upregulated genes without application of heat shock (KS test, P <0.0001).

F) Metagene analysis of RNA-seq data demonstrates that B2 LNA treatment also recapitulates increased expression of H/S-upregulated genes in the absence of H/S (KS test, P < 0.0001).

Figures 6A-J. EZH2 is recruited to B2 target genes to direct H/S activation. A) Metagene analysis of changes in EZH2 binding (ChlP-seq) at H/S-upregulated and -downregulated genes. Analysis corresponds to two biological replicates (FDR<0.05 for sample signal to input noise) and P <0.0001 (KS test) between pre- and post-H/S read count distribution of downregulated genes only.

B) EZH2 is recruited to H/S-responsive genes with a B2-binding site. Metagene analysis of changes in EZH2 binding (ChlP-seq) at H/S-upregulated with or without B2 binding sites (Type I versus Type II). P O.OOOl (KS test) for upregulated genes with B2 binding site.

C) H3K27me3 coverage is not increased at the TSS after EZH2 recruitment to H/S- upregulated genes. The metagene analysis is performed on the subclass of H/S- upregulated genes with B2 and EZH2 binding sites (either before or after H/S) (Difference not statistically significant, KS test).

D) Metagene analysis showing relative changes in H3K27me3 coverage after H/S for the subclass of upregulated genes shown in (C). Relative change is indicated by the ratio of post- to pre-H/S ChIP coverage. Positive and negative values represent an increase and decrease in H3K27me3 coverage, respectively.

E) Meta-site analysis centered on the EZH2 binding site shows B2 binds in pre-H/S cells where EZH2 is gained after H/S. x=0 corresponds to EZH2 peaks start of post- H/S cells. F) Meta-site analysis centered on the B2 binding site shows that EZH2 binds where B2 is lost during H/S. x=0 corresponds to B2 peaks of pre-H/S cells.

G) Anti-correlation of B2 and EZH2 binding viewed in a metagene plot. Relative changes in either B2 or EZH2 coverage at upregulated genes are shown after H/S. Relative change is indicated by the ratio of post- to pre-H/S coverage. Positive and negative values represent an increase and decrease in density, respectively.

H) Linear anti-correlation between B2 coverage and EZH2 density. Change in B2 density (x-axis) plotted as a function of change in EZH2 density (y-axis). R = -0. 7, P< 0.05.

I) Depleting EZH2 reduces processing of B2 RNA. NIH/3T3 cells are transfected with EZH2 or Scr LNAs and short RNA-seq analysis is performed after 24 hours. 5' ends of short RNA-seq reads are mapped to the B2 transcript and the relative number of 5' ends is plotted on the y-axis (P <0.0001, KS test/

J) EZH2 is required for the heat shock response. Metagene analysis of RNA-seq data demonstrates that EZH2 depletion reduces expression of H/S -upregulated genes (P <0.0001, KS test for pre- post-HS distributions

Figures 7A-B. The Speed Bump Model of B2/EZH2-mediated gene control.

A) Compilation of data from Figures 4-6: IGV screenshots showing alignments of binding patterns for B2 RNA, EZH2, and POL-II-S2P to specific genes.

B) The Speed Bump Model. Upper panels: In resting cells, B2 RNA binds H/S- responsive genes and reduces their expression by establishing "speed bumps" for POL-II progression. Upon stress (e.g., heat shock), PRC2 is recruited to H/S- responsive genes and triggers B2 degradation. The speed bumps are removed and POL-II elongates at faster speed, thereby resulting in transcriptional upregulation. Bottom panels: B2 also regulates housekeeping genes that undergo transcriptional downregulation upon H/S. H/S results in B2 upregulation. These newly transcribed B2 RNA binds new target genes and reduces POL-II activity, thereby reducing expression of housekeeping genes. Both transcriptional initiation and elongation may be affected. The speed bump mechanism enables a rapid and specific response to cellular stress. All changes are observed within 15 minutes of heat shock. Figure 8. Correlation between biological replicates of the B2 CHART-seq experiment.

Metagene plot of B2 CHART read density at B2 elements, the site of nascent transcription. As expected, B2 RNA is enriched at the site of transcription. These loci served as positive control and are excluded from further analysis.

Figure9. Correlation between biological replicates of RNA-seq data after EZH2 knockdown.

Significant EZH2 knockdown by LNA transfection. P =0.04, as determined by t-test. Figures lOA-C. Human Alu are the equivalent of mouse B2, and are also cleaved.

A) Human Alu consensus sequence (SEQ ID NO: 1) and secondary structure adapted from Hadjiargyrou and Delihas, Int J Mol Sci. 14(7): 13307-28 (2013). Alu sequence consists of a sequence dimer, of which the monomers constitute its left and right arms, respectively. The asterisk indicates the Alu cut point in vivo as defined in Figure 10B below.

B) Alu's are cut at a position within the position range 49-52 from the start of the Alu SINE genomic elements. The graph shows 5' ends of short RNA-seq reads mapped against mm9 genomic Alu elements creating the transcript metagene of the Alu elements. The metagene x axis is constructed by aligning the 5' end start points of all Alu RNAs as defined in UCSC repeat masker as of Sept 2016. The x axis position numbers represent absolute distance in nucleotides from the Alu start site (i.e. position 1 in the metagene corresponds to the start site of each Alu genomic element from which the Alu RNA transcript metagene is constructed). The relative number of short RNA 5 ' ends is plotted on the y-axis. Because, as shown in Table 3, various Alu elements present variations from the consensus sequence showed in Fig 10A, the cut position varies accordingly based on various insertions and deletions of each Alu that constitutes this metagene (i.e. cut position of different Alu sabfamilies relative to the Alu start site is heterogenous based on these variations creating the compound metagene profile of this figure). These variations and the respective cut range (highlighted in gray), are shown in Figure 1 1. Mapping is focused on only the first Alu Arm (left) to prevent cross mapping because of sequence similarity between the two Alu sequence dimers.

C) For a specific Alu class, AluY, the cut is at position 51. This is presented as an example of the cut point within an Alu subfamily.

Figure 11. Table of sequences for human Alu family members and their respective cut sites. Each row represents the sequence of an Alu family aligned with each other based on Vassetzky amd Kramerov, Nucleic Acids Res. 41(Database issue):D83-9 (2013). The cut region is highlighted in grey. These sequences represent the consensus sequences of all human Alu subfamilies.

DETAILED DESCRIPTION

For more than half a century, genome size has been known to correlate poorly with organism size and developmental complexity (Gall, 1981; Mirsky, 1951; Thomas,

1971). Many flowering plants and amphibians, for example, have genome sizes (or C- value) that are 10- to 100-times larger than those of mammals. This so-called "C- value paradox" was thought to be solved by the discovery that only 1-2% of mammalian genomes have protein-coding potential. The rest of the genome consists largely of repetitive DNA, with satellite DNA, retrotransposable elements, and DNA transposons accounting for -50% of noncoding sequences (de Koning et al., 2011). For much of the past few decades, these poorly conserved elements have been considered "junk DNA", believed to be remnants of evolution and genetic parasites that proliferate without constraint of purifying selection (Kramerov and Vassetzky, 2011). Emerging studies, however, have been hinting at possible functions for these noncoding sequences (Bourque et al., 2008; Lowe and Haussler, 2012; Lunyak et al., 2007; Ponicsan et al., 2010). It is now known through ENCODE that >80% of the noncoding genome is transcribed during development (Consortium et al., 2007). A growing number of the resulting long noncoding RNAs (IncRNA)— particularly the unique ones— now appear to have important cellular roles, including during X- chromosome inactivation, genomic imprinting, and cancer progression (Kapranov et al., 2007; Lee and Bartolomei, 2013; Li et al., 2016; Rinn and Chang, 2012; Tay et al., 2014).

Nevertheless, functions for repetitive elements remain largely a mystery. One class of repeat elements, however, has garnered some attention in recent years. The B2 element belongs to a family of short intersperse nuclear element (SINE), is present in -100,000 copies, and is transcribed by RNA polymerase III into a 180- to 200-base IncRNA (Kramerov et al., 1982; Kramerov and Vassetzky, 2011) with a 5' tRNA-like sequence and A-rich 3 ' end (Daniels and Deininger, 1985; Krayev et al, 1982;

Lawrence et al., 1985). B2 expression changes significantly during development (Bachvarova, 1988) and its expression is highly induced by specific cellular stresses and disease states, such as viral infection (Singh et al., 1985), age-related macular degeneration (Kaneko et al, 201 1 ; Tarallo et al, 2012), and various cancers

(Kaczkowski et al., 2016; Kramerov et al., 1982; Moolhuijzen et al., 2010). The functional and mechanistic relationships between B2 and these various disease states are not currently known. Notably, B2 RNA has been shown to play a role in heat shock (Fornace and Mitchell, 1986; Li et al., 1999), during which B2 RNA is assembled into the pre -initiation complex of RNA polymerase II (POL-II) (Espinoza et al., 2004) and becomes inhibitory to transcription in vitro (Allen et al., 2004). Transcription of the B2 element has also been implicated in formation of a boundary between heterochromatin and euchromatin (Lunyak et al., 2007). The B2 DNA element can also lend its promoter activity to mammalian genes (Ferrigno et al, 2001). Thus, in the mammalian noncoding genome, the B2 repeat currently stands out as one element that is likely to be much more than junk.

With this in mind, we became intrigued by a set of data involving the RNA-binding activity of an epigenetic complex known as Polycomb repressive complex 2

(PRC2)(Zhao et al., 2010). PRC2 is a histone methyltransferase complex consisting of four core subunits, EED, RBBP4/7, SUZ 12, and the catalytic subunit EZH2, that together mediate the trimethylation of histone H3 at lysine 27 (H3K27me3) and help to establish repressive chromatin (Margueron and Reinberg, 201 1). By RNA immunoprecipitation with deep sequencing (RIP-seq), previous work in mouse cells revealed an RNA interactome of >9,000 unique transcripts (Zhao et al., 2010). While the raison d 'etre for the large RNA interactome is under intensive investigation (Cifuentes-Rojas et al., 2014; Davidovich et al., 2015; Davidovich et al., 2013;

Kaneko et al, 2013), it is clear that interacting transcripts can target PRC2 in cis to repress gene expression (Pandey et al., 2008; Zhao et al., 2010; Zhao et al., 2008). Further examination of PRC2-RNA interactions has also shown that PRC2 binding can be found at active genes (Davidovich et al, 2013; Kaneko et al., 2013), implying that PRC2 may not solely be involved in gene repression.

The PRC2 RIP-seq analysis also identified RNAs made from repetitive elements (Zhao et al, 2010). However, because repeats pose technical challenges for sequence alignment during analysis of next-generation sequencing data (Treangen and Salzberg, 2012), the repeat fraction had been unexamined despite the fact that such transcripts were present in large numbers. Described herein is an exploration of PRC2's interaction with repetitive RNAs. These findings integrate two previously unconnected networks— Polycomb and junk RNA— in the cellular response to stress and demonstrate the importance of a B2-specific RNA cleavage event.

Herein, data show that EZH2 and a B2 transcript made from "junk" DNA play a central role (Fig. 7B). Intriguingly, the key triggering event is B2 RNA elimination. Without wishing to be bound by theory, it is proposed that B2 RNA act as transcriptional "speed bumps" for POL-II. B2 RNA binds broadly in intronic regions, sometimes to one intron, sometimes to two or more (Fig. 4B-E, 7A). The present data suggest that, in resting cells, B2 binding to gene bodies reduces the elongation rate of POL-II and thereby controls the rate at which target genes are expressed in the unstressed state.

Upon stress, EZH2 is rapidly recruited to H/S-responsive genes (within 15 minutes). A significant consequence is a degradation of B2 RNA involving endonucleolytic cleavages at multiple positions (e.g., nt 98, 77, 33) both in vitro and in vivo (Fig. IE, 2D, 3D, 61). Cleavage of B2 RNA is sufficient to induce H/S-responsive genes (Fig. 5E,F, 7A). Notably, cut B2 fragments have dramatically reduced affinities for EZH2 (AKd from 423 nM to >3000 nM; Fig. IF). Without wishing to be bound by theory, it is suggested that the cleavage event results in disintegration and release of B2 RNA from target genes. B2 degradation at target genes removes the POL-II speed bumps, enabling a larger percent of elongating POL-II to reach the 3 ' termini of target genes. Previous studies had shown transcriptional pausing downstream of H/S-responsive promoters (Brown et al, 1996; Kwak et al., 2013). Speculatively, some pause sites may correspond to sites of B2 binding. A B2 speed bump mechanism would enable a swift cellular response to stress, as EZH2 recruitment and B2 cleavage occur rapidly — within minutes of the stimulus in vivo.

The present study ascribes a specific new function to EZH2 that is independent of its well-known histone methyltransferase activity. Although this work was conducted in mammalian cells, EZH2 may also function during stress in flies, plants, and fungi, (Basenko et al., 2015; Kleinmanns and Schubert, 2014; Siebold et al., 2010). The present work also provides an explanation for the paradoxical observation that EZH2 and its associated RNAs can be found at both active and inactive genes (Davidovich et al., 2013; Kaneko et al., 2013; Zhao et al., 2010). Whereas the H3K27me3 mark is a critical part of EZH2 -mediated gene silencing (Margueron and Reinberg, 2011), gene activation by the EZH2-B2 interaction does not depend on H3K27

trimethylation (Fig. 6C,D). Rather activation depends on contact-dependent B2 elimination. Thus, frequent mutation of EZH2 (Margueron and Reinberg, 201 1) and misexpression of Alu/B2 elements (Chircop and Speidel, 2014; Kaczkowski et al., 2016; Kramerov et al., 1982; Moolhuijzen et al., 2010) in cancer cells may in part be explained by the critical roles played by EZH2 and B2 during the stress response. Finally, it should be noted that heat shock normally leads to two distinct responses - transcriptional upregulation of stress response genes (Table 1) and transcriptional downregulation of housekeeping genes, among others (Table 2). The EZH2-B2 dynamic relates primarily to the former set of genes. B2 plays an equally important role for the latter (Fig. 3C, 7B). Repression of a large number of genes that are non- essential to stress is an adaptation to conserve cellular resources. Existing studies have demonstrated a role for B2 RNA in repression of two housekeeping genes, including ActinB and Hk2 (Allen et al., 2004; Espinoza et al., 2004; Fornace and Mitchell, 1986; Li et al., 1999). The B2 CHART-seq data now provide a genomic view for this second arm of the heat shock response and reveal that a large number of genes are targeted by B2 RNA immediately after heat shock (Fig. 4F,G; Tables S2,S4,S7), concurrently with the increase in B2 expression (Allen et al., 2004; Fornace and Mitchell, 1986). Because EZH2 is not recruited to the downregulated gene set, B2 RNA is spared the degradation. Previous studies convincingly showed that incorporated B2 can act in vitro by blocking formation of the POL-II pre-initiation complex at promoters. The present findings suggest that B2 may suppress both transcriptional initiation and elongation in vivo. Notably, the present study explains how H/S-upregulated genes can be immune to increased B2 expression immediately following heat shock, as indeed the recruitment of EZH2 ensures B2 degradation at H/S-upregulated genes. In conclusion, the present results have shown that a specific interaction between EZH2 and B2 "junk RNA" triggers the heat shock response via an RNA elimination event. Methods of Modulating the Mammalian Stress Response

The present results demonstrate that EZH2 interaction with B2 SINE retrotransposons triggers PRC2-mediated cleavage of the B2 elements (consensus sequences are shown in Fig. 2A; the ASOs targeting B2 included a mixture of 5'- GTTACGGATGGTTGTG-3 ' (SEQ ID NO:63) and 5 '-TGTAGCTGTCTTCAG-3 ' (SEQ ID NO:64) LNAs, e.g., the + in front of the base depicts an LNA nt: 5- G+TTA+CGG+ATGG+TTG+TG-3 (SEQ ID NO: 69) and 5- TG+T+AGC+TGTC+TTC+AG-3 ' (SEQ ID NO:70)), inducing the heat shock response in mammalian cells. Antisense oligonucleotides that modulate the EZH2/B2 interaction have the capacity to alter cleavage of B2. Non-cleaving antisense oligos (ASOs) that prevent or decrease binding of EZH2 to B2 without increasing cleavage of B2 can increase levels of intact B2, resulting in cell death. Such pro-apoptotic ASOs would be useful, e.g., in conditions associated with unwanted cellular proliferation, such as cancer. These ASOs include peptide nucleic acids, N3',P5'- phosphoramidates, morpholino phosphoroamidates, 2'-0-methoxyethyl nucleic acids, and ribonucleic acids delivered through an RNA degradation protective carrier (e.g., using the the HiPerfect reagent from Qiagen; see, e.g., Zovoilis et al., EMBO J. 2011 Sep 23;30(20):4299-308). This includes sequences that have both continuing stretches of the modification or clusters of modified nucleotides separated by not modified ones.

In contrast, ASOs such as Locked Nucleic Acids (LNAs, ribonucleotides containing a "lock" or methylene bridge that connects the 2'-oxygen of ribose with the 4'-carbon), that increase cleavage of B2 elements (e.g., by RNAseH) would increase cell viability, useful in conditions associated with cell death such as autoimmune diseases, degenerative diseases, and ischemic injury. Cyclohexenyl nucleic acids can also be used. See, e.g., Kurreck et al, Nucleic Acids Res. 30(9): 1911-1918 (2002).

Also as shown herein, the introduction of B2 RNA into a cell, e.g., a cancer cell, induces cell death. Thus the present methods can include administration of an Alu or B2 RNA, or a DNA encoding an Alu or B2 RNA, or a fragment thereof (RNA or DNA), to induce cell death.

Human Alu Repeats

Repetitive DNA elements account for at least about 20% of the human genome, and have been classified into four principal families of interspersed repeats; Alu, Line 1, MIR and MaLR (Schmid, Prog. Nucleic Acid Res. Mol. Biol, 53 :283-319 ( 1996)). The rodent B2 family of repetitive sequence elements corresponds to the human Alu sequence family (see, e.g., Clawson et al., Cell Growth and Diff 7(5):635-646 (1996)); thus, in the methods described herein, Alu sequences can be used as a target for modulating the stress response in humans. The Alu sequences are typically about 280-300 nucleotides in length, and account for about 1 1% of the human genome (Lander et al., Nature, 409, 860-921 (2001); Deininger et al, Genome Biol. 201 1 ; 12(12): 236). Exemplary consensus sequences of human Alu repeats can be found in Figure 1 1 ; see also Figure 1 of Weisenberger et al., Nucleic Acids Research

33(21):6823-36 (2005); in Figure 1 of Luo et al., Biomed Res Int. 2014:784706

(2014); and in Hambor et al., Molecular and Cellular Biology, 13(1 1): 7056-7070 (1993).

Antisense Oligonucleotides (ASOs)

In some embodiments, the ASOs used in the present methods are 10 to 50, 10 to 20, 10 to 25, 13 to 50, or 13 to 30 nucleotides in length. One having ordinary skill in the art will appreciate that this embodies ASOs having complementary portions of 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or any range therewithin. In some embodiments, the ASOs are 15 nucleotides in length. In some embodiments, the ASOs are 12 or 13 to 20, 25, or 30 nucleotides in length. One having ordinary skill in the art will appreciate that this embodies ASOs having complementary portions of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length, or any range therewithin (complementary portions refers to those portions of the ASOs that are complementary to the target sequence). (As used herein, the "target sequence" or "target RNA" means B2 RNA, or Alu RNA in humans, or other equivalent sequences in other organisms).

The ASOs useful in the present methods are sufficiently complementary to the target RNA, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect. "Complementary" refers to the capacity for pairing, through hydrogen bonding, between two sequences comprising naturally or non-naturally occurring bases or analogs thereof. For example, if a base at one position of an ASO is capable of hydrogen bonding with a base at the corresponding position of a RNA, then the bases are considered to be complementary to each other at that position. 100% complementarity is preferred but not required.

Routine methods can be used to design an ASO that binds to the target sequence with sufficient specificity. In some embodiments, the methods include using

bioinformatics methods known in the art to identify regions of secondary structure, e.g., one, two, or more stem-loop structures, or pseudoknots, and selecting those regions to target with an ASO. For example, "gene walk" methods can be used to optimize the inhibitory activity of the nucleic acid; for example, a series of oligonucleotides of 10-30 nucleotides spanning the length of a target RNA can be prepared, followed by testing for activity. Optionally, gaps, e.g., of 5-10 nucleotides or more, can be left between the target sequences to reduce the number of oligonucleotides synthesized and tested. GC content is preferably between about 30-60%. Contiguous runs of three or more Gs or Cs should be avoided where possible (for example, it may not be possible with very short (e.g., about 9-10 nt) oligonucleotide s) .

In some embodiments, the ASO molecules can be designed to target a specific region of the RNA sequence. For example, a specific functional region can be targeted, e.g., a region comprising a known RNA localization motif (i.e., a region in which EZH2 binds to the target nucleic acid, e.g., the region between position 70 and 160 at the sequences of the B2mm la sequence of Fig 2A). Alternatively, or in addition, highly conserved regions can be targeted, e.g., regions identified by aligning sequences from disparate species such as primate (e.g., human) and rodent (e.g., mouse) and looking for regions with high degrees of identity. Percent identity can be determined routinely using basic local alignment search tools (BLAST programs) (Altschul et al., J. Mol. Biol, 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656), e.g., using the default parameters.

Once one or more target regions, segments or sites have been identified, e.g., within a sequence known in the art or provided herein, ASO compounds are chosen that are sufficiently complementary to the target, i.e., that hybridize sufficiently well and with sufficient specificity (i.e., do not substantially bind to other non-target RNAs), to give the desired effect.

In the context of this invention, hybridization means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. Complementary, as used herein, refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of a RNA molecule, then the ASO and the RNA are considered to be complementary to each other at that position. The ASOs and the RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other. Thus, "specifically hybridisable" and "complementary" are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the ASO and the RNA target. For example, if a base at one position of an ASO is capable of hydrogen bonding with a base at the corresponding position of a RNA, then the bases are considered to be complementary to each other at that position. 100% complementarity is not required.

As noted above, a complementary nucleic acid sequence need not be 100% complementary to that of its target nucleic acid to be specifically hybridisable. A complementary nucleic acid sequence for purposes of the present methods is specifically hybridisable when binding of the sequence to the target RNA molecule interferes with the normal function of the target RNA to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the sequence to non-target RNA sequences under conditions in which specific binding is desired, e.g., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed under suitable conditions of stringency. For example, stringent salt concentration will ordinarily be less than about 750 mM NaCl and 75 mM trisodium citrate, preferably less than about 500 mM NaCl and 50 mM trisodium citrate, and more preferably less than about 250 mM NaCl and 25 mM trisodium citrate. Low stringency hybridization can be obtained in the absence of organic solvent, e.g., formamide, while high stringency hybridization can be obtained in the presence of at least about 35% formamide, and more preferably at least about 50% formamide. Stringent temperature conditions will ordinarily include temperatures of at least about 30° C, more preferably of at least about 37° C, and most preferably of at least about 42° C. Varying additional parameters, such as hybridization time, the concentration of detergent, e.g., sodium dodecyl sulfate (SDS), and the inclusion or exclusion of carrier DNA, are well known to those skilled in the art. Various levels of stringency are accomplished by combining these various conditions as needed. In a preferred embodiment, hybridization will occur at 30° C in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS. In a more preferred embodiment, hybridization will occur at 37° C in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 μg/ml denatured salmon sperm DNA (ssDNA). In a most preferred embodiment, hybridization will occur at 42° C in 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and 200 μg/ml ssDNA. Useful variations on these conditions will be readily apparent to those skilled in the art.

For most applications, washing steps that follow hybridization will also vary in stringency. Wash stringency conditions can be defined by salt concentration and by temperature. As above, wash stringency can be increased by decreasing salt concentration or by increasing temperature. For example, stringent salt concentration for the wash steps will preferably be less than about 30 mM NaCl and 3 mM trisodium citrate, and most preferably less than about 15 mM NaCl and 1.5 mM trisodium citrate. Stringent temperature conditions for the wash steps will ordinarily include a temperature of at least about 25° C, more preferably of at least about 42° C, and even more preferably of at least about 68° C. In a preferred embodiment, wash steps will occur at 25° C in 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 42° C. in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 68° C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS.

Additional variations on these conditions will be readily apparent to those skilled in the art. Hybridization techniques are well known to those skilled in the art and are described, for example, in Benton and Davis (Science 196: 180, 1977); Grunstein and Hogness (Proc. Natl. Acad. Sci., USA 72:3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New

York); and Sambrook et al., Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York. In general, the ASOs useful in the methods described herein have at least 80% sequence complementarity to a target region within the target nucleic acid, e.g., 90%, 95%, or 100% sequence complementarity to the target region within an RNA. For example, an antisense compound in which 18 of 20 nucleobases of the antisense oligonucleotide are complementary, and would therefore specifically hybridize, to a target region would represent 90 percent complementarity. Percent complementarity of an ASO with a region of a target nucleic acid can be determined routinely using basic local alignment search tools (BLAST programs) (Altschul et al., J. Mol. Biol, 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). ASOs that hybridize to an RNA can be identified through routine experimentation. In general, the ASOs must retain specificity for their target, i.e., must not directly bind to, or directly significantly affect levels or expression levels of, transcripts other than the intended target.

For further disclosure regarding ASOs, please see US2010/0317718 (antisense oligos); US2009/0181914 and US2010/0234451 (LNAs); and WO2010/129746 and WO2010/0401 12 (ASOs), as well as WO 2012/065143, WO 2012/087983, and WO 2014/025887 (ASOs targeting non-coding RNAs/supRNAs), all of which are incorporated herein by reference in their entirety.

In some embodiments, the ASOs used in the methods described herein are modified, e.g., comprise one or more modified bonds or bases. A number of modified bases include phosphorothioate, methylphosphonate, peptide nucleic acids, or locked nucleic acid (LNA) molecules. Some ASOs are fully modified, while others are chimeric and contain two or more chemically distinct regions, each made up of at least one nucleotide. These ASOs typically contain at least one region of modified nucleotides that confers one or more beneficial properties (such as, for example, increased nuclease resistance, increased uptake into cells, increased binding affinity for the target) and a region that is a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. Chimeric ASOs of the invention may be formed as composite structures of two or more types of oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers (e.g., wherein a central block of DNA monomers is flanked by 2 -0 modified ribonucleotides or other artificially modified ribonucleotide monomers such as bridged nucleic acids (BNAs), e.g., LNA/DNA/LNA or BNA/DNA/DNA gapmers, usually wherein the central block of deoxynucleotide monomers is sufficiently long to induce RNase H cleavage) or mixmers, i.e., LNAs containing a limited number of modified ribonucleotide or nucleotide monomers, e.g., LNA monomers, in combination with other types of monomers, typically DNA. See Wahlestedt et al., Proc. Natl Acad. Sci. USA, 97, 5633-5638 (2000). Representative United States patents that teach the preparation of such hybrid structures comprise, but are not limited to, US patent nos. 5,013,830; 5,149,797; 5, 220,007; 5,256,775; 5,366,878; 5,403,711; 5,491, 133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, each of which is herein incorporated by reference.

In some embodiments, the ASO comprises at least one nucleotide modified at the 2' position of the sugar, most preferably a 2'-0-alkyl, 2'-0-alkyl-0-alkyl or 2'-fluoro- modified nucleotide. In other preferred embodiments, RNA modifications include 2'- fluoro, 2'-amino and 2' O-methyl modifications on the ribose of pyrimidines, abasic residues or an inverted base at the 3' end of the RNA. Such modifications are routinely incorporated into oligonucleotides and these oligonucleotides have been shown to have a higher Tm (i.e., higher target binding affinity) than; 2'- deoxyoligonucleotides against a given target.

A number of nucleotide and nucleoside modifications have been shown to make the ASO into which they are incorporated more resistant to nuclease digestion than the native oligodeoxynucleotide; these modified oligos survive intact for a longer time than unmodified ASOs. Specific examples of modified ASOs include those comprising modified backbones, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. Most preferred are ASOs with phosphorothioate backbones and those with heteroatom backbones, particularly CH2 - NH-0-CH2, CH,~N(CH3)~0~CH2 (known as a methylene(methylimino) or MMI backbone], CH2 --0--N (CH3)-CH2, CH2 -N (CH3)-N (CH3)-CH2 and O-N (CH3)- CH2 -CH2 backbones, wherein the native phosphodiester backbone is represented as O- P-O-CH); amide backbones (see De Mesmaeker et al. Ace. Chem. Res. 1995,

28:366-374); morpholino backbone structures (see Summerton and Weller, U.S. Pat. No. 5,034,506); peptide nucleic acid (PNA) backbone (wherein the phosphodiester backbone of the ASO is replaced with a polyamide backbone, the nucleotides being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone, see Nielsen et al, Science 1991, 254, 1497). Phosphorus-containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3'alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3 '-amino phosphoramidate and

aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3 '-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'; see US patent nos.

3,687,808; 4,469,863; 4,476,301 ; 5,023,243; 5, 177, 196; 5, 188,897; 5,264,423;

5,276,019; 5,278,302; 5,286,717; 5,321, 131 ; 5,399,676; 5,405,939; 5,453,496; 5,455, 233; 5,466,677; 5,476,925; 5,519, 126; 5,536,821 ; 5,541,306; 5,550, 1 1 1 ; 5,563, 253; 5,571,799; 5,587,361 ; and 5,625,050.

Morpholino-based oligomeric compounds are described in Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41(14), 4503-4510); Genesis, volume 30, issue 3, 2001 ; Heasman, J., Dev. Biol, 2002, 243, 209-214; Nasevicius et al, Nat. Genet., 2000, 26, 216-220; Lacerra et al, Proc. Natl. Acad. Sci., 2000, 97, 9591-9596; and U.S. Pat. No. 5,034,506, issued Jul. 23, 1991.

Cyclohexenyl nucleic acid ASO mimetics are described in Wang et al., J. Am. Chem. Soc, 2000, 122, 8595-8602.

Modified ASO backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These comprise those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones;

formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts; see US patent nos. 5,034,506; 5, 166,315; 5, 185,444; 5,214, 134; 5,216, 141 ; 5,235,033; 5,264, 562; 5, 264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596, 086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;

5,618,704; 5,623, 070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference.

One or more substituted sugar moieties can also be included, e.g., one of the following at the 2' position: OH, SH, SCH ₃ , F, OCN, OCH ₃ OCH3, OCH3 0(CH2)n CH3, 0(CHi)n NH2 or 0(CH ₂ )n CH3 where n is from 1 to about 10; Ci to CIO lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; CI; Br; CN; CF3 ; OCF3; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; SOCH3; S02 CH3; ON02; N02; N3; NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino;

substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of an ASO; or a group for improving the pharmacodynamic properties of an ASO and other substituents having similar properties. A preferred modification includes 2'-methoxyethoxy P'-O-CFhCFhOCFb, also known as 2'-0-(2-methoxyethyl)] (Martin et al, Helv. Chim. Acta, 1995, 78, 486). Other preferred modifications include 2'-methoxy (2'-0-Ο¾), 2'-propoxy (2'-

OCFh CH2CH3) and 2'-fluoro (2'-F). Similar modifications may also be made at other positions on the ASO, particularly the 3' position of the sugar on the 3' terminal nucleotide and the 5' position of 5' terminal nucleotide. ASOs may also have sugar mimetics such as cyclobutyls in place of the pentofuranosyl group.

ASOs can also include, additionally or alternatively, nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5-methylcytosine (also referred to as 5 -methyl -2' deoxy cytosine and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleobases, e.g., 2-aminoadenine, 2- (methylamino)adenine, 2-(imidazolylalkyl)adenine, 2- (aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2- thiothymine, 5-bromouracil, 5- hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl)adenine and 2,6- diaminopurine. Kornberg, A., DNA Replication, W. H. Freeman & Co., San Francisco, 1980, pp75-77; Gebeyehu, G., et al. Nucl. Acids Res. 1987, 15:4513). A "universal" base known in the art, e.g., inosine, can also be included. 5-Me-C substitutions have been shown to increase nucleic acid duplex stability by 0.6- 1.2<0>C. (Sanghvi, Y. S., in Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions.

It is not necessary for all positions in a given ASO to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single ASO or even at within a single nucleoside within an ASO.

In some embodiments, both a sugar and an intemucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an ASO mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an ASO is replaced with an amide containing backbone, for example, an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds comprise, but are not limited to, US patent nos. 5,539,082; 5,714,331 ; and 5,719,262, each of which is herein incorporated by reference . Further teaching of PNA compounds can be found in Nielsen et al, Science, 1991, 254, 1497-1500.

ASOs can also include one or more nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases comprise the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases comprise other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5 -uracil (pseudo-uracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5- bromo, 5- trifluoromethyl and other 5 -substituted uracils and cytosines, 7-methylquanine and 7- methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3- deazaguanine and 3-deazaadenine. Further, nucleobases comprise those disclosed in United States Patent No. 3,687,808, those disclosed in 'The Concise Encyclopedia of Polymer Science And Engineering', pages 858-859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al, Angewandle Chemie, International Edition', 1991, 30, page 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications', pages 289- 302, Crooke, S.T. and Lebleu, B. ea., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6- azapyrimidines and N-2, N-6 and 0-6 substituted purines, comprising 2- aminopropyladenine, 5-propynyluracil and 5- propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6- 1.2<0>C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds, Antisense Research and Applications', CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2'-0-methoxyethyl sugar modifications. Modified nucleobases are described in US patent nos.

3,687,808, as well as 4,845,205; 5, 130,302; 5, 134,066; 5, 175, 273; 5, 367,066;

5,432,272; 5,457, 187; 5,459,255; 5,484,908; 5,502, 177; 5,525,711 ; 5,552,540;

5,587,469; 5,596,091 ; 5,614,617; 5,750,692, and 5,681,941, each of which is herein incorporated by reference.

In some embodiments, the ASOs are chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the ASO. Such moieties comprise but are not limited to, lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553- 6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S- tritylthiol (Manoharan et al, Ann. N. Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Kabanov et al, FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49- 54), a phospholipid, e.g., di- hexadecyl-rac -glycerol or triethylammonium 1 ,2-di-O-hexadecyl- rac-glycero-3-H- phosphonate (Manoharan et al, Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al, Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Mancharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al, Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-t oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937). See also US patent nos. 4,828,979; 4,948,882; 5,218, 105; 5,525,465; 5,541,313; 5,545,730; 5,552, 538; 5,578,717,

5,580,731 ; 5,580,731; 5,591,584; 5, 109, 124; 5, 1 18,802; 5, 138,045; 5,414,077; 5,486, 603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762, 779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082, 830;

5, 1 12,963; 5,214, 136; 5,082,830; 5, 1 12,963; 5,214, 136; 5, 245,022; 5,254,469;

5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391, 723;

5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5, 565,552; 5,567,810;

5,574, 142; 5,585,481; 5,587,371 ; 5,595,726; 5,597,696; 5,599,923; 5,599, 928 and 5,688,941, each of which is herein incorporated by reference.

These moieties or conjugates can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this invention, include groups that improve uptake, enhance resistance to degradation, and/or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties, in the context of this invention, include groups that improve uptake, distribution, metabolism or excretion of the compounds of the present invention. Representative conjugate groups are disclosed in International Patent Application No.

PCT/US92/09196, filed Oct. 23, 1992, and U.S. Pat. No. 6,287,860, which are incorporated herein by reference. Conjugate moieties include, but are not limited to, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-5- tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O- hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino- carbonyl-oxy cholesterol moiety. See, e.g., U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218, 105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731 ;

5,580,731 ; 5,591,584; 5, 109, 124; 5, 1 18,802; 5, 138,045; 5,414,077; 5,486,603;

5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779;

4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830;

5, 1 12,963; 5,214, 136; 5,082,830; 5, 1 12,963; 5,214, 136; 5,245,022; 5,254,469;

5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723;

5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810;

5,574, 142; 5,585,481; 5,587,371 ; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941.

Because of the heterogeneity in human Alu sequences across the genome, the use of pools of ASOs that target multiple families may be desired. In some embodiments, ASOs comprising the following sequences are used: 5-GGCCGAGGCGGGCGG-3 (SEQ ID NO: 71) and 5- TTTGGGAGGCCGAGG-3 (SEQ ID NO: 72). siRNA/shRNA

In some embodiments, the ASOs used in the present methods are interfering RNAs, including but not limited to a small interfering RNAs ("siRNAs") or a small hairpin RNAs ("shRNAs"). Methods for constructing interfering RNAs are well known in the art. For example, the interfering RNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e., each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double stranded structure); the antisense strand comprises nucleotide sequence that is complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof (i.e., an undesired gene) and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. Alternatively, interfering RNA is assembled from a single oligonucleotide, where the self-complementary sense and antisense regions are linked by means of nucleic acid based or non-nucleic acid-based linker(s). The interfering RNA can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises a nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The interfering can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self- complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siR A molecule capable of mediating RNA interference.

In some embodiments, the interfering RNA coding region encodes a self- complementary RNA molecule having a sense region, an antisense region and a loop region. Such an RNA molecule when expressed desirably forms a "hairpin" structure, and is referred to herein as an "shRNA." The loop region is generally between about 2 and about 10 nucleotides in length. In some embodiments, the loop region is from about 6 to about 9 nucleotides in length. In some embodiments, the sense region and the antisense region are between about 15 and about 20 nucleotides in length.

Following post-transcriptional processing, the small hairpin RNA is converted into a siRNA by a cleavage event mediated by the enzyme Dicer, which is a member of the RNase III family. The siRNA is then capable of inhibiting the expression of a gene with which it shares homology. For details, see Brummelkamp et al, Science 296:550-553, (2002); Lee et al, Nature Biotechnol., 20, 500-505, (2002); Miyagishi and Taira, Nature Biotechnol 20:497-500, (2002); Paddison et al. Genes & Dev. 16:948-958, (2002); Paul, Nature Biotechnol, 20, 505-508, (2002); Sui, Proc. Natl.

Acad. Sd. USA, 99(6), 5515-5520, (2002); Yu et al. Proc NatlAcadSci USA 99:6047- 6052, (2002).

The target RNA cleavage reaction guided by siRNAs is highly sequence specific. In general, siRNA containing a nucleotide sequences identical to a portion of the target nucleic acid are preferred for inhibition. However, 100% sequence identity between the siRNA and the target gene is not required to practice the present invention. Thus the invention has the advantage of being able to tolerate sequence variations that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence. For example, siRNA sequences with insertions, deletions, and single point mutations relative to the target sequence have also been found to be effective for inhibition. Alternatively, siRNA sequences with nucleotide analog substitutions or insertions can be effective for inhibition. In general the siRNAs must retain specificity for their target, i.e., must not directly bind to, or directly

significantly affect expression levels of, transcripts other than the intended target. Because of the heterogeneity in human Alu sequences across the genome, the use of pools of siRNAs that target multiple families may be desired.

Locked Nucleic Acids (LNAs)

In some embodiments, the modified ASOs used in the methods described herein comprise locked nucleic acid (LNA) molecules, e.g., including [alpha] -L-LNAs. LNAs comprise ribonucleic acid analogues wherein the ribose ring is "locked" by a methylene bridge between the 2'-oxgygen and the 4'-carbon - i.e., ASOs containing at least one LNA monomer, that is, one 2'-0,4'-C-methylene- ?-D-ribofuranosyl nucleotide. LNA bases form standard Watson-Crick base pairs but the locked configuration increases the rate and stability of the basepairing reaction (Jepsen et al, Oligonucleotides, 14, 130-146 (2004)). LNAs also have increased affinity to base pair with RNA as compared to DNA and initiate cleavage by RNAse H. These properties render LNAs especially useful as probes for fluorescence in situ hybridization (FISH) and comparative genomic hybridization, as knockdown tools for miRNAs, and as antisense oligonucleotides to target mRNAs or other RNAs, e.g., RNAs as described herein. See, e.g., Kurreck et al., Nucleic Acids Res. 30(9): 191 1— 1918 (2002).

The LNA molecules can include molecules comprising 10-30, e.g., 12-24, e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in each strand, wherein one of the strands is substantially identical, e.g., at least 80% (or more, e.g., 85%, 90%, 95%, or 100%) identical, e.g., having 3, 2, 1, or 0 mismatched nucleotide(s), to a target region in the RNA. The LNA molecules can be chemically synthesized using methods known in the art.

The LNA molecules can be designed using any method known in the art; a number of algorithms are known, and are commercially available (e.g., on the internet, for example at exiqon.com). See, e.g., You et al., Nuc. Acids. Res. 34:e60 (2006);

McTigue et al., Biochemistry 43 :5388-405 (2004); and Levin et al., Nuc. Acids. Res. 34:e l42 (2006). For example, "gene walk" methods, similar to those used to design antisense oligos, can be used to optimize the inhibitory activity of the LNA; for example, a series of ASOs of 10-30 nucleotides spanning the length of a target R A can be prepared, followed by testing for activity. Optionally, gaps, e.g., of 5-10 nucleotides or more, can be left between the LNAs to reduce the number of ASOs synthesized and tested. GC content is preferably between about 30-60%. General guidelines for designing LNAs are known in the art; for example, LNA sequences will bind very tightly to other LNA sequences, so it is preferable to avoid significant complementarity within an LNA. Contiguous runs of more than four LNA residues, should be avoided where possible (for example, it may not be possible with very short (e.g., about 9-10 nt) ASOs). In some embodiments, the LNAs are xylo-LNAs.

For additional information regarding LNAs see U.S. Pat. Nos. 6,268,490; 6,734,291 ; 6,770,748; 6,794,499; 7,034, 133; 7,053,207; 7,060,809; 7,084, 125; and 7,572,582; and U.S. Pre-Grant Pub. Nos. 20100267018; 20100261 175; and 20100035968;

Koshkin et al. Tetrahedron 54, 3607-3630 (1998); Obika et al. Tetrahedron Lett. 39, 5401-5404 ( 1998); Jepsen et al., Oligonucleotides 14: 130-146 (2004); Kauppinen et al., Drug Disc. Today 2(3):287-290 (2005); and Ponting et al., Cell 136(4): 629-641 (2009), and references cited therein.

Because of the heterogeneity in human Alu sequences across the genome, the use of pools of LNAs that target multiple families may be desired.

Making and Using ASOs

Nucleic acid sequences used to practice this invention can be made using methods known in the art, e.g., synthesized in vitro by well-known chemical synthesis techniques, as described in, e.g., Adams (1983) J. Am. Chem. Soc. 105 :661 ; Belousov (1997) Nucleic Acids Res. 25 :3440-3444; Frenkel (1995) Free Radic. Biol. Med. 19:373-380; Blommers ( 1994) Biochemistry 33 :7886-7896; Narang (1979) Meth. Enzymol. 68:90; Brown (1979) Meth. Enzymol. 68: 109; Beaucage (1981) Tetra. Lett. 22: 1859; U.S. Patent No. 4,458,066.

Techniques for the manipulation of nucleic acids used to practice this invention, such as, e.g., subcloning, labeling probes (e.g., random-primer labeling using Klenow polymerase, nick translation, amplification), sequencing, hybridization and the like are well described in the scientific and patent literature, see, e.g., Sambrook et al, Molecular Cloning; A Laboratory Manual 3d ed. (2001); Current Protocols in Molecular Biology, Ausubel et al, eds. (John Wiley & Sons, Inc., New York 2010); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); Laboratory Techniques In Biochemistry And Molecular Biology: Hybridization With Nucleic Acid Probes, Part I. Theory and Nucleic Acid Preparation, Tijssen, ed. Elsevier, N.Y. (1993).

Alu/B2 Nucleic Acids

The methods described herein can also include the use of Alu or B2 nucleic acids to induce cell death in a cell, e.g., for the treatment of disorders associated with abnormal apoptotic or differentiative processes. The Alu or B2 nucleic acids can be, e.g., Alu or B2 RNA comprising a full length Alu or B2 sequence, or a fragment thereof that induces cell death. Methods for identifying fragments that induce cell death are known in the art and described herein, see, e.g., Example 3 herein. The methods can include incubating a sample of test cells, e.g., cancer cells, in the presence of a candidate fragment and a control fragment (e.g., of the same length and modifications but having a scrambled sequence), and selecting those fragments that induce cell death under conditions in which the control fragment does not induce cell death.

The Alu or B2 nucleic acids can be administered to the cells as RNA, e.g., naked RNA or RNA encapsulated in a carrier, e.g., a liposomal carrier. Alternatively, an expression construct encoding the Alu or B2 nucleic acid or fragment thereof can be administered.

Expression Constructs

Expression constructs encoding an Alu or B2 nucleic acid or fragment thereof can be administered in any effective carrier, e.g., any formulation or composition capable of effectively delivering the component gene to cells in vivo. Approaches include insertion of the gene in viral vectors, including recombinant retroviruses, adenovirus, adeno-associated virus, lentivirus, and herpes simplex virus- 1, or recombinant bacterial or eukaryotic plasmids. Viral vectors transfect cells directly; plasmid DNA can be delivered naked or with the help of, for example, cationic liposomes

(lipofectamine) or derivatized (e.g., antibody conjugated), polylysine conjugates, gramacidin S, artificial viral envelopes or other such intracellular carriers, as well as direct injection of the gene construct or CaP04 precipitation carried out in vivo. A preferred approach for in vivo introduction of nucleic acid into a cell is by use of a viral vector containing nucleic acid, e.g., a cDNA. Infection of cells with a viral vector has the advantage that a large proportion of the targeted cells can receive the nucleic acid. Additionally, molecules encoded within the viral vector, e.g., by a cDNA contained in the viral vector, are expressed efficiently in cells that have taken up viral vector nucleic acid.

Retrovirus vectors and adeno-associated virus vectors can be used as a recombinant gene delivery system for the transfer of exogenous genes in vivo, particularly into humans. These vectors provide efficient delivery of genes into cells, and the transferred nucleic acids are stably integrated into the chromosomal DNA of the host. The development of specialized cell lines (termed "packaging cells") which produce only replication-defective retroviruses has increased the utility of retroviruses for gene therapy, and defective retroviruses are characterized for use in gene transfer for gene therapy purposes (for a review see Miller, Blood 76:271 (1990)). A replication defective retrovirus can be packaged into virions, which can be used to infect a target cell through the use of a helper virus by standard techniques. Protocols for producing recombinant retroviruses and for infecting cells in vitro or in vivo with such viruses can be found in Ausubel, et al., eds., Current Protocols in Molecular Biology, Greene Publishing Associates, (1989), Sections 9.10-9.14, and other standard laboratory manuals. Examples of suitable retroviruses include pLJ, pZIP, pWE and pEM which are known to those skilled in the art. Examples of suitable packaging virus lines for preparing both ecotropic and amphotropic retroviral systems include Ψ(¾ρ, Ψ&ε, Ψ2 and ΨΑπι. Retroviruses have been used to introduce a variety of genes into many different cell types, including epithelial cells, in vitro and/or in vivo (see for example Eglitis, et al. (1985) Science 230: 1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad. Sci. USA 85 :6460-6464; Wilson et al. (1988) Proc. Natl. Acad. Sci. USA 85 :3014-3018; Armentano et al. (1990) Proc. Natl. Acad. Sci. USA 87:6141-6145; Huber et al. ( 1991) Proc. Natl. Acad. Sci. USA 88: 8039-8043; Ferry et al. (1991) Proc. Natl. Acad. Sci. USA 88: 8377-8381 ; Chowdhury et al. (1991) Science

254: 1802-1805; van Beusechem et al. ( 1992) Proc. Natl. Acad. Sci. USA 89:7640-

7644; Kay et al. (1992) Human Gene Therapy 3 :641-647; Dai et al. (1992) Proc. Natl. Acad. Sci. USA 89: 10892-10895; Hwu et al. (1993) J. Immunol. 150:4104-41 15; U.S. Patent No. 4,868, 1 16; U.S. Patent No. 4,980,286; PCT Application WO 89/07136; PCT Application WO 89/02468; PCT Application WO 89/05345; and PCT

Application WO 92/07573).

Another viral gene delivery system useful in the present methods utilizes adenovirus- derived vectors. The genome of an adenovirus can be manipulated, such that it encodes and expresses a gene product of interest but is inactivated in terms of its ability to replicate in a normal lytic viral life cycle. See, for example, Berkner et al, BioTechniques 6:616 ( 1988); Rosenfeld et al, Science 252:431-434 (1991); and Rosenfeld et al, Cell 68: 143-155 ( 1992). Suitable adenoviral vectors derived from the adenovirus strain Ad type 5 dl324 or other strains of adenovirus (e.g., Ad2, Ad3, or Ad7 etc.) are known to those skilled in the art. Recombinant adenoviruses can be advantageous in certain circumstances, in that they are not capable of infecting non- dividing cells and can be used to infect a wide variety of cell types, including epithelial cells (Rosenfeld et al, (1992) supra). Furthermore, the virus particle is relatively stable and amenable to purification and concentration, and as above, can be modified so as to affect the spectrum of infectivity . Additionally, introduced adenoviral DNA (and foreign DNA contained therein) is not integrated into the genome of a host cell but remains episomal, thereby avoiding potential problems that can occur as a result of insertional mutagenesis in situ, where introduced DNA becomes integrated into the host genome (e.g., retroviral DNA). Moreover, the carrying capacity of the adenoviral genome for foreign DNA is large (up to 8 kilobases) relative to other gene delivery vectors (Berkner et al., supra; Haj-Ahmand and Graham, J. Virol. 57:267 (1986).

Yet another viral vector system useful for delivery of nucleic acids is the adeno- associated virus (AAV). Adeno-associated virus is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle. (For a review see Muzyczka et al., Curr. Topics in Micro, and Immunol.158:97-129 (1992). It is also one of the few viruses that may integrate its DNA into non-dividing cells, and exhibits a high frequency of stable integration (see for example Flotte et al., Am. J. Respir. Cell. Mol. Biol. 7:349-356 (1992); Samulski et al., J. Virol. 63 :3822-3828 (1989); and

McLaughlin et al, J. Virol. 62: 1963-1973 (1989). Vectors containing as little as 300 base pairs of AAV can be packaged and can integrate. Space for exogenous DNA is limited to about 4.5 kb. An AAV vector such as that described in Tratschin et al, Mol. Cell. Biol. 5 :3251-3260 (1985) can be used to introduce DNA into cells. A variety of nucleic acids have been introduced into different cell types using AAV vectors (see for example Hermonat et al, Proc. Natl. Acad. Sci. USA 81 :6466-6470 (1984); Tratschin et al., Mol. Cell. Biol. 4:2072-2081 ( 1985); Wondisford et al., Mol. Endocrinol. 2:32-39 ( 1988); Tratschin et al., J. Virol. 51 :61 1-619 (1984); and Flotte et al., J. Biol. Chem. 268:3781-3790 ( 1993).

In some embodiments, Alu or B2 nucleic acid or fragments thereof, or nucleic acids encoding an Alu or B2 nucleic acid or fragments thereof, are entrapped in liposomes bearing positive charges on their surface (e.g., lipofectins), which can be tagged with antibodies against cell surface antigens of the target cancer cells.

In clinical settings, the nucleic acids can be introduced into a subject by any of a number of methods, each of which is familiar in the art. For instance, a

pharmaceutical preparation can be introduced systemically, e.g., by intravenous injection, and specific transduction of the protein in the target cells will occur predominantly from specificity of transfection, provided by the gene delivery vehicle, cell -type or tissue-type expression due to the transcriptional regulatory sequences controlling expression of the receptor gene, or a combination thereof. In other embodiments, initial delivery of the nucleic acids is more limited, with introduction into the subject being quite localized. For example, the nucleic acids can be introduced by catheter (see U.S. Patent 5,328,470) or by stereotactic injection (e.g., Chen et al., PNAS USA 91 : 3054-3057 (1994)). In some embodiments, the nucleic acids are administered during or after surgical resection of a tumor; in some embodiments, a controlled-release hydrogel comprising the nucleic acids is administered at the conclusion of resection before closure to provide a steady dose of the nucleic acids over time.

A pharmaceutical preparation of the nucleic acids can consist essentially of the gene delivery system (e.g., viral vector(s)) in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is embedded. Alternatively, where the complete gene delivery system can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can comprise one or more cells, which produce the gene delivery system. Treating Cellular Differentiate e Disorders

As noted above, the methods described herein can also include the use of Alu or B2 nucleic acids or fragments thereof to induce cell death in a cell, e.g., for the treatment of disorders associated with abnormal apoptotic or differentiative processes, e.g., cellular proliferative disorders or cellular differentiative disorders, e.g., cancer, e.g., by producing an active or passive immunity. Examples of cellular proliferative and/or differentiative disorders include cancer, e.g., carcinoma, sarcoma, metastatic disorders or hematopoietic neoplastic disorders, e.g., leukemias. A metastatic tumor can arise from a multitude of primary tumor types, including but not limited to those of prostate, colon, lung, breast and liver origin.

As used herein, the terms "cancer", "hyperproliferative" and "neoplastic" refer to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. Hyperproliferative and neoplastic disease states may be categorized as pathologic, i.e., characterizing or constituting a disease state, or may be categorized as non-pathologic, i.e., a deviation from normal but not associated with a disease state. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness. "Pathologic hyperproliferative" cells occur in disease states characterized by malignant tumor growth. Examples of non-pathologic

hyperproliferative cells include proliferation of cells associated with wound repair. The terms "cancer" or "neoplasms" include malignancies of the various organ systems, such as affecting lung, breast, thyroid, lymphoid, gastrointestinal, and genito-urinary tract, as well as adenocarcinomas which include malignancies such as most colon cancers, renal-cell carcinoma, prostate cancer and/or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus.

The term "carcinoma" is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas, gastrointestinal system carcinomas, genitourinary system carcinomas, testicular carcinomas, breast carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas. In some embodiments, the disease is renal carcinoma or melanoma. Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon and ovary. The term also includes carcinosarcomas, e.g., which include malignant tumors composed of carcinomatous and sarcomatous tissues. An "adenocarcinoma" refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures.

The term "sarcoma" is art recognized and refers to malignant tumors of mesenchymal derivation.

Additional examples of proliferative disorders include hematopoietic neoplastic disorders. As used herein, the term "hematopoietic neoplastic disorders" includes diseases involving hyperplastic/neoplastic cells of hematopoietic origin, e.g., arising from myeloid, lymphoid or erythroid lineages, or precursor cells thereof. Preferably, the diseases arise from poorly differentiated acute leukemias, e.g., erythroblastic leukemia and acute megakaryoblastic leukemia. Additional exemplary myeloid disorders include, but are not limited to, acute promyeloid leukemia (APML), acute myelogenous leukemia (AML) and chronic myelogenous leukemia (CML) (reviewed in Vaickus, L. (1991) Crit Rev. in Oncol. /Hemotol. 1 1 :267-97); lymphoid

malignancies include, but are not limited to acute lymphoblastic leukemia (ALL) which includes B-lineage ALL and T-lineage ALL, chronic lymphocytic leukemia (CLL), prolymphocyte leukemia (PLL), hairy cell leukemia (HLL) and

Waldenstrom's macroglobulinemia (WM). Additional forms of malignant lymphomas include, but are not limited to non-Hodgkin lymphoma and variants thereof, peripheral T cell lymphomas, adult T cell leukemia/lymphoma (ATL), cutaneous T- cell lymphoma (CTCL), large granular lymphocytic leukemia (LGF), Hodgkin's disease and Reed-Sternberg disease.

Other examples of proliferative and/or differentiative disorders include skin disorders. The skin disorder may involve the aberrant activity of a cell or a group of cells or layers in the dermal, epidermal, or hypodermal layer, or an abnormality in the dermal- epidermal junction. For example, the skin disorder may involve aberrant activity of keratinocytes (e.g., hyperproliferative basal and immediately suprabasal

keratinocytes), melanocytes, Langerhans cells, Merkel cells, immune cell, and other cells found in one or more of the epidermal layers, e.g., the stratum basale (stratum germinativum), stratum spinosum, stratum granulosum, stratum lucidum or stratum corneum. In other embodiments, the disorder may involve aberrant activity of a dermal cell, e.g., a dermal endothelial, fibroblast, immune cell (e.g., mast cell or macrophage) found in a dermal layer, e.g., the papillary layer or the reticular layer. Examples of skin disorders include psoriasis, psoriatic arthritis, dermatitis (eczema), e.g., exfoliative dermatitis or atopic dermatitis, pityriasis rubra pilaris, pityriasis rosacea, parapsoriasis, pityriasis lichenoiders, lichen planus, lichen nitidus, ichthyosiform dermatosis, keratodermas, dermatosis, alopecia areata, pyoderma gangrenosum, vitiligo, pemphigoid (e.g., ocular cicatricial pemphigoid or bullous pemphigoid), urticaria, prokeratosis, rheumatoid arthritis that involves

hyperproliferation and inflammation of epithelial-related cells lining the joint capsule; dermatitises such as seborrheic dermatitis and solar dermatitis; keratoses such as seborrheic keratosis, senile keratosis, actinic keratosis, photo-induced keratosis, and keratosis follicularis; acne vulgaris; keloids and prophylaxis against keloid formation; nevi; warts including verruca, condyloma or condyloma acuminatum, and human papilloma viral (HPV) infections such as venereal warts; leukoplakia; lichen planus; and keratitis. The skin disorder can be dermatitis, e.g., atopic dermatitis or allergic dermatitis, or psoriasis.

In some embodiments, the disorder is psoriasis. The term "psoriasis" is intended to have its medical meaning, namely, a disease which afflicts primarily the skin and produces raised, thickened, scaling, nonscarring lesions. The lesions are usually sharply demarcated erythematous papules covered with overlapping shiny scales. The scales are typically silvery or slightly opalescent. Involvement of the nails frequently occurs resulting in pitting, separation of the nail, thickening and discoloration.

Psoriasis is sometimes associated with arthritis, and it may be crippling.

Hyperproliferation of keratinocytes is a key feature of psoriatic epidermal hyperplasia along with epidermal inflammation and reduced differentiation of keratinocytes. Multiple mechanisms have been invoked to explain the keratinocyte

hyperproliferation that characterizes psoriasis. Disordered cellular immunity has also been implicated in the pathogenesis of psoriasis. Examples of psoriatic disorders include chronic stationary psoriasis, psoriasis vulgaris, eruptive (gluttate) psoriasis, psoriatic erythroderma, generalized pustular psoriasis (Von Zumbusch), annular pustular psoriasis, and localized pustular psoriasis. Pharmaceutical Compositions

The methods described herein can include the administration of pharmaceutical compositions and formulations comprising an Alu or B2 RNA, a DNA encoding an Alu or B2 RNA, or an ASO that targets Alu or B2 RNA.

In some embodiments, the compositions are formulated with a pharmaceutically acceptable carrier. The pharmaceutical compositions and formulations can be administered parenterally, topically, orally or by local administration, such as by aerosol or transdermally. The pharmaceutical compositions can be formulated in any way and can be administered in a variety of unit dosage forms depending upon the condition or disease and the degree of illness, the general medical condition of each patient, the resulting preferred method of administration and the like. Details on techniques for formulation and administration of pharmaceuticals are well described in the scientific and patent literature, see, e.g., Remington: The Science and Practice of Pharmacy, 21st ed., 2005.

The ASOs can be administered alone or as a component of a pharmaceutical formulation (composition). The compounds may be formulated for administration, in any convenient way for use in human or veterinary medicine. Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.

Formulations of the compositions of the invention include those suitable for intradermal, inhalation, oral/ nasal, topical, parenteral, rectal, and/or intravaginal administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient (e.g., nucleic acid sequences of this invention) which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration, e.g., intradermal or inhalation. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect, e.g., an antigen specific T cell or humoral response. Pharmaceutical formulations can be prepared according to any method known to the art for the manufacture of pharmaceuticals. Such drugs can contain sweetening agents, flavoring agents, coloring agents and preserving agents. A formulation can be admixtured with nontoxic pharmaceutically acceptable excipients which are suitable for manufacture. Formulations may comprise one or more diluents, emulsifiers, preservatives, buffers, excipients, etc. and may be provided in such forms as liquids, powders, emulsions, lyophilized powders, sprays, creams, lotions, controlled release formulations, tablets, pills, gels, on patches, in implants, etc.

Pharmaceutical formulations for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in appropriate and suitable dosages. Such carriers enable the pharmaceuticals to be formulated in unit dosage forms as tablets, pills, powder, dragees, capsules, liquids, lozenges, gels, syrups, slurries, suspensions, etc., suitable for ingestion by the patient. Pharmaceutical preparations for oral use can be formulated as a solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable additional compounds, if desired, to obtain tablets or dragee cores. Suitable solid excipients are carbohydrate or protein fillers include, e.g., sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxy-methylcellulose; and gums including arabic and tragacanth; and proteins, e.g., gelatin and collagen. Disintegrating or solubilizing agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate. Push-fit capsules can contain active agents mixed with a filler or binders such as lactose or starches, lubricants such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active agents can be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycol with or without stabilizers.

Aqueous suspensions can contain an active agent (e.g., nucleic acid sequences of the invention) in admixture with excipients suitable for the manufacture of aqueous suspensions, e.g., for aqueous intradermal injections. Such excipients include a suspending agent, such as sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia, and dispersing or wetting agents such as a naturally occurring phosphatide (e.g., lecithin), a condensation product of an alkylene oxide with a fatty acid (e.g., polyoxyethylene stearate), a condensation product of ethylene oxide with a long chain aliphatic alcohol (e.g., heptadecaethylene oxycetanol), a condensation product of ethylene oxide with a partial ester derived from a fatty acid and a hexitol (e.g., polyoxyethylene sorbitol mono-oleate), or a condensation product of ethylene oxide with a partial ester derived from fatty acid and a hexitol anhydride (e.g., polyoxyethylene sorbitan mono-oleate). The aqueous suspension can also contain one or more preservatives such as ethyl or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents and one or more sweetening agents, such as sucrose, aspartame or saccharin. Formulations can be adjusted for osmolality.

In some embodiments, oil-based pharmaceuticals are used for administration of nucleic acid sequences of the invention. Oil-based suspensions can be formulated by suspending an active agent in a vegetable oil, such as arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin; or a mixture of these. See e.g., U.S. Patent No. 5,716,928 describing using essential oils or essential oil components for increasing bioavailability and reducing inter- and intra-individual variability of orally administered hydrophobic pharmaceutical compounds (see also U.S. Patent No. 5,858,401). The oil suspensions can contain a thickening agent, such as beeswax, hard paraffin or cetyl alcohol. Sweetening agents can be added to provide a palatable oral preparation, such as glycerol, sorbitol or sucrose. These formulations can be preserved by the addition of an antioxidant such as ascorbic acid. As an example of an injectable oil vehicle, see Minto (1997) J. Pharmacol. Exp. Ther. 281 :93-102.

Pharmaceutical formulations can also be in the form of oil-in-water emulsions. The oily phase can be a vegetable oil or a mineral oil, described above, or a mixture of these. Suitable emulsifying agents include naturally-occurring gums, such as gum acacia and gum tragacanth, naturally occurring phosphatides, such as soybean lecithin, esters or partial esters derived from fatty acids and hexitol anhydrides, such as sorbitan mono-oleate, and condensation products of these partial esters with ethylene oxide, such as polyoxyethylene sorbitan mono-oleate. The emulsion can also contain sweetening agents and flavoring agents, as in the formulation of syrups and elixirs. Such formulations can also contain a demulcent, a preservative, or a coloring agent. In alternative embodiments, these injectable oil-in-water emulsions of the invention comprise a paraffin oil, a sorbitan monooleate, an ethoxylated sorbitan monooleate and/or an ethoxylated sorbitan trioleate.

The pharmaceutical compounds can also be administered by in intranasal, intraocular and intravaginal routes including suppositories, insufflation, powders and aerosol formulations (for examples of steroid inhalants, see e.g., Rohatagi (1995) J. Clin. Pharmacol. 35 : 1 187-1 193; Tjwa (1995) Ann. Allergy Asthma Immunol. 75 : 107- 11 1). Suppositories formulations can be prepared by mixing the drug with a suitable non- irritating excipient which is solid at ordinary temperatures but liquid at body temperatures and will therefore melt in the body to release the drug. Such materials are cocoa butter and polyethylene glycols.

In some embodiments, the pharmaceutical compounds can be delivered transdermally, by a topical route, formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols.

In some embodiments, the pharmaceutical compounds can also be delivered as microspheres for slow release in the body. For example, microspheres can be administered via intradermal injection of drug which slowly release subcutaneously; see Rao (1995) J. Biomater Sci. Polym. Ed. 7:623-645; as biodegradable and injectable gel formulations, see, e.g., Gao ( 1995) Pharm. Res. 12: 857-863 (1995); or, as microspheres for oral administration, see, e.g., Eyles (1997) J. Pharm. Pharmacol. 49:669-674.

In some embodiments, the pharmaceutical compounds can be parenterally administered, such as by intravenous (IV) administration or administration into a body cavity or lumen of an organ. These formulations can comprise a solution of active agent dissolved in a pharmaceutically acceptable carrier. Acceptable vehicles and solvents that can be employed are water and Ringer's solution, an isotonic sodium chloride. In addition, sterile fixed oils can be employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can likewise be used in the preparation of injectables. These solutions are sterile and generally free of undesirable matter. These formulations may be sterilized by conventional, well known sterilization techniques. The formulations may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents, e.g., sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like. The concentration of active agent in these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight, and the like, in accordance with the particular mode of administration selected and the patient's needs. For IV administration, the formulation can be a sterile injectable preparation, such as a sterile injectable aqueous or oleaginous suspension. This suspension can be formulated using those suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation can also be a suspension in a nontoxic parenterally-acceptable diluent or solvent, such as a solution of 1,3- butanediol. The administration can be by bolus or continuous infusion (e.g., substantially uninterrupted introduction into a blood vessel for a specified period of time).

In some embodiments, the pharmaceutical compounds and formulations can be lyophilized. Stable lyophilized formulations comprising an ASO can be made by lyophilizing a solution comprising a pharmaceutical of the invention and a bulking agent, e.g., mannitol, trehalose, raffinose, and sucrose or mixtures thereof. A process for preparing a stable lyophilized formulation can include lyophilizing a solution about 2.5 mg/mL protein, about 15 mg/mL sucrose, about 19 mg/mL NaCl, and a sodium citrate buffer having a pH greater than 5.5 but less than 6.5. See, e.g., U.S. 20040028670.

The compositions and formulations can be delivered by the use of liposomes. By using liposomes, particularly where the liposome surface carries ligands specific for target cells, or are otherwise preferentially directed to a specific organ, one can focus the delivery of the active agent into target cells in vivo. See, e.g., U.S. Patent Nos.

6,063,400; 6,007,839; Al-Muhammed (1996) J. Microencapsul. 13 :293-306; Chonn (1995) Curr. Opin. Biotechnol. 6:698-708; Ostro (1989) Am. J. Hosp. Pharm.

46: 1576-1587. As used in the present invention, the term "liposome" means a vesicle composed of amphiphilic lipids arranged in a bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered.

Cationic liposomes are positively charged liposomes that are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively-charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.

Liposomes can also include "sterically stabilized" liposomes, i.e., liposomes comprising one or more specialized lipids. When incorporated into liposomes, these specialized lipids result in liposomes with enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. Liposomes and their uses are further described in U.S. Pat. No. 6,287,860.

The formulations of the invention can be administered for prophylactic and/or therapeutic treatments. In some embodiments, for therapeutic applications, compositions are administered to a subject who is need of reduced triglyceride levels, or who is at risk of or has a disorder described herein, in an amount sufficient to cure, alleviate or partially arrest the clinical manifestations of the disorder or its complications; this can be called a therapeutically effective amount. For example, in some embodiments, pharmaceutical compositions of the invention are administered in an amount sufficient to decrease serum levels of triglycerides in the subject.

The amount of pharmaceutical composition adequate to accomplish this is a therapeutically effective dose. The dosage schedule and amounts effective for this use, i.e., the dosing regimen, will depend upon a variety of factors, including the stage of the disease or condition, the severity of the disease or condition, the general state of the patient's health, the patient's physical status, age and the like. In calculating the dosage regimen for a patient, the mode of administration also is taken into consideration.

The dosage regimen also takes into consideration pharmacokinetics parameters well known in the art, i.e., the active agents' rate of absorption, bioavailability, metabolism, clearance, and the like (see, e.g., Hidalgo-Aragones (1996) J. Steroid Biochem. Mol. Biol. 58:611-617; Groning (1996) Pharmazie 51 :337-341 ; Fotherby (1996) Contraception 54:59-69; Johnson (1995) J. Pharm. Sci. 84: 1 144- 1146;

Rohatagi (1995) Pharmazie 50:610-613; Brophy (1983) Eur. J. Clin. Pharmacol. 24: 103-108: Remington: The Science and Practice of Pharmacy. 21st ed.. 2005). The state of the art allows the clinician to determine the dosage regimen for each individual patient, active agent and disease or condition treated. Guidelines provided for similar compositions used as pharmaceuticals can be used as guidance to determine the dosage regiment, i.e., dose schedule and dosage levels, administered practicing the methods of the invention are correct and appropriate.

Single or multiple administrations of formulations can be given depending on for example: the dosage and frequency as required and tolerated by the patient, the degree and amount of therapeutic effect generated after each administration (e.g., effect on tumor size or growth), and the like. The formulations should provide a sufficient quantity of active agent to effectively treat, prevent or ameliorate conditions, diseases or symptoms.

In alternative embodiments, pharmaceutical formulations for oral administration are in a daily amount of between about 1 to 100 or more mg per kilogram of body weight per day. Lower dosages can be used, in contrast to administration orally, into the blood stream, into a body cavity or into a lumen of an organ. Substantially higher dosages can be used in topical or oral administration or administering by powders, spray or inhalation. Actual methods for preparing parenterally or non-parenterally administrable formulations will be known or apparent to those skilled in the art and are described in more detail in such publications as Remington: The Science and Practice of Pharmacy, 21st ed., 2005.

In some embodiments, the methods described herein can include co-administration with other drugs or pharmaceuticals, e.g., compositions for providing cholesterol homeostasis. For example, the ASOs can be co-administered with drugs for treating or reducing risk of a disorder described herein. EXAMPLES

The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

Experimental procedures

The following materials and methods were used in the Examples below.

Cell culture and transfections. NIH/3T3 cells were cultured in DMEM+Glutamax (Life Technologies) supplemented with 10% fetal bovine serum and 1%

Penicillin/Streptomycin. Before heat shock stimulus cells were trypsinized and resuspended in 5ml complete medium in a 15ml falcon tube. Subsequently, cells were either placed in 37°C (control cells, pre-H/S condition) or in 45°C (treated cells, post- H/S condition) for 15 min. Time points mentioned throughout this work have as a starting point the moment of the start of the heat shock stimulus. After the end of this 15 minute period, cells were centrifuged shortly (2min) and cell pellets were directly resuspended into Trizol (Thermofischer) for the RNA-seq analysis or fixated with 1% formaldehyde for the ChlP-seq and CHART-seq analysis. For LNA transfections against B2 RNA we used the HiPerfect transfection reagent (Qiagen) and the sequence of the LNAs used were as follows: LNAl 1 : 5 '-GTTACGGATGGTTGTG-3 ' and LNA 12 : 5 '-TGTAGCTGTCTTCAG-3 ' . The scramble LNA sequence was 5 '- CACGTCTATACACCAC-3'. In detail, the LNAs were diluted to lOOuM and incubated with 1.35ul of the transfection reagent in a final volume of lOul for 15-20 min at room temperature (RT). Subsequently the transfection mix was transferred to 2ml of recently trypsinized cells in full culture medium containing 5 x 10 ⁵ cells (final LNA concentration 500nM). A fluorophore conjugated LNA was also transfected to test transfection efficiency. Subsequently cells were plated and incubated at 37°C for 24 hours before testing. In the meanwhile, after lh from plating, a subset of cells was subjected to FACS analysis and transfection rate was estimated to 90% of live cells. For LNA transfections against Ezh2 we used the following LNA ASO sequence: 5'- TTCTTCTTCTGTGCAG-3'. Transfections were performed with HiPerfect as mentioned above but for a final LNA concentration of 25nM. For RNA transfections of the B2 RNA and its fragments we used the TransMessenger Transfection Reagent (Qiagen). In brief, 16 pmol of RNA in Buffer EC was incubated for 5 min at RT with 2ul enhancer, and subsequently 8ul transfection reagent was added to a total reaction of lOOul and incubated for 10 min at RT before addition to recently trypsinized cells in culture medium without serum. 2,6 x 10 ⁴ transfected cells were plated and incubated at 37°C for 30 min before adding an equal volume of complete medium (with serum). After 2 hours, a subset of these cells were washed with PBS twice and RNA was extracted using Trizol and analyzed with qPCR against B2 RNA to confirm B2 overexpression. After 6 hours from plating the medium was changed to complete medium and cells were counted during the subsequent days using a Nexcelom Cellometer. RNA in vitro transcription and RNA-protein incubations. RNAs were transcribed in vitro and Ezh2, Eed and GST proteins were purified as described previously (32) with the following modifications: For RNA in vitro transcription we used the AmpliScribe T7 High Yield Transcription Kit (Epicentre) applying a 3h incubation at 42°C and using a template resulting to the following B2 RNA sequence: 5'-

GGGGCTGGTGAGATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCGA AGGTCCGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCG TAACGAGATCTGACTCCCTCTTCTGGAGTGTCTGAAGACAGCTACAGTGT ACTTACATATAATAAATAAATAAATCTTTAAAAAAAAA - 3'.

For smaller B2 RNA fragments the respective templates were constructed based on the above sequence and the nt numbering mentioned in the text. In detail, domain I RNA was from +lnt to +72nt, domain I+II RNA from +lnt to +105nt, and domain III from +99 to +140nt. The quality of the transcribed RNA was tested running a 6% UREA PAGE gel as well as through small RNA-seq library construction and next generation sequencing (see below). RNAs were purified using the ZymoResearch

RNA clean kit. Incubations, unless mentioned differently in the text were performed with 200 nM in-vitro-transcribed B2 RNA folded with 300mM NaCl and

supplemented with TAP buffer (final reaction concentrations: 5nM Tris pH 7.9, 0.5mM MgC12, 0.02mM EDTA, 0.01% NP40, 1% glycerol, 0.2mM DTT). For RNA folding the RNA was incubated for 1 min at 50°C and cooled down with a rate of C/10sec. Cleavage time-courses were quantified using ImageJ (NIH). The fraction of full-Length B2 RNA present at each time point was measured and this data was fit using Kaleidagraph (Synergy) using the differential form of the rate equation for an irreversible, first-order reaction.

Double-Filter Binding Assays. Binding reactions were assembled with 1 μΐ of 1,000 cpm/μΐ (0.1 nM final concentration) folded RNA and purified protein at the shown concentrations in binding buffer (50 mM Tris-HCl [pH 8.0], 100 mM NaCl, 5 mM MgC12, 10 ug/ml BSA, 0.05% NP40, 1 mM DTT, 20 U RNaseOUT [Invitrogen], and 5% glycerol) in 30 μΐ. A total of 50 ng/μΐ yeast tRNA (Ambion catalog number

AM7119) was used as a nonspecific competitor. After 30 min at 30°C, the reactions were filtered through nitrocellulose (PROTRAN, Schleicher & Schuell) and Hybond- N+ (GE Healthcare) membranes using a Minifold I system (Whatman), washed with 600 μΐ washing buffer (50 mM Tris-HCl [pH 8.0], 100 mM NaCl, 1.5 mM MgC12, 0.05% NP40, 1 mM DTT), dried, exposed to a phosphor screen, and scanned after 2 hr in a Typhoon Trio (GE Healthcare Life Sciences). Data were quantified by Quantity One and normalized as previously described (Cifuentes-Rojas et al, 2014). Equilibrium dissociation constants, Kd, were obtained by fitting the binding data to a one-site binding model by nonlinear regression using Graphpad Prism.

CHART and ChIP analyses. At least two biological replicates were analyzed for CHART and ChIP experiments. The B2 CHART was modified from the original CHART protocols (33). In detail, 12 millions cells were crosslinked with 1% formaldehyde for 10 min at room temperature. Crosslinking was then quenched with 0.125 M glycine for 5 min and washed with PBS 3 times. Snap freezing cells could be stored at -80°C. Crosslinked cells were re-suspended in 2 ml of sucrose buffer (0.3 M sucrose, 1% Triton-X-100, 10 mM HEPES pH 7.5, 100 mM KOAc, 0.1 mM EGTA), dounced 20 times with a tight pestle, and kept on ice for 10 min. The following steps were using polystyrene tubes, glass pipettes, and DNA LoBind microtubes

(Eppendorf) to avoid cell clumps sticking onto the walls of tubes or pipettes. Nuclei were collected by centrifugation at l,500g for 10 min on top of a cushion of 5 ml glycerol buffer (25% glycerol, 10 mM HEPES pH7.5, 1 mM EDTA, 0.1 mM EGTA, 100 mM KOAc). Nuclei were further crosslinked with 3% formaldehyde for 30 min at room temperature. After washing three times with ice-cold PBS, nuclei were extracted once with 50mM HEPES pH7.5, 250 mM NaCl, O. lmM EGTA, 0.5% N- lauroylsarcosine, 0.1% sodium deoxycholate, 5mM DTT, 100 U/ml SUPERasIN (Invitrogen) for 10 min on ice, and centrifuged at 400g for 5 min at 4°C Nuclei were resuspended in 1.2 ml of sonication buffer (50 mM HEPES pH 7.5, 75 mM NaCl, 0.1 mM EGTA, 0.5% N-lauroylsarcosine, 0.1% sodium deoxycholate, 5 mM DTT, 10 U/ml SUPERasIN, and sonicated in microtubes using Covaris E220 sonicator at 10% duty cycle, 200 bursts per cycle, 105 peak intensity power for 5 min. The major size of chromatin fragments was around 3-4 kb. Fragmented chromatin was subjected to hybridization immediately. Hybridization, washing and elution were performed as follows. In brief, beads were blocked with 500 ng/ul yeast total RNA, and 1 mg/ml BSA for 1 hr at 37°C, and respuspended in IX hybridization buffer. 360 μΐ of 2X hybridization buffer (750 mM NaCl, 1% SDS, 50 mM Tris pH 7.0, 1 mM EDTA, 15% Formamide, 1 mM DTT, PMSF, protease inhibitor, and 100 U/ml Superase-in) was added into 180 μΐ lysates, and then this IX hybridization lysate was precleaned by 60 μΐ of blocked beads at room temperature for 1 hr. After removal of the beads, B2 probes (labeled with 3' biotin-TEG, 18 pmol) for B2 RNA were added into the IX hybridization lysate and incubate at room temperature for overnight. Given the variability of the different B2 repeats, we used a pool of probes that correspond to the majority of the sequence variations within the target region presented at Fig. 4a. As control we used also a negative probe that does not show any sequence similarity to the used probes with he following sequence: 5-GCACGTCTATACACCACT-3'. 120 ul of blocked beads were added into lysates and incubated at RT for two hours.

Beads:biotin-probes:RNA:chromatin adducts were captured by magnets, washed once with IX hybridization buffer at 37°C for 30 min, washed four times at 37°C for 5 min with SDS wash buffer (2X SSC, 1% SDS, 1 mM DTT, 1 mM PMSF), and then washed once for 5 min at room temperature with 0.1% NP40 buffer (150 mM NaCl, 50 mM Tris pH8.0, 3 mM MgC12, 10 mM DTT, 0.1% NP40). DNA was then eluted in 100 μΐ twice for 20 min in 100 μΐ of 0.1% NP40 buffer with 200 U/ml RNase H (NEB) at room temperature and purified further using phenol-chloroform extraction. Before ChIP analysis, 3 millions cells were crosslinked as above and sheared chromatin was prepared using the ChIP-IT Express kit (Active motif) in a 135ul volume using the following conditions in a Covaris E220 sonicator: 2% duty cycle, 200 bursts per cycle, 105 peak intensity power for 5 min. Chromatin

immunoprecipitations were performed in lOOul reaction volumes using the same kit as with chromatin shearing and the following antibodies for 14h incubation times: Ezh2 (D2C9, 5246S Cell signaling technology), H3K27me3 (39155, active motif), RNA pol II phospho S2 (from the ab 103968 panel, abeam), RNA pol II phospho S5 (from the abl03968 panel, abeam), HsflP (ADI-SPA-901-D, Enzo life sciences). Eluted DNA was further purified with phenol-chloroform.

Library construction for RNA sequencing. RNA used for short RNA-seq and RNA-seq libraries was prepared as follows: Total RNA from cells was extracted using Trizol and 4 ug of total RNA was subjected to ribosomal RNA depletion using the ribominus V2 kit (Life technologies). Incubation of the RNA with the probe was done for 40 min instead of 20min. RNA depleted RNA was separated into two fractions of short (<200) and longer RNAs using the mirVana separation kit (Life technologies) with the following modifications: After addition of the lysis/binding buffer and the miRNA homogenate additive solution, 100% EtOH at 1/3 of the volume was added and the mix was passed through the filter to bind long RNAs. The flow through was collected and 100% EtOH at 2/3 of the flow through volume was added and passed through a new filter column to bind short RNAs. Elution of the long and short RNAs from each column respectively was done per manufacturer instructions. Eluted RNAs were concentrated in both cases using the RNeasy MinElute Spin Columns (Qiagen) and tested for its size and quality using an Agilent Bioanalyzer RNA kit. For short RNA library construction, ribo-depleted short RNAs were subjected to PNK phosphorylation for lh at 37C. Subsequently we used the NEBnext small RNA library construction kit (NEB) with the following modifications: Incubation of the 3 'adaptor was performed for 2h, and the libraries at the end were not subjected to double size selection with the Ampure beads but with 1,2X size selection. For sequencing of the in vitro B2 fragments no ribosomal depletion was applied

For the longer RNAs we used the NEBNext Ultra directional RNA library kit (NEB) with an RNA fragmentation of 10 min at 95 C and with the following modifications: First strand synthesis at 42C was done for 50 min and the End Prep of cDNA library was followed by an Ampure Beads selection of l,8x and ligation of the adapters using the 5x quick ligation buffer and Quick T4 DNA ligase (NEB) for 30 min. Incubation with the USER enzyme was done before the PCR amplification for 30 min, followed by a double size selection of 0.5x-lx, while the final library was size selected using Ampure beads at a lx sample-beads ratio. Libraries were evaluated using the Bioanalyser high sensitivity DNA kit (Agilent) and quantitated using the qPCR KAPPA kit (Kappa).

Library construction for ChIP and CHART sequencing. Purified DNA was subjected to further fragmentation in a Covaris E220 sonicator using 10% duty cycle, 200 bursts per cycle, 175 peak intensity power for 5 min in 125ul. Subsequently, we used the NEBNext ChlP-seq library Prep Master MIX set (NEB) with the following modifications: For ChlP-seq the EndRepair of ChIP DNA was performed only for 15min in a 10.5ul total volume (using lul buffer and 0.5ul enzyme) followed by no cleanup but dA-Tailing in a reaction scaled to lOOul for 15 min. Subsequently we performed double size selection 0.2X-2.5X before adaptor (0.3uM) ligation for 30 min and USER enzyme incubation for another 30 min. Ligation reaction was cleaned using 1.4 sample-bead ratio and the final library was size selected and clean with Ampure beads twice using lx and 0.5x-0.9x ratios. In addition, the PCR reaction had an extension time of lmin and 30sec. For CHART-seq the end repair was scaled to 150ul, while the dA-tailing was performed at 25.5ul total volume. After adaptor ligation it was size selected with 0.6x-l .2x bead-sample ratio, while after the PCR it was cleaned twice with lx and 0.9x Ampure beads and quantified using the qPCR KAPPA kit.

Bioinformatics analysis. Raw RIP-seq, CHART-seq and ChlP-seq reads and the respective sequenced input reads were mapped using bwa.0.5.5 (Li and Durbin, 2010) (default parameters). Using in home scripts and bedtools (Quinlan and Hall, 2010) the resulting sam files were converted to bed files and enriched genomics regions against the input were filtered using SICER (Xu et al, 2014) with a window and gap parameter of 300 and an FDR 0.05. Subsequently, CHART-seq reads of the B2 probe were filtered further based on distribution of reads captured by the negative CHART probe. Metagene profiles were constructed using the Babraham NGS analysis suite Seqmonk (www.bioinformatics.babraham.ac.uk/projects_seqmonk/) employing normalized cumulative distributions filtered in case of CHART-reads against the positions of B2 elements (3KB radius). Normalization was performed based on the total number of mapped reads. Seqmonk genome browser was used for visualization using RefSeq and RepeatMasker annotations for mRNAs and B2 SINE elements, respectively. Peak annotation was done using Galaxy (Afgan et al., 2016) and PA VIS (Huang et al, 2013).

Short RNA reads were trimmed from adapters in both ends using cutadapt

(doi.org/10.14806/ej .17.1.200) for the following adapter sequences:

AAGATCGGAAGAGCACACGTCT. Subsequently reads were mapped using bwa and converted to bed files with bedtools. Then, using in home transcripts 5' ends co- ordinates of the reads were extracted and plotted against a metagene representing the absolute distance between start of B2 repeats and downstream sequences. Reads distributions and alignments were performed using seqmonk. Raw RNA-seq reads were trimmed using cutadapt for the following adapter sequences: AAGATCGGAAGAGCACACGTCT and

AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT for read 1 and read 2, respectively. Subsequently they were mapped against mm9 reference transcriptome using tophat (Trapnell et al., 2009) with the following parameters: bowtie l -r -100 -N 20 --read-gap-length 10—segment-mismatches 3 —read-edit-dist 20. Subsequently, differential expression was performed using Seqmonk's intensify difference function for a p value less than 0.05. Metagene profiles were plotted with Seqmonk using the relative read density function. Transcriptional start site was defined using the TSS Eponine track from Seqmonk (Down and Hubbard, 2002). Aread coverage was calculated (CoveragePostH/S- CoveragePreH/S)/((CoveragePostH/S +

CoveragePreH/S)/2). Genome browser screenshots were derived using the IGV viewer (Robinson et al., 201 1). For the statistical analysis of the read distributions we applied the Kolmogorov-Smirnov test, using Prism6 (Graphpad). Datasets for short- RNA-seq, RNA-seq, ChlP-seq and CHART-seq have been deposited in GEO (GSE82255).

Example 1. B2 RNA associates with PRC2 and exists as short fragments in vivo

Previous RIP-seq analysis for the EZH2 subunit of PRC2 showed that reads derived from repetitive sequences comprised -20% of total reads— a not so insignificant fraction (Zhao et al., 2010)(Fig. 1A, right pie chart). We asked whether any family of repeat RNAs might be enriched relative to its representation in the transcriptome of female mouse embryonic stem (ES) cells, the cell type in which the RIP-seq analysis was performed. While most repeats were not enriched, we noted that SINEs accounted for -4% of all repetitive reads in the RIP-seq datasets and, within this family of repeats, the B2 element was enriched 4-fold above its representation in the female ES transcriptome (32% versus 8%; Fig. 1A) or the nuclear ES transcriptome (32% versus 12%, data from (Kung et al., 2015)). B2 RNA was highly enriched in RIP-seq reads relative to B l, another type of SINE repeat, in spite of the fact that the RNAs have similar expression profiles in the mouse genome (Fig. IB, bottom panels)(Hasties, 1989). PRC2 therefore seems to have a preference for binding B2 RNA.

Examination of read distributions within the B2 element revealed an intriguing nonuniform pattern. Instead of the expected homogeneous distribution across the -200- nucleotide (nt) B2 element, we observed at least two subpopulations, with a sharp discontinuity of reads at ~ nt 98 (Fig. 1C). This pattern suggested that, apart from the full-length RNA, B2 may also exist as subfragments. The process of generating the RIP-seq libraries could have introduced biases in RNA fragmentation or cloning, however. Furthermore, only 36 bases could be sequenced by the older HiSeq2000 machine (Zhao et al., 2010). To rule out the possibility that the non-uniform RNA distributions arose from technical biases, we developed a short RNA-seq protocol that excludes an RNA fragmentation step and enriches for native transcripts in the 40- to 200-nt size range (see Experimental Procedures). Short RNA-seq of female mouse embryonic stem (ES) cells confirmed a discontinuity at nt 98 (Fig. ID).

The discontinuity was interesting, as it occurred within the 51-nt critical region of B2 (nt 81- 131 ; shaded region, Fig. IE) previously shown by deletional analysis to be necessary and sufficient to stably bind an RNA docking site in POL-II in order to prevent formation of the pre-initiation complex (Espinoza et al, 2007; Ponicsan et al, 2015; Yakovchuk et al., 2009). To map the precise location of the break, we aligned 5 ' ends of reads from the short RNA-seq library to the B2 consensus sequence and observed a strong peak at position 98 (fig. IE, "X"), with additional but smaller peaks at positions 77, 49, and 33. Thus, shorter forms of B2 RNA can indeed be detected in vivo.

To determine whether EZH2 binds B2 RNAs directly, we produced affinity-purified, recombinant EZH2 in baculovirus-infected insect cells and performed filter-binding assays with in vitro-transcribed B2 RNA. The results demonstrated that the full-length (180 nt) B2 RNA interacted with EZH2 and it did so with a dissociation constant (Kd) of 422.6 ± 63 nM (Fig. IF). It has an affinity that is similar to that of a similar-sized positive control, RepA I-II— a 210-nt shortened form of Xist RepA containing four of eight repeats (Cifuentes-Rojas et al. and Fig. IF). This affinity was much greater than that for the negative control P4P6 RNA, a 154-nt transcript from Tetrahymena (K _d >3000 nM) and also for the 300-nt MBP RNA from E. coli. Truncating B2 RNA also resulted in extremely low affinities for EZH2, with various domains— DI [nt 1- 72], DI+D2 [nt 1- 105], and Dili [nt 99-140]— all demonstrating K _d of >3000 nM. These data demonstrate that B2 RNA directly interacts with EZH2 in vitro and confirm the binding interaction observed by RIP-seq in vivo. Example 2. B2 RNA is cleaved and degraded in the presence of EZH2

In principle, the discontinuity at position 98 could be due to an internal transcription start site or to an RNA processing event. Examination of the B2 sequence revealed internal Box A and Box B sites characteristic of RNA POL-III promoters and did not suggest additional transcription start sites around position 98 (Fig. 2A). Additionally, analysis of conventional and short RNA-seq data did not suggest a splice junction at position 98 or any other site of discontinuity. We therefore suspected a specific endonucleolytic event and set out to test this idea in vitro. Intriguingly, whereas incubation of 200 nM in-vitro-transcribed B2 RNA folded in 300 nM NaCl and supplemented with TAP 100 buffer (incubation final concentrations: 5 nM Tris pH 7.9, 0.5 mM MgC12, 0.02 mM EDTA, 0.01% NP40, 1% glycerol, 0.2 mM DTT) did not reveal any instability, addition of 25 nM purified recombinant PRC2 resulted in RNA fragmentation to sizes similar to those observed in vivo (Fig. 2B). This endonucleolytic event was recapitulated by addition of the EZH2 subunit alone, and was not observed with GST protein or with another PRC2 subunit, EED (Fig. 2C). We then performed deep sequencing of these RNA fragments to identify the exact cleavage sites. Several cleavage sites were observed, including a major one at position 98 and minor ones at positions 77 and 33 (Fig. 2D)— corresponding to the sharp discontinuities uncovered by EZH2 RIP-seq and the short RNA-seq analysis (Fig. 1C- E). Thus, the in vivo activity can be recapitulated in vitro using purified RNA and protein components (Fig. 2E). Collectively, these data demonstrate that full-length B2 RNA is subject to endonucleolytic cleavage at position 98, with minor cut sites at positions 77 and 33.

We next studied the in vitro kinetics of B2 RNA processing. In the presence of 25 nM EZH2, cleaved RNA accumulates over time between 0-100 minutes (Fig. 2F). To better understand the enhancement of B2 cleavage by EZH2, we plotted the amount of remaining full-length B2 RNA as a function of time (Fig. 2G). Cleavage rate constants were then determined by a linear fit using the differential form of the rate equation for an irreversible, first-order reaction (Fig. 2H). With either GST or no protein, we observed a low rate of turnover (kobs = 2 x 10 ^"5 min ^"1 and 6 x 10 ^"4 min ^"1 , respectively). The presence of EED mildly enhanced B2 cleavage at a modest rate of 8 x 10 ^"3 min ^"1 . On the other hand, the presence of EZH2 resulted in a 1,400-fold rate increase to a kobs of 0.029 (Fig. 2G)(R ² > 0.99, indicating that the datapoints have an excellent fit to the curve). Without EZH2, full-length B2 has an extrapolated half-life of 24 days in vitro. In the presence of EZH2, its half-life was reduced to 24 minutes (Fig. 21). Thus, the ribonucleolytic cleavages within B2 are accelerated considerably by contact with PRC2.

The rate of cleavage also depended on EZH2 concentration. In the presence of 50 nM B2 RNA, increasingly higher processing rates were observed as the concentration of EZH2 was increased from 25 to 400 during a constant 20-minute incubation (Fig. 2H). Cleavage rate constants were again determined by fitting the data to a single- exponential function (Fig. 2J). At 25 nM EZH2, the observed rate constant, kobs, was 0.0248/min in the presence of 200 nM B2 RNA; at 125 nM EZH2, the kobs was 0.2029/min; at 250 nM, the kobs increased further to 0.3605/min; and at 500 nM EZH2, the kobs still increased further to 0.4389 without reaching saturation (Fig. 2J- K). Taken together, the present data demonstrate that B2 RNA associates with PRC2 and induces a process that destabilizes B2 RNA, resulting in its cleavage into multiple fragments. These events occur both in vitro and in vivo.

Example 3. B2 RNA induces cell death; Heat shock induces B2 cleavage in vivo

We asked whether degradation of B2 RNA is biologically relevant. First, we interrogated the consequences of introducing excess B2 RNA into NIH/3T3 cells, the cell line used previously to study B2 effects (Allen et al., 2004). Surprisingly, transfecting purified full-length B2 RNA into the cells resulted in marked cell death within 2 days of treatment (Fig. 3A). Culturing out to 3 days did not lead to cellular recovery. However, when B2 RNA was pre-incubated with EZH2 to induce cutting, cytotoxicity was reduced and cells grew to confluence within 3 days (Fig. 3A). We then repeated this analysis using a synthesized and purified truncated B2 fragment (nt 99-140), rather than one cut from full-length B2. Similar results were obtained:

Starting with a transfection of 30,000 cells, full-length B2 RNA killed all cells within 2 days with no recovery after 5 days, whereas transfection of synthesized truncated B2 showed reduced cytotoxicity at 2 days and full recovery at 5 days (Fig. 3B). These data demonstrate that B2 RNA has biological activity in vivo and that cutting B2 RNA neutralizes that activity.

We set out to determine the nature of that activity. B2 RNA has been shown to block POL-II transcription during the heat shock response (Allen et al, 2004; Espinoza et al, 2004; Fornace and Mitchell, 1986; Li et al, 1999). Heat shock is a type of stress that puts cells at risk, and a rapid response is essential for survival (Chircop and Speidel, 2014). One immediate response is transcriptional downregulation of a large number of cellular genes— an adaptation to suppress expression of unnecessary genes. An equally critical immediate response is transcriptional upregulation of so- called "immediate early genes". These genes are upregulated within the first 15 minutes after heat shock and encode proteins that buffer against cellular damage, such as those that assist in repair of damaged structures (Fig. 3C)(de Nadal et al, 2011). These proteins include transcription factors, epigenetic complexes, and chaperones that aid in refolding or elimination of damaged proteins. During the immediate early period, the B2 element is known to also increase in expression (Allen et al, 2004; Fornace and Mitchell, 1986).

To determine whether B2 RNA stability bears connection to heat shock, we examined the integrity of B2 RNA after 15 minutes of heat shock (45°C) in NIH/3T3 cells. We performed short RNA-sequencing and compared the number of cut B2 fragments before and after heat shock. As B2 RNA levels also rose after heat shock (Fig. 3C), we normalized the number of cut sites to total B2 RNA levels in order to exclude increased B2 expression as a confounding factor. Intriguingly, a major increase in cutting was observed at position 98 after 15 minutes of heat shock, as well as at positions 77 and 33 (Fig. 3D). The difference in cutting before and after heat shock was highly significant (Kolmogorov-Smirnov [KS] test; O.OOOl). We conclude that B2 RNA has biological activity and temperature stress induces turnover of B2 RNA in vivo.

Example 4. B2 RNA binds to heat shock-responsive genes

To understand the mechanism of action, we mapped genomic binding sites for B2 RNA using "capture hybridization analysis of RNA targets" with deep sequencing [CHART-seq (Simon, 2013; Simon et al., 2013)]. For capture probes, we designed complementary oligonucleotides to B2 RNA to pull down chromatin regions associated with B2 RNA. These 17-base capture probes spanned nt 87-103 of B2 RNA and overlapped the major cut site (Fig. 4A), thereby enabling us to specifically identify target sites bound by intact B2 RNA. Given variability of the B2 sequence, we designed a probe cocktail that would capture SNP variants for the vast majority of B2's in NIH/3T3 cells. CHART reads were then normalized to input DNA and to CHART reads obtained by a scrambled capture probe. Peaks were called using SICER (Xu et al., 2014) to identify statistically significant B2 targets sites throughout the genome (FDR < 0.05). CHART-seq was conducted on pre- and post-heat shock cells (pre-H/S and post-H/S, respectively), and biological replicates showed highly similar results (Fig. 8).

Among 83,928 significant peaks altogether, 39,330 corresponded to nascent transcription from genomic B2 elements and served as positive controls (Fig. 8). Because the goal was to identify B2 target sites, peaks localizing within +/-3 kb of a B2 element (the average size of captured fragments) were excluded from further analysis. We examined the remaining 44,598 B2 RNA target sites. In pre-H/S cells, we observed 18,964 such sites. After only 15 minutes of heat shock, the number of B2 target sites nearly doubled to 31,368. Interestingly, target sites were largely non- overlapping between the two conditions. Among 18,964 pre-H/S sites, 13,230 were present only before heat shock (mentioned as "Type I" sites. Reciprocally, among 31,368 post-H/S sites, 25,634 were observed only after H/S ("Type Π" sites). A minority (5,734) occurred in both pre- and post-H/S cells ("Type III" sites).

We then characterized the target sites and found that the vast majority of B2 binding sites were in intergenic space and introns (Fig. 4B,C; pre-H/S shock shown), especially the first intron (Fig. 4B), and this was true for all three types of B2-binding targets (Tables S3-S5). With regards to the 1 ^st intron, the peaks often occurred at the 1 ^st exon-intron boundary and generally within 1,000 bp of the transcription start site (TSS), as shown by both a metagene analysis (Fig. 4D; KS test, O.OOOl) and by examination of specific genie loci (Fig. 4E). It should be emphasized, however, that B2 binding sites could occur anywhere within the gene body, that the binding sites tend to be broad and frequently spanned adjacent introns (Fig. 4E,S3), appearing different from the discrete peaks typified by transcription factors.

To determine how B2 binding affects gene expression, we performed RNA-seq analysis of NIH/3T3 cells before and after 15 minutes of heat shock and compared the results to B2 CHART-seq profiles. We observed that 1,587 genes were upregulated (log2fold-change >0.5; Table 1) and 1,413 genes were downregulated (log2fold- change <0.5; Table 2) by heat shock. Biological replicates were highly correlated and showed similar results (Pearson's R = 0.9). Intriguingly, H/S -upregulated genes were enriched in the Type I subclass of B2 targets— i.e., they were bound by B2 RNA prior to heat shock, and were released from binding following heat shock. In contrast, H/S-downregulated genes were enriched in the Type II subclass— i.e., they were free of B2 binding prior to heat shock, but became B2 targets after heat shock. These trends are illustrated by specific examples (Fig. 4E). For instance, at two H/S- upregulated genes, A3galt2 and Snx32, B2 binding was observed in the resting state when the genes were expressed at low levels, but was lost after 15 minutes of heat shock after which the genes were upregulated. On the other hand, at two H/S- downregulated genes, Zfp37 and Zkscan5, B2 binding was not apparent before H/S, but became significant after H/S.

Metagene analysis confirmed these trends on a genome-wide scale (Fig. 4F,G). At 15 minutes post-H/S, the vast majority of genes displayed no changes in B2 localization ("all genes"). By contrast, H/S-upregulated genes (Table 1) showed a significant loss of B2 binding, and H/S-downregulated genes (Table 2) showed a significant increase in B2 binding. Together, these data demonstrate that B2 RNA targets specific genomic regions and that the binding pattern is rapidly and dramatically altered by heat shock. The changes are measurable within 15 minutes. We conclude that B2

RNA targets heat shock-responsive genes and its binding is anti-correlated with H/S gene expression across the genome.

Example 5. Cleavage of B2 RNA induces heat shock-responsive genes

In light of the anti-correlation between B2 binding and target gene activity, the cleavability of B2 RNA raised a fascinating possibility: That B2 RNA might normally suppress POL-II activity, and that stress would trigger B2 turnover in order to lift the block to POL-II activity. To investigate this hypothesis, we performed ChlP-seq for the Serine-2 phosphorylated form of RNA POL-II (POL-II-S2P) to examine the density of elongating RNA polymerase across H/S-responsive genes (Fig. 5). As expected, genes upregulated by H/S (Table 1) showed increased POL-II density within 15 minutes of H/S, whereas genes downregulated by H/S (Table 2) showed decreased POL-II density (Fig. 5A, KS test, O.OOOl). We then examined the subset of genes that bind B2 only before H/S (Type I). Indeed, among the Type I genes, the H/S stimulus resulted in a significant spike in POL-II density (KS test; O.OOOl) (Fig. 5B,C), coinciding with the loss of the B2 binding (Fig. 4E,F). Conversely, among genes that bind B2 only after H/S (Type II), the H/S stimulus led to a significant decrease in POL-II density (KS test; O.OOOl) (Fig. 5B, C), coinciding with the gain of B2 binding within the same timeframe (Fig. 4E). Thus, POL-II activity is reduced where B2 binding appears, and POL-II activity increases where B2 binding is lost.

These data suggested that B2 binding is central to control of H/S genes. If so, turnover of B2 alone might be sufficient to induce transcriptional release. To de-couple B2 turnover from heat shock, we designed a B2-specific antisense oligonucleotide (ASO) using locked nucleic acid chemistry (LNA) to cleave B2 RNA. After 24 hours of transfection into NIH/3T3 cells (without heat shock), we observed significantly elevated cutting of B2 fragments relative to that seen in a scrambled (Scr) LNA- treated sample (Fig. 5D, KS test; O.OOOl). B2 LNA treatment recapitulated the increase in POL-II density across H/S-responsive genes, again without the heat shock stimulus (Fig. 5E, KS test; O.OOOl). Concurrently, RNA-seq analysis showed activation of H/S-responsive genes (Fig. 5F, KS test; O.OOOl). Biological replicates for RNA-seq and POL-II-S2P ChlP-seq showed excellent reproducibility. We conclude that increased POL-II density and gene expression can be uncoupled from the heat shock stimulus by ectopically inducing B2 degradation. Thus, B2 cleavage is central to the H/S response.

Example 6. EZH2 is recruited to B2 target sites to promote the heat shock response

We were initially led to consider the role B2 RNA after noting its enriched representation in the EZH2 RIP-seq data (Fig. 1). We subsequently discovered that contact with EZH2 resulted in cleavage of B2 RNA in vitro (Fig. 2) and that cut forms of B2 RNA have dramatically reduced affinity for EZH2 (Fig. IF). Together, these findings suggested that contact with EZH2 might destabilize B2 RNA and thereby release POL-II from suppression at H/S genes. To test this possibility, we performed EZH2 ChlP-seq in NIH/3T3 cells before and after heat shock and called statistically significant peaks of EZH2 enrichment using SICER (FDR < 0.05), with biological replicates showing similar results. Consistent with EZH2's repressive role for transcription, we observed an enrichment for EZH2 at the TSS of H/S-downregulated genes (Fig. 6A). Unexpectedly, EZH2 also appeared to be slightly increased at H/S- upregulated genes, though this small increase was not statistically significant.

However, the difference became pronounced and significant when analysis was focused on the subpopulation of H/S-upregulated genes bound by B2 (in the pre-H/S state) (Fig. 6B, KS test; O.OOOl). Those without a B2 site did not show increased EZH2 binding. Therefore, genes induced by heat shock paradoxically gained EZH2 coverage during activation. This finding implied that EZH2 is recruited to genes repressed by B2 RNA. Recruitment of EZH2 was not accompanied by an increase in trimethylation of H3K27, however (Fig. 6C). Rather, there was a decrease in

H3K27me3 over the TSS after heat shock (Fig. 6D), consistent with their transcriptional upregulation.

Thus, during heat shock, EZH2 is recruited to inducible genes for a purpose other than H3K27 trimethylation. Because the paradoxical association between EZH2 density and gene expression was most remarkable for genie targets of B2 RNA (Fig. 6B) and in light of EZH2's effect on B2 RNA in vitro, we suspected that recruited EZH2 may serve to destabilize B2 RNA in order to activate target genes. Indeed, "meta-site" analysis from an EZH2 -centric view (x=0 at EZH2 site) revealed that, after introduction of stress, EZH2 was attracted to sites where B2 was bound (Fig. 6E). In the converse analysis, a B2-centric view (x=0 at B2 sites) revealed the same finding — a gain of EZH2 binding where B2 binding was lost (Fig. 6F). This conclusion was supported by a very strong anti-correlation between change in B2 binding density and change in EZH2 coverage (Fig. 6G,H). Collectively, these data lend credence to the hypothesis that, in resting cells, B2 RNA is bound to H/S-inducible genes and a stressful stimulus triggers recruitment of EZH2, which in turn destabilizes B2 RNA for the activation of H/S genes.

Thus, EZH2 appears to play an equally important role in the heat shock response. We asked whether perturbing EZH2 affects B2 processing and gene induction in vivo. Administering ASOs specific for EZH2 to NIH/3T3 cells led to a significant knockdown (KD) of EZH2 (Fig. 9). Short RNA-seq analysis showed that this effect was accompanied by significantly decreased B2 cleavage at positions 98 and 77 (Fig. 61, KS test; O.OOOl). Depleting EZH2 also led to a blunted activation of H/S - responsive genes in two biological replicates (Fig. 6J, KS test; O.OOOl). These experiments thereby demonstrate that EZH2 is indeed a crucial factor in the induction of H/S-responsive genes.

The dynamic interplay between B2 RNA, EZH2, and POL-II activity can be appreciated by examination of specific H/S-inducible loci (Fig. 7A). For example, in resting cells, the gene for CI tumor necrosis factor-related protein, Clqtnf3, was transcribed at low levels, as reflected by a low POL-II-S2P coverage (0.257) and a low R A-seq value (FPKM=0.009). During rest, B2 RNA was bound at high levels and EZH2 binding was not detectable. Upon heat shock, EZH2 rapidly appeared within intron 3 at the same time that B2 binding decreased in introns 2 and 3.

Concurrently, we observed increased POL-II-S2P coverage within the gene body (FPKM=0.308) and a 2.4-fold upregulation oi Clqtnf3 transcription (FPKM=0.022). [N.B: The H/S genes respond in a graded rather than all-or-none manner (Brown et al, 1996; Chircop and Speidel, 2014; Kwak et al, 2013)] . Similarly, at another H/S- activated gene, Lrrc61, B2 binding disappeared when EZH2 binding appeared after heat shock, at which time POL-II-S2P coverage increased 2-fold (FPKM=0.093 to 0.192). All of these events were measurable within 15 minutes of heat shock.

Ectopically cleaving B2 RNA (using B2 LNAs) recapitulated the H/S response in the absence of stimulus (Fig. 5E, 7A). For Clqtnfl, B2 LNA treatment resulted in a ~2- fold increase of POL-II-S2P coverage (FPKM=0.481) and a 3-fold increase in RNA levels (FPKM=0.027) relative to baseline. For Lrrc61 , there was a 2.3-fold increase of POL-II-S2 coverage (FPKM=0.213) and a 1.36-fold increase in transcription

(FPKM=0.420) relative to baseline. We conclude that EZH2 and B2 play pivotal roles during the stress response, and that contact-induced B2 elimination is the key trigger for gene activation.

Table 1. List of heat shock-upregulated genes shown by RNA-seq analysis.

Column A: Heat shock-upregulated gene shown by RNA-seq analysis of NIH/3T3 cells. Column B: Log2 fold-change of the gene in post-H/S cells relative to pre-H/S state. log2(fold log2(fold log2(fold gene _change) gene _change) gene _change)

Pla2g4b 16.3925 Gimap9 2.97228 Cecr6 2.56515

H2-L 10.2141 Prrl8 2.94858 Rpsl5a-ps4 2.54353 bml4-rbm4 9.70033 Col8a2 2.93686 Lyll 2.53327

Btg3 7.92603 SlclOal 2.90647 Gml0069 2.51012

Snora64 4.4165 Esrl 2.89912 5730480H06Rik 2.50066

Ccin 4.38112 Mfsd7c 2.89912 1110 2.50066

Xrral 4.10699 Mucl 2.89912 Lrrc4b 2.50066

Hlfx 4.06394 Zfp72 2.89912 Mmp24 2.50066

Mclr 3.80096 Cmah 2.84826 Snora44 2.50066

9630028B13Rik 3.72776 Cr2 2.8482 Tnfrsfl3c 2.50066

Duspl8 3.68517 KIN41 2.8482 Sap25 2.49155

Ctxnl 3.62625 Hspalb 2.82076 2810442l21Rik 2.48463

Ism2 3.59641 Stxbp2 2.79653 4930565N06Rik 2.46801

Ipcefl 3.56099 Efnb3 2.78526 Col6a5 2.463

Clrb 3.53327 Actl7b 2.75266 II If 9 2.463

Cyb561 3.50066 Snordl5b 2.74752 Ppfibp2 2.4581

Camk4 3.49282 Gml7801 2.74178 1700020D05Rik 2.45648

Gprl 3.46731 Gzmm 2.74178 Aldhla3 2.43316

Doc2b 3.40167 Ill7rb 2.74178 Gnatl 2.43316

Gpr3 3.39892 Tmeml32b 2.74178 NeklO 2.43316

Pacsinl 3.2119 Hebp2 2.72196 Wnt6 2.43316

Rsph6a 3.19737 Xntrpc 2.68679 Rplp2-psl 2.42774

A530013C23Rik 3.15779 BC055111 2.68487 Jam2 2.37402

Socsl 3.12905 Btbdl8 2.68487 Olfr90 2.37402

Gml5107 3.12894 Fam219aos 2.68487 Gdapl 2.36384

Uncl3d 3.12894 Fzd9 2.68487 Gpr82 2.36362

Zfp296 3.10073 Itga7 2.68487 Snoral7 2.33896

1700001L05Rik 3.09658 Nwdl 2.68487 BC064078 2.33762

Upkla 3.08563 1700113A16Rik 2.63311 Gml6287 2.33762

BC065397 3.08515 4930558J18Rik 2.62688 Taslrl 2.33762

Jazfl 3.06248 Opn3 2.62688 Rnf43 2.32635

Ddn 3.04796 Wdr96 2.62688 Plxncl 2.31983

Sh2d2a 3.0438 Gml0390 2.60575 Bestl 2.29297

Bcl2ll4 3.04098 Cxcl5 2.57392 KIN40 2.29166

Brsk2 2.98871 Rbpjl 2.57344 Reep6 2.28961 log2(fold log2(fold log2(fold gene _change) gene _change) gene _change)

6330403K07Rik 2.28945 A3galt2 2.05897 Wdr95 1.93686

Dqxl 2.28945 Mip 2.04852 Dpf3 1.93548

Gca 2.28945 Bhlhe41 2.04593 Snora21 1.91886

Gperl 2.28945 Trim72 2.04571 Pstpipl 1.91647

Jpx 2.28945 Igtp 2.04536 Sfrp5 1.9157

Trptl 2.2764 Star 2.0433 Actr3b 1.90441

Soxl5 2.25076 Fut2 2.0423 Hpgds 1.90441

Wdr78 2.24895 Plekha6 2.04223 Slfn8 1.90335

Msh4 2.24419 B430319G15Rik 2.04192 Hsphl 1.89988

Gml6702 2.23912 Gm3219 2.04192 Pdzd2 1.89678

Gbp3 2.23509 Kcnab3 2.04192 Mpegl 1.87887

H2-Q1 2.21109 Pmel 2.04192 Dnajbl 1.87558

Cplx3 2.211 Tnni2 2.04192 Rhpn2 1.87141

E130310l04Rik 2.211 Gpr39 2.04098 Mgat4a 1.86854

Gnb3 2.211 Zpbp 2.04098 Ccdcl66 1.84845

Homer2 2.211 Oaslb 2.04097 Slcla2 1.84845

Nipal4 2.211 Opnlsw 2.02673 AI182371 1.84832

Serpina6 2.211 Fam221a 2.01216 1700112E06Rik 1.8482

Spata21 2.211 Fam83e 2.01138 1810010H24Rik 1.8482

Taslr3 2.211 B3galt4 2.0113 B3gnt6 1.8482

Tppp 2.211 Snora26 2.00473 Coro2b 1.8482

Prickle3 2.20323 Kbtbd8 2.00401 Elfnl 1.8482

Adamla 2.17995 Zfp783 2.00084 Gm3558 1.8482

Ill8bp 2.17376 Gdf9 1.99587 Hsf5 1.8482

IfitmS 2.16195 Gml2504 1.99377 Kcng4 1.8482

Dnah7b 2.15111 Raver2 1.99377 Myrf 1.8482

Stac3 2.15111 Klrg2 1.98508 Smiml8 1.84815

Gml5760 2.15011 Nfe2l3 1.97729 Gml0941 1.8477

Snora24 2.14432 Masp2 1.95104 Phldal 1.83422

Snora78 2.13742 Fcgbp 1.94831 Gml5545 1.83411

Gdpdl 2.12849 Gm6537 1.94831 4933413J09Rik 1.82881

Plcd4 2.1267 Gm6578 1.94831 Arhgefl5 1.82881

Vmnlr58 2.11637 Medl2l 1.94831 Cntn6 1.82881

Gm9159 2.10744 Serpinblb 1.94831 Olfrll89 1.82881

Ccdcl06 2.10658 Tmem82 1.94831 Rprl2 1.82509

Cersl 2.09773 Xylb 1.94831 Cep97 1.81814

Znf41-ps 2.09439 Hsf4 1.94331 Ddx60 1.81715

Cd68 2.09373 Slc6a20b 1.94114 LOC101669761 1.81715

Scn8a 2.09301 Kcnk7 1.9395 Klhdc9 1.81396

Vaultrc5 2.08566 Nacad 1.93879 1700022lllRik 1.80786

Gt(ROSA)26Sor 2.07448 Ccpglos 1.93686 Ttn 1.80658

Thai 2.0712 Kcnh3 1.93686 Elmo3 1.80537 log2(fold log2(fold log2(fold gene _change) gene _change) gene _change)

Rxfp3 1.79653 B3gnt5 1.685 Atpla2 1.57835

Nipall 1.79613 Glyctk 1.68497 Baiap2ll 1.57245

Mina 1.79225 Mboatl 1.68487 D3Ertd751e 1.57011

Tnfsfl3 1.78146 Nodal 1.68487 Prdm9 1.5668

Rassf4 1.77813 Sh2d5 1.68487 Itih4 1.56527

Rdh9 1.77813 Myh7b 1.68431 1700034J05Rik 1.5652

Tlrl 1.77397 Dclrelc 1.67736 Raverl-fdxll 1.56387

Ccdc28a 1.76904 Wnt2 1.67199 Tcf7 1.55402

Ccdc64b 1.76504 Gml6386 1.67005 SamdlO 1.55366

Pde8b 1.7648 Lyn 1.66592 Celf3 1.55217

1110046J04Rik 1.75266 Phkgl 1.6648 Rel 1.55198

Cyp27bl 1.75266 Igfals 1.66368 Slcl0a6 1.54397

Evpl 1.75266 2310014L17Rik 1.6616 Bend4 1.5425

Gm3230 1.75266 Nudtl5 1.65918 Glp2r 1.54222

LOC102633315 1.75266 Pdelb 1.65858 Sptbn4 1.54168

Ppefl 1.75266 Pycard 1.64266 Rxfp4 1.54144

Csdc2 1.74675 Serpina3h 1.63923 SnhglO 1.54144

4930404NllRik 1.74216 Nfaml 1.62808 Txlnb 1.54144

Gmlll28 1.74178 Ptpro 1.62749 Hidl 1.53588

Lamc2 1.74178 Serpinala 1.62696 Csflr 1.53327

Let 1.74178 Bspry 1.62688 Avpr2 1.53196

Ptgs2os 1.74178 Crabp2 1.62688 Qrfp 1.52681

Slc5a5 1.74178 Gm20756 1.62688 Gpdl 1.52636

Shank2 1.73997 Hcn3 1.62688 A330035PllRik 1.51543

Gml3483 1.7356 Ptprcap 1.62688 Slc35gl 1.51543

Gpr61 1.72476 Rnf208 1.62688 Hspb6 1.50826

Prph 1.72265 Smok4a 1.62688 Ppfia3 1.50177

Petll7 1.72082 Uncl3c 1.62688 G530011O06Rik 1.50141

Sema7a 1.7193 2900060B14Rik 1.6267 Papln 1.50105

1700003F12Rik 1.71621 Sptal 1.61997 Fmo5 1.50092

Tmemll7 1.71621 Afaplll 1.61903 Nrlh3 1.50072

Mtfr2 1.71536 Cldn3 1.61903 Ace2 1.50069

Nkpdl 1.7136 Nat8 1.61903 1700123M08Rik 1.50066

Loxl2 1.69758 Cul9 1.6178 4930592l03Rik 1.50066

Immp2l 1.69379 Dusp4 1.61584 6330403A02Rik 1.50066

Gng3 1.6927 Fcgr4 1.61584 A930007ll9Rik 1.50066

Snora7a 1.68565 Gprl60 1.61512 Apolllb 1.50066

Liph 1.68547 Hspala 1.61007 Arhgef33 1.50066

4931403G20Rik 1.68527 Tnfrsf21 1.59665 Atcay 1.50066

Faml80a 1.68515 E330033B04Rik 1.59361 Ccdcl21 1.50066

Gabre 1.68515 Zfp619 1.5887 Cldn22 1.50066

Gm5464 1.68515 Fbxl22 1.58506 Dpep2 1.50066 log2(fold log2(fold log2(fold gene _change) gene _change) gene _change)

Gm4532 1.50066 Kndcl 1.42298 Zbtb46 1.33407

Gm7444 1.50066 D630041G03Rik 1.42212 Ugtla7c 1.33286

Kbtbdll 1.50066 Lgals4 1.41708 Artn 1.33251

KIN30 1.50066 Slcl6all 1.41091 Gdpd5 1.33179

Nat8l 1.50066 Gprl79 1.41042 Cd4 1.33151

Pihld2 1.50066 Ranbp3l 1.40929 Ptplad2 1.33151

Prss27 1.50066 Amd2 1.40852 Wnt2b 1.32923

Prss8 1.50066 Pexl 1.40713 Hmgal-rsl 1.32721

Rsgl 1.50066 Plin4 1.40601 F2H3 1.3266

Snora52 1.50066 Fbxo2 1.40581 Slc7al4 1.32262

Srrm3 1.50066 Trp53corl 1.40434 4933421O10Rik 1.322

Tnfrsflla 1.50066 Pde7b 1.39892 Gadd45b 1.32079

Zfp941 1.50066 Cntf 1.39812 4930562C15Rik 1.31983

Dlk2 1.49872 AK010878 1.39473 Map3kl9 1.31983

Dmtn 1.49855 Trim68 1.39431 Map4kl 1.31983

Gml9705 1.49424 Htr2a 1.39336 2700054A10Rik 1.31827

Hoxc6 1.48708 Efcab4b 1.39168 Ttc38 1.31684

Col23al 1.48359 Slcl6a4 1.3892 BC068281 1.31495

Viprl 1.48359 Snord22 1.38615 Dlgap2 1.31421

Gimapl 1.47889 Dph7 1.38372 Rhof 1.29987

Tmc4 1.47717 2210039B01Rik 1.38093 Snora74a 1.29838

Rdhl2 1.4742 Gpr62 1.38093 Plekhg6 1.2981

Adcy7 1.47092 Slc23al 1.38093 A930024E05Rik 1.29391

Ulk3 1.46879 Dpcrl 1.37458 AI317395 1.29391

Lag3 1.46553 Ttlll3 1.37458 Eva la 1.29391

1700007J10Rik 1.46387 Tctexld4 1.37126 Snora28 1.29376

Kctdl2b 1.463 Ccdcl07 1.36936 5031414D18Rik 1.29297

Olfrl314 1.463 Isml 1.36865 Ntrk3 1.28949

Slc25al8 1.463 Adam30 1.36334 Adamtsll 1.28945

Zfp773 1.463 Tatdn3 1.35879 Esam 1.28945

Pianp 1.45782 D130040H23Rik 1.35337 Rltpr 1.28945

Msrb2 1.45731 Snora43 1.35152 Tmem240 1.28945

TbcldlOc 1.45601 Ldb3 1.3509 Atf7ip2 1.28363

Prkd2 1.45336 Gprl73 1.34981 Amacr 1.2823

Rbmx2 1.45103 Mroh6 1.34981 Vegfb 1.27558

Arntl2 1.45055 Plcel 1.3453 Grip2 1.27432

Sycp2 1.44763 8430419L09Rik 1.34516 Slfn5 1.27378

Cdk5rl 1.44717 Bcl2ll2 1.34451 Triqk 1.27105

Bag3 1.44633 4732491K20Rik 1.33815 Rpusd3 1.27038

Gale 1.44537 Duoxl 1.33762 Ercc8 1.26377

Bcas3osl 1.43319 Ms4a6c 1.33762 Gml3826 1.26355

Pnmal 1.42344 Rtp4 1.33762 Kctdl3 1.26328 log2(fold log2(fold log2(fold gene _change) gene _change) gene _change)

BC051226 1.26309 Sobp 1.20643 Synpo2 1.15111

Podxl 1.26292 4933408B17Rik 1.20613 Alkbh7 1.14711

Slc35g3 1.26292 C030037D09Rik 1.20613 Tnik 1.14696

Hmgn5 1.25808 Tmeml51a 1.20613 Slcl6a6 1.1454

Cdtl 1.25486 Slc44a5 1.20547 Sema6b 1.14345

Kcnrg 1.25459 Faml89b 1.2043 C130083MllRik 1.1432

Pcdhga4 1.25453 Gstp2 1.20335 Ppfia4 1.1432

Kcnmal 1.25351 Kcnc3 1.20036 Slc4al0 1.13882

Wnt4 1.25076 RasllOa 1.20033 Pitpnm3 1.13748

9430091E24Rik 1.24955 Clqtnf3 1.20031 Macrod2 1.13675

Faml31a 1.24944 9030624G23Rik 1.2003 4930443O20Rik 1.13415

Kcnjl5 1.24725 AY512931 1.2003 Khk 1.13195

Acyp2 1.24385 Adora2a 1.2003 Actr6 1.13087

Cenpv 1.24385 Cmya5 1.2003 Cspg5 1.12465

A930005H10Rik 1.24095 Gml6880 1.2003 Klhl36 1.12433

Abhdl4a 1.24046 Gm8234 1.2003 Msantdl 1.12287

Naa30 1.23835 Nefh 1.2003 Epb4.1l5 1.11995

Zfp58 1.23825 Zglpl 1.2003 Grin3b 1.11589

Aamdc 1.23695 Slc25al4 1.1969 8430427H17Rik 1.11299

E330009J07Rik 1.23602 Ptgir 1.19468 Htr2b 1.11195

Lbp 1.23602 Map2k3 1.1943 Chrnb2 1.11104

Depdc7 1.23422 CcdclOl 1.19405 AI606473 1.11064

Celsr3 1.23292 Tinagll 1.19082 Prorsdl 1.10873

Ociad2 1.23033 Serfl 1.1847 Slc26a6 1.10492

Napb 1.22772 Poc5 1.18338 Ufspl 1.10078

Slc25a35 1.22618 Arid5a 1.18139 Kcncl 1.10075

Nup210 1.22573 Col6a6 1.18093 Oip5 1.10073

Morn4 1.22452 Grpr 1.18014 Dnaic2 1.10063

Marveld3 1.22407 Ccl25 1.17567 Cdknlc 1.10046

Zbtb3 1.21949 Fam96a 1.17447 2410004P03Rik 1.10043

Sphkl 1.21867 Zfp811 1.17432 Gngt2 1.10035

Nrip2 1.21705 Cdkl3 1.17415 1700020L24Rik 1.10019

Mapt 1.21439 Cecr2 1.17257 BC006965 1.10019

Acox2 1.2111 Smco4 1.17098 Dill 1.10019

Cysl 1.21106 Pkp2 1.16547 Gml5455 1.10019

ActllO 1.211 Arc 1.16474 Tex38 1.10019

Ccdc40 1.211 Pcp4ll 1.16148 Lrriq3 1.10001

Clcnl 1.211 Cyp2d22 1.16078 GbplO 1.09991

Mog 1.211 A230073K19Rik 1.15896 Grhll 1.09522

Scube2 1.211 H2-T24 1.15681 Rab2b 1.09438

H2-T9 1.20949 Olfr543 1.15681 D8Ertd82e 1.09279

Rhbdll 1.20785 Tmem40 1.15112 Foxll 1.09279 log2(fold log2(fold log2(fold gene _change) gene _change) gene _change)

Dedd2 1.09278 6030408B16Rik 1.04192 Clqtnf5 1.01755

Mtssl 1.08997 Arhgdig 1.04192 Gml0653 1.01638

Gm 14446 1.08714 Cd74 1.04192 Cth 1.01507

Ppplr3fos 1.08702 Cesld 1.04192 Nrxn2 1.01162

Arl4d 1.08605 Gbxl 1.04192 Eif2d 1.01147

Pcdhga8 1.08499 Gml2522 1.04192 Rdhl 1.01121

Gml5645 1.08387 Gm6559 1.04192 Egr2 1.01105

Gpr21 1.08387 Gpbarl 1.04192 Herc3 1.01037

Tymp 1.08242 Gpr52 1.04192 Tmem251 1.00643

Cntn2 1.07872 Ifi205 1.04192 Angptl6 1.00496

Nprl 1.07872 Llcam 1.04192 Catspergl 1.00496

Oaslc 1.07872 Lixl 1.04192 4833417C18Rik 1.00443

Olfm2 1.07872 Me3 1.04192 Cln3 1.0025

Zfpll4 1.07872 Naaladll 1.04192 Lingo2 0.997291

Angpt2 1.07759 Napll3 1.04192 Cyp2ul 0.994908

Gm5088 1.07699 Nlrp2 1.04192 Fam57a 0.994908

Klhll5 1.07463 Nmbr 1.04192 Trim7 0.994908

Dnajcl7 1.07353 Npylr 1.04192 Aipll 0.993772

Foxo6 1.07299 Olfr267 1.04192 Kif27 0.993772

Prickle4 1.07299 Pkpl 1.04192 C130026l21Rik 0.991507

Setd4 1.07299 Rsll 1.04192 Zscan29 0.987511

Snora70 1.07254 Serpincl 1.04192 Vwa5b2 0.987476

Slc2a9 1.06974 Slc35g2 1.04192 Ldlrad4 0.98738

Slc4all 1.06881 Sntbl 1.04192 Polr2d 0.985661

Surf 2 1.06676 Tmem239 1.04192 Asxl3 0.984939

Mab21l3 1.0631 Tspanl 1.04192 Naip5 0.984869

Chd5 1.06304 Ccdc78 1.04189 Plin5 0.984791

4930488L21Rik 1.05868 Gnb5 1.04179 Cpeb2 0.98369

Pdzd7 1.05763 Cxxlb 1.04109 Gml976 0.983577

1110008P14Rik 1.05495 Cd80 1.04098 Ptpre 0.983576

Snordl5a 1.051 Gmpr2 1.03962 Pemt 0.983353

AI450353 1.05089 Snhg7 1.03798 Exdl 0.980189

Kdfl 1.04853 2310061l04Rik 1.03454 Vkorcl 0.978895

Msh5 1.04707 Gpt 1.03454 Tdg 0.978404

Tmem88 1.04701 Extll 1.03012 Ecm2 0.978362

Atp6v0e2 1.04611 Nabpl 1.02862 Fuom 0.97786

Tgfbl 1.04536 Cd200 1.02751 Rnul2 0.977477

Nr4a2 1.04375 2810408lllRik 1.02441 Zc2hclc 0.976971

Snph 1.0423 MapklO 1.02441 Uncll9 0.976375

1700012D01Rik 1.04192 Gm7102 1.02141 Gm8801 0.975702

3632451O06Rik 1.04192 Gpr63 1.01962 Pdgfa 0.975251

4933406J10Rik 1.04192 Mcmdc2 1.01962 C2cd4c 0.973608 log2(fold log2(fold log2(fold gene _change) gene _change) gene _change)

Tmeml91c 0.972035 Ccdc73 0.917792 Rdh5 0.880761

Proserl 0.969728 Taf9b 0.917074 9130023H24Rik 0.88045

Ppapdclb 0.969129 Prkaa2 0.917028 Cklf 0.880209

5730422E09Rik 0.968698 1110054M08Rik 0.917012 Apobec4 0.878874

Acypl 0.966964 Zfp959 0.917012 Bail 0.878874

Gprc5a 0.966757 Zfp595 0.916656 Cesla 0.878874

Zfpm2 0.96574 C530005A16Rik 0.915701 Dusp23 0.878874

Ptprj 0.962058 Gm4432 0.915701 Gm20594 0.878874

Cpxml 0.96165 Tnntl 0.914369 Hal 0.878874

Slc25al6 0.958634 Cgrefl 0.913576 LOC102634401 0.878874

9530027J09Rik 0.958632 Dancr 0.912835 Ppef2 0.878874

P2rx3 0.958372 Fastkd3 0.912483 Sycp3 0.878874

Sponl 0.957466 Slc8bl 0.911925 Ttc30a2 0.878874

Arntl 0.952404 Ttc39a 0.911876 Zfp459 0.878874

Blocls4 0.951861 Zbtb26 0.910565 Cdc25c 0.872104

Nfkbill 0.951789 OsbpllO 0.907185 Akrlb3 0.871897

Tpcnl 0.95107 Adck3 0.907067 Notch3 0.871894

Camsap3 0.950006 Gml0578 0.906363 Tmeml50b 0.871884

Gpm6b 0.948516 Itfg2 0.906018 Pde2a 0.87053

1700056E22Rik 0.948305 Megfll 0.905916 Ddx59 0.869902

Gabrb2 0.948305 Apol6 0.905812 Ggn 0.869005

Seracl 0.94768 3110040NllRik 0.904664 Tysndl 0.868374

Nckap5 0.946966 Dnaja4 0.903673 B930003M22Rik 0.867501

Fgd3 0.945867 Zmyml 0.903268 Cdcpl 0.867501

Rnd2 0.944931 Fahd2a 0.902592 Chst3 0.867501

Cyp4fl3 0.943695 Plekhhl 0.902592 Rps6kll 0.867501

Gramdlb 0.943094 Cdk20 0.900992 Zfpl60 0.865721

Adam22 0.941898 Sbspon 0.899119 Pdf 0.865008

Tekt2 0.941898 Snordl7 0.898693 Gml0845 0.864807

Scoc 0.941402 4930507D05Rik 0.898355 9330020H09Rik 0.864482

Slc39a6 0.939491 Zfp688 0.896366 Btbd6 0.86434

Ybey 0.938154 Sh2d4a 0.896038 Spefl 0.863728

Mtpap 0.936922 Slc7all 0.893529 Dock8 0.862569

5730408K05Rik 0.934471 Pkn3 0.892733 Bdkrbl 0.86228

Xkr8 0.933427 D030028A08Rik 0.892603 Yy2 0.86228

Mtml 0.933134 AI506816 0.892334 Hapl 0.860601

Porcn 0.932296 Tmem64 0.890878 Rrnadl 0.859938

Ugtla6a 0.932118 Phyhdl 0.888334 AH15 0.859273

1700094D03Rik 0.930346 Tpkl 0.887405 Pgap2 0.858987

Acsl6 0.927489 Nkirasl 0.884175 Cd302 0.857087

Agt 0.925678 Snora23 0.884144 Magohb 0.856945

Aurkaipl 0.922869 Lyrm2 0.8823 Thsdl 0.854136 log2(fold log2(fold log2(fold gene _change) gene _change) gene _change)

Abcc6 0.853329 4933400F21Rik 0.846084 Mcts2 0.815087

Nnat 0.852521 Staul 0.84469 Piml 0.814866

Rps6kal 0.848375 9030025P20Rik 0.844502 Gml2338 0.81463

Pex5l 0.848217 Lzic 0.84265 Mmachc 0.814113

Pla2g4c 0.848196 Paipl 0.842563 Endodl 0.814107

1700034l23Rik 0.848195 Fam213a 0.842291 Grebll 0.813839

2510049J12Rik 0.848195 Gkapl 0.840528 Paml6 0.8135

6330418K02Rik 0.848195 Slc35b2 0.839747 Ncor2 0.812126

Adamlb 0.848195 4931440P22Rik 0.836634 Ap4el 0.80971

Adrb3 0.848195 B630019K06Rik 0.835283 Nyapl 0.808223

Aldh3b2 0.848195 Prtg 0.832862 Mccclos 0.805974

B130034CllRik 0.848195 Pcdhga3 0.830016 Fam210b 0.805673

Bdkrb2 0.848195 Atxn3 0.829792 4933411K16Rik 0.805371

Cacna2d2 0.848195 Pmsl 0.828572 Stab2 0.805371

Cacnb2 0.848195 Vampl 0.828083 Tmeml4c 0.805168

Ccdcl70 0.848195 Dlg2 0.827534 Gfm2 0.80513

Cux2 0.848195 Nipal3 0.82751 Spaca6 0.80475

D730005E14Rik 0.848195 Ccrn4l 0.827023 Retn 0.803861

Ect2l 0.848195 Gml943 0.826803 Nanosl 0.803319

Epstil 0.848195 Mfsd8 0.826239 Dhrsl3 0.802263

Fscn3 0.848195 Pfkp 0.825156 Rab7ll 0.802263

Ftcd 0.848195 Rprl3 0.824685 Fancg 0.801687

Gbp2b 0.848195 AI662270 0.824329 Jph3 0.799945

Gml0556 0.848195 Gprl51 0.824329 Zfp428 0.799896

Gmlll49 0.848195 Osbpl6 0.82422 Uxt 0.796525

Gmll517 0.848195 Inhba 0.823205 Harbil 0.796215

Gml5880 0.848195 Atpafl 0.822957 Capns2 0.795969

Gml7746 0.848195 Cmc2 0.822775 Pabpc4l 0.795968

Gm4984 0.848195 Mrpl41 0.822763 Slc25a47 0.7942

Gpx3 0.848195 Relt 0.822405 Apip 0.793004

Itga4 0.848195 Sirt4 0.821295 Dbt 0.792254

Nkd2 0.848195 Snora81 0.82116 Rpphl 0.791102

Nuprll 0.848195 Zfp846 0.820109 Jade3 0.790246

Olfr544 0.848195 Cmcl 0.818789 Alkbh2 0.789058

Panx3 0.848195 Kptn 0.817543 Cntdl 0.789058

Pde8a 0.848195 Leprotll 0.817308 Fndc5 0.789058

Ppplr3e 0.848195 Gnal4 0.817146 Gml6982 0.789058

Srd5a2 0.848195 Fxydl 0.81712 Slc24a5 0.789058

Wdfy4 0.848195 Mrpll 0.816356 TmemlOO 0.789058

Zfp85os 0.848195 Mob3b 0.815682 Zfp354b 0.789058

AU021063 0.848194 Commd4 0.815445 Zfp474 0.789058

MegflO 0.847764 Rmdnl 0.81537 Dpm2 0.789044 log2(fold log2(fold log2(fold gene _change) gene _change) gene _change)

Igip 0.788349 6720416L17Rik 0.752659 Cbx7 0.739073

Vangl2 0.788187 Adcy5 0.752659 Chstl2 0.739009

Mumlll 0.787543 B3gnt3 0.752659 Algl3 0.738372

Adat3 0.785414 BC021767 0.752659 Plscrl 0.738264

2410018L13Rik 0.785263 Ccdcl44b 0.752659 Gareml 0.737958

Gprl55 0.784518 Cldnl5 0.752659 Mornl 0.737958

Mertk 0.783692 Ggt5 0.752659 Rfesd 0.736998

Tomlll 0.781902 Gml0125 0.752659 Ago4 0.73664

Apbblip 0.780693 Gml0789 0.752659 Surfl 0.736503

Denndlb 0.780558 Gm6251 0.752659 Urod 0.735173

Bbs4 0.779385 Kcnk3 0.752659 Vps8 0.735138

Fermt3 0.778882 Mslnl 0.752659 Tyw5 0.734593

Tmeml61b 0.778178 Omp 0.752659 Trim34b 0.732648

Pexlla 0.778129 Rab26os 0.752659 Tssk6 0.732185

Shf 0.777706 Rab33a 0.752659 Ndufs6 0.731844

A130077B15Rik 0.773746 She 0.752659 Lrrcl 0.731533

4930455C13Rik 0.773479 Stmnl-rsl 0.752659 Exosc6 0.7314

Tmeml28 0.771253 Stpgl 0.752659 Gpr4 0.731132

Ncfl 0.771184 Ttc25 0.752659 Eif5a2 0.730385

Flt3l 0.770416 Ccdcl25 0.752641 Rnasek 0.72918

Timm21 0.770403 Nudtl7 0.752439 Slc41a3 0.728341

Kif24 0.770009 Fahdl 0.752245 Hsp90aal 0.727456

Foxjl 0.769525 Hvcnl 0.751942 Zfp524 0.727194

Trmt2b 0.768958 Tcplll2 0.751931 Pogk 0.72698

Zfp558 0.768924 Cd320 0.74905 LOC106740 0.726647

C230091D08Rik 0.767682 Map3kl3 0.749038 Stard5 0.726492

Trim59 0.764706 Phyhipl 0.747059 Prkar2b 0.726386

Ak6 0.763367 Dsccl 0.745278 Ttll3 0.72431

Lrrc61 0.761217 Mss51 0.745003 BC061194 0.724219

Slc25a27 0.760096 Camk2n2 0.744507 Nipa2 0.723398

Gml7762 0.759466 Asb3 0.743641 Zdhhcl2 0.723354

Polq 0.75938 Emx2os 0.742987 Gm20319 0.722999

Apoo 0.757916 Depdcla 0.742283 Gpcpdl 0.722965

Mrpl50 0.756048 Bok 0.741219 Col4a3bp 0.722612

Zfp874b 0.755962 Slcl5a4 0.740891 Gnal 0.722065

Zfp954 0.755957 2610044O15Rik Arl6ipl 0.721104

Prss53 0.754948 8 0.740567 Snupn 0.72027

Peli3 0.754578 Mb21d2 0.740516 Sprtn 0.719836

Lfng 0.753516 Homerl 0.740491 Pnpo 0.718019

Pxdcl 0.753057 Prrgl 0.740343 Wdr8 0.71784

Phosphol 0.752661 Cnp 0.74021 Fbxoll 0.717345

4930539J05Rik 0.752659 Ramp2 0.740134 Cpne8 0.716441 log2(fold log2(fold log2(fold gene _change) gene _change) gene _change)

Cpa4 0.716207 Gprl35 0.694222 Steapl 0.669469

Kcnjl4 0.716207 Serpinel 0.692035 Cln6 0.66829

Ap3m2 0.714914 Slc38a9 0.689846 Tvp23b 0.667508

Bid 0.714076 Fcho2 0.689564 Hexdc 0.665967

Kril 0.713345 Ints6 0.687629 Nr4al 0.66566

Ankrd42 0.711881 Immpll 0.687536 Pvtl 0.664854

Azinl 0.710642 Atg4d 0.687146 Mrpl32 0.664084

Pcdhacl 0.710402 Angptl 0.685654 A230020J21Rik 0.663918

Ndufcl 0.709634 Begain 0.685588 Apol8 0.663706

Has3 0.709572 Pqlc2 0.685415 Gng8 0.663679

Aldh3bl 0.70932 Mfsd9 0.685326 Sdsl 0.663679

Shrooml 0.709143 1700120K04Rik 0.685153 Tmem223 0.663679

Awat2 0.707302 Cdl4 0.684869 Clvsl 0.663678

Eps8ll 0.707095 Foxgl 0.683375 Apexl 0.661955

Smg9 0.706269 Ostml 0.683047 Tmeml92 0.661617

Gm8615 0.706096 Fbrs 0.68116 Siahlb 0.660784

Cgnll 0.706094 Pqlc3 0.681088 Krccl 0.65898

Dhx58 0.705249 Insigl 0.680904 Zeb2os 0.658912

Gm7609 0.704485 Lrch2 0.67938 Ahsa2 0.658866

Piga 0.702853 A230057D06Rik 0.678457 Aphlb 0.657954

Gpldl 0.702609 Sumo3 0.678457 Degs2 0.657643

Calcrl 0.701227 Tmem38b 0.678361 PcdhgalO 0.657617

Slc36a4 0.701085 Runxl 0.676638 Zfp329 0.657543

Tmeml70b 0.700545 Efhcl 0.676024 9430038l01Rik 0.656592

Slc2a4rg-ps 0.70028 Parn 0.675847 Mfsd7a 0.656592

Ccdc53 0.700114 Fbxo41 0.675628 Tmeml54 0.656592

Mnsl 0.699875 Gba2 0.675114 Dtwd2 0.655861

Pyroxdl 0.699604 Ptrhdl 0.674611 Sla2 0.654917

Dcafll 0.699481 Gng7 0.674239 Eeflel 0.654614

Lrrtm2 0.699116 Mrpll5 0.67413 Nmrall 0.652852

Foxd2os 0.699048 Slc6a8 0.673973 Abcb9 0.651804

Tmem260 0.698446 Lmln 0.673293 Osbp 0.651032

Etohd2 0.697577 Ralgps2 0.673136 A730098PllRik 0.650639

Smiml3 0.696617 Rsph3b 0.672982 Pgbd5 0.648948

Vbpl 0.696407 Gml28 0.672774 Gpsml 0.648374

Gml0033 0.696287 N6amt2 0.672643 Tbce 0.646814

Ephal 0.69572 Glrx3 0.672054 Mkl2 0.646378

Cd93 0.695059 Lyrm5 0.671061 Cep44 0.645635

Cradd 0.694944 Bckdhb 0.670957 Omd 0.645421

Zfyvel9 0.694588 Ubxn2b 0.670957 Styx 0.643302

Lrrc73 0.694306 Tmeml76b 0.670325 Klhl28 0.6429

Mettl22 0.694306 Strip2 0.670093 Rnf38 0.642831 log2(fold log2(fold log2(fold gene _change) gene _change) gene _change)

Radl 0.641986 Zfp300 0.623066 Nsg2 0.611039

Plekho2 0.641774 Adora2b 0.622927 Rab27b 0.610999

Rabl3 0.641702 Mnda 0.622737 Tmem258 0.610448

Pqlcl 0.640004 Tmem39a 0.622735 Smekl 0.609214

Katnal 0.639256 Gfpt2 0.622152 Olfml 0.608263

Letm2 0.639051 Athll 0.621666 Gpraspl 0.608247

Rpusdl 0.638148 Jmjd8 0.621474 Gml4005 0.608228

Mepce 0.637215 Pisd-ps3 0.621433 Isgl5 0.606174

Prkra 0.636744 Cyb5rl 0.621432 Irgml 0.605639

Zfp788 0.634809 2700046G09Rik 0.621166 Snhg4 0.605639

Femlb 0.633894 Aox3 0.621166 Tst 0.605195

Ppmlh 0.633878 Gm2381 0.621166 Slc35e2 0.60484

Msl2 0.633096 Mmpl6 0.621166 Ift20 0.604186

Chchd5 0.632246 Zfp273 0.621166 Ttc7b 0.603738

Irak4 0.631371 Fzd7 0.621147 Sirt5 0.603131

Slc43a2 0.631227 Thumpd2 0.621053 Dtymk 0.602386

Procr 0.630555 Phkg2 0.620933 Pdxp 0.601831

Peg3os 0.630487 Tmeml81b-ps 0.620847 Wrap53 0.600599

Ece2 0.630018 AcadlO 0.620113 Kdm4c 0.60056

Cdc42ep5 0.629752 Cckbr 0.61997 D430020J02Rik 0.599646

4933434E20Rik 0.629419 Faml51b 0.61997 Sft2d3 0.599477

Mif4gd 0.628942 Hpse 0.61997 Rnfl9a 0.599175

Rsph3a 0.62888 Ptgdr2 0.61997 Zfp609 0.598705

Clgaltlcl 0.628447 Lysmd2 0.619798 Apobecl 0.597047

Tmbim4 0.628297 Gsap 0.619637 Heca 0.597013

Cenph 0.628231 Ankrd39 0.619008 Sec61g 0.596673

Pecaml 0.627064 Ptges3l 0.618627 Tmeml9 0.595994

BC028528 0.626879 Cbx4 0.618374 Psmg3 0.595282

Clql3 0.626879 Lat2 0.617924 Zfp385c 0.594687

Ceacaml6 0.626879 Ogfod3 0.617793 Cnih4 0.594569

Gml5408 0.626879 Gchfr 0.617511 Mppel 0.594067

Faml98a 0.626827 Ube2q2 0.617001 Tenl 0.59351

Ift57 0.626357 Tac4 0.616837 Tmem200a 0.593417

Diexf 0.626265 Gml6023 0.616481 2010111l01Rik 0.593026

Lrrc39 0.626042 Mpcl 0.616368 Pisd-ps2 0.592919

RnaselO 0.626017 TsglOl 0.615968 Snx24 0.592641

Nlrplb 0.624538 Wdr47 0.614698 Nfkbie 0.592566

Arxesl 0.62417 Pcnxl4 0.614302 5830415F09Rik 0.592261

Uncl3b 0.623961 KlhlS 0.613586 Dcunld2 0.592249

Hdacll 0.623461 Chekl 0.613071 Rgag4 0.591944

E230016K23Rik 0.623341 Chkb 0.612202 Dyxlcl 0.591382

Slc25a22 0.62327 Tmeml26b 0.61188 Dcafl7 0.591272 log2(fold log2(fold log2(fold gene _change) gene _change) gene _change)

Ciart 0.590954 Gtf2h4 0.574845 Tmem25 0.560892

Ramp3 0.590861 Ugtla5 0.574447 Myol9 0.560238

Znrf2 0.589795 Lrrc8d 0.573823 Aifll 0.559823

Mb21dl 0.58888 Zfp963 0.573677 Ppp2r5e 0.559413

Prkab2 0.58887 Prox2 0.573599 Scnml 0.5593

Pla2g7 0.588629 Hoxd4 0.572448 Nomol 0.558574

Efcab7 0.58861 Lig4 0.572442 Omal 0.557833

B330016D10Rik 0.587808 Ill7d 0.57166 Helq 0.557714

Kcnjl3 0.587808 Ttpal 0.571422 Bivm 0.557124

A330009N23Rik 0.587798 Fam227a 0.57119 Caapl 0.556957

AK129341 0.58761 Tsc22d3 0.570947 Tgm4 0.556805

Agpat4 0.587377 Rnflll 0.570455 Mira 0.556405

Tafll 0.586982 Ube2m 0.57044 P2rx6 0.556297

Fst 0.58662 Abcd3 0.570293 Ap3s2 0.555981

Slc35f6 0.586565 Gab2 0.569957 MettllO 0.555565

Cep70 0.585426 Casql 0.568093 Perml 0.555081

1110008F13Rik 0.583769 Gpr89 0.567585 Cdhl8 0.554378

Acp6 0.582501 Dimtl 0.567419 3110002H16Rik 0.553881

Gtdcl 0.580918 Sccpdh 0.567194 Smpd5 0.55366

Klra2 0.57994 Ankrd9 0.566665 PcdhalO 0.553628

4833418N02Rik 0.57987 Polr2g 0.566507 Pms2 0.553541

AI848285 0.57987 Ap3ml 0.566406 Cyb5d2 0.553112

B130006D01Rik 0.57987 1500015A07Rik 0.566239 Exosc8 0.552342

C920025E04Rik 0.57987 5730508B09Rik 0.566151 Caszl 0.55191

Dusp3 0.579592 Chrm4 0.566151 Tmeml07 0.551467

D930016D06Rik 0.578811 Plekhjl 0.565282 Chnl 0.551282

Ccdc84 0.578616 3110052M02Rik 0.564375 Dnall 0.550887

A230103JllRik 0.57856 Pkp3 0.564178 Ntn5 0.550711

Wdr89 0.578542 Arhgef39 0.564018 Rndl 0.550337

Nav2 0.578471 Map3k8 0.563651 E530011L22Rik 0.550039

Dnahll 0.578348 Serinc4 0.56365 Slc9a3r2 0.549408

Anklel 0.578103 Zfp345 0.563641 Gtf3c3 0.547369

Zkscan7 0.577966 Spopl 0.563258 Armc7 0.547319

Stxl2 0.577634 Cdh24 0.563141 Tgfb3 0.547257

Citedl 0.577184 Ndfip2 0.562232 Tmem229b 0.546946

Wdr5b 0.576386 Pithdl 0.562121 Rgsl6 0.545969

Mmadhc 0.576184 Osbp2 0.561933 Rfx3 0.545748

Sycpl 0.575501 Kin 0.561629 Duspl9 0.545573

KlflO 0.575321 Csnk2a2 0.561161 Cisd2 0.544746

A430078G23Rik 0.575229 Ccr9 0.561072 Gm20199 0.544746

Mdk 0.575135 Tmeml84a 0.560921 Mfrp 0.544483

Pde4d 0.574991 Emidl 0.560892 3110062M04Rik 0.544427 log2(fold log2(fold log2(fold gene _change) gene _change) gene _change)

Zfp446 0.544344 Coll8al 0.530327 Tmeml83a 0.515984 nfl3 0.544193 Aoxl 0.529754 A830082K12Rik 0.515819

Stykl 0.543974 Camkld 0.528434 Orai3 0.515617

Tyms 0.543539 Mrpl23 0.527912 Csmd3 0.515432

Npff 0.543132 Dph6 0.527526 Egf 0.515432

Tnkl 0.542397 Cacng7 0.527458 Tmtc4 0.515432

Zdhhc4 0.542264 Zfpl4 0.527404 Pcdhga6 0.514804

E030030l06Rik 0.541443 Cdc42se2 0.527181 Gml7066 0.514713

Fam228a 0.541443 2610002J02Rik 0.526737 Smiml9 0.513809

Gm6583 0.541443 Hylsl 0.526574 Histlh4i 0.513443

Zfp385a 0.540252 Tnnil 0.526432 Zfp935 0.513136

H2-K1 0.540178 Errfil 0.526361 Gas5 0.513087

Stkl9 0.540108 4930545L23Rik 0.526358 Serinc3 0.512927

Wdr55 0.539619 Clcal 0.526358 Trmtl3 0.512829

1110001J03Rik 0.539364 Fscn2 0.526358 Mctsl 0.512614

Spred3 0.539216 Gml4379 0.526358 Zfp362 0.511695

Dpm3 0.53858 Mroh7 0.526358 Galntl3 0.511562

Tmem238 0.538559 Phf7 0.526358 Reel 0.511331

Msrbl 0.538183 Zfp931 0.526358 Zufsp 0.511331

PsmdlO 0.538183 Srpx2 0.526211 Ciita 0.511154

Tada3 0.538181 4833420G17Rik 0.526076 4921524J17Rik 0.510351

3110021N24Rik 0.537005 Creb3ll 0.525956 Fam92a 0.510289

Zfpl74 0.536428 Rrp36 0.525482 Faml93b 0.509569

Zfp579 0.535497 Atg4b 0.524675 Adck5 0.509469

Atp6vlg2 0.534769 Hatl 0.524476 4930579G24Rik 0.509424 lcosl 0.534769 Cbfb 0.524265 Paqr3 0.509403

Tmem47 0.534065 Iba57 0.524034 Myoml 0.508284

Ube2b 0.533897 Pldl 0.523875 Tmem29 0.508004

Hscb 0.533385 Ehd4 0.523701 Dbhos 0.506884

Rbl 0.533144 Draml 0.523638 Ntnl 0.506518

Slc45a3 0.533138 Mrpsl4 0.522991 Ap4sl 0.506184

Lamtor4 0.532759 Gplba 0.52285 Adprm 0.505908

Psmgl 0.532611 Fgfr3 0.522807 Vamp8 0.505153

Pigp 0.532384 Zfpl 0.521457 Ddt 0.504355

Gcnt7 0.532189 Sez6l2 0.52067 Stil 0.50419

Isg20 0.531979 Setd6 0.518642 Crtc3 0.503525

GrcclO 0.531928 Tnfsfl2 0.517882 Pla2gl2a 0.503497

Pil6 0.53156 BbslO 0.517871 Naa38 0.503395

Usbl 0.53152 2700094K13Rik 0.517218 Nutf2-psl 0.502546

2610301B20Rik 0.531452 Parpbp 0.5172 Polrle 0.502282

Sh2d3c 0.530616 Qrsll 0.516473 Slc52a2 0.501981

Tnr 0.530556 Acrbp 0.516059 Pcdhb22 0.50183 log2(fold log2(fold log2(fold gene _change) gene _change) gene _change)

Gpatch3 0.501768 1700030J22Rik 0.500664 Serpina3g 0.500664

1700066 M 2 I ik 0.501414 4930503E14Rik 0.500664 Slc40al 0.500664

Bend6 0.501342 Alpk3 0.500664 Tmem204 0.500664

EII2 0.501311 Gml3251 0.500664 Stox2 0.500652

Rbm7 0.50092 Gm6654 0.500664 Hoxa3 0.500622

Gulpl 0.500836 Ltc4s 0.500664

0610010B08Rik, Piwil2 0.500664

Gm4724 0.500664 Rrad 0.500664

Table 2: List of heat shock-downregulated genes shown by RNA-seq analysis.

Column A: Heat shock-downregulated gene shown by RNA-seq analysis of NIH/3T3 cells. Column B: Log2 fold-change of the gene in post-H/S cells relative to pre-H/S state.

)52 log2(fold_ log2(fold_ log2(fold_ gene change) gene change) gene change)

Mirg -0.51971 Pcca -0.533789 Sival -0.547497

Obscn -0.519902 Dnttipl -0.533998 Zfp637 -0.547733

Slc4alap -0.519928 Birc2 -0.534003 Cry2 -0.548168

Pacsin3 -0.520093 Papd5 -0.534515 Bin3 -0.548322

Amnl -0.520166 Prep -0.534706 0610009O20Rik -0.548329

Lrrcl4b -0.520856 Goraspl -0.535042 3830408C21Rik -0.548597

Exosc4 -0.520914 Hist2h2ac -0.536325 Stk36 -0.549294

Misl8bpl -0.521761 Ier2 -0.537189 Alkbh6 -0.549329

Histlh2bf -0.522018 Noll2 -0.5375 Madd -0.54934

Jarid2 -0.522317 Mettll -0.537775 Tnfaip3 -0.549519

Ctgf -0.522406 Fgd6 -0.538283 Fbxll2 -0.549547

Zfpl20 -0.522641 Ccnel -0.538454 Thumpdl -0.54967

Jphl -0.524609 Mrpl42 -0.538658 Clcn6 -0.550539

Zfp93 -0.525308 Vmpl -0.538673 4933411K20Rik -0.550935

Far2 -0.525753 2810021J22Rik -0.539498 Tmeml29 -0.551641

Slc37a2 -0.525982 Tmeml43 -0.539673 C330013E15Rik -0.552251

Slc7a7 -0.526089 Zkscanl4 -0.539712 Zfp422 -0.552646

Coq7 -0.526739 Cdkn2d -0.539849 Dchsl -0.553193

Epcl -0.527036 Efcabll -0.539849 Echdcl -0.553488

Dhps -0.527047 A930013F10Rik -0.540539 Zfp775 -0.553516

Cbx8 -0.527184 Kif9 -0.540604 Scrn2 -0.553607

Histlh2bn -0.527204 Uchl5 -0.540704 Rtkn2 -0.553639

N6amtl -0.527226 Bmper -0.541647 Zfp90 -0.554355

Dguok -0.527277 AU040972 -0.543 Faim -0.554597

Nsun4 -0.527444 4930478L05Rik -0.543017 Slc25a29 -0.554769

Mob2 -0.527774 Agap3 -0.543024 Taf4b -0.555292

Ttc30b -0.528068 B230217C12Rik -0.543046 Psmc3ip -0.555487

Dpml -0.528659 Clca2 -0.543046 Ecsit -0.555716

Cdl60 -0.528948 Efcab2 -0.543046 Cdkl8 -0.555878

A130010J15Rik -0.529464 Flil -0.543046 Gml3212 -0.556088

Tex261 -0.529497 Adam33 -0.543153 Zfp809 -0.556774

Zrsrl -0.529582 Zfp692 -0.543211 Slc27a6 -0.556931

Ezh2 -0.529736 Tmem37 -0.54398 Pagrla -0.557216

Spnsl -0.529766 Exoc6 -0.543982 Ankrd61 -0.557364

Rad52 -0.530504 Nabl -0.544948 2310061J03Rik -0.557451

A430105ll9Rik -0.530628 Osgepll -0.545206 Atp5s -0.557451

D8Ertd738e -0.530884 Tdrp -0.54622 Taf6 -0.557831

Mettl23 -0.530933 Lztsl -0.546333 BC005624 -0.558161

Hsdl2 -0.531341 Dtdl -0.546666 Rpia -0.558475

Hmcnl -0.532021 Sec23b -0.546755 ZfpllO -0.558722

C330018D20Rik -0.533362 Smg8 -0.54728 BC002163 -0.559052 )52 log2(fold_ log2(fold_ log2(fold_ gene change) gene change) gene change)

Gzfl -0.560191 B830017H08Rik -0.573752 Pnkp -0.587455

Ppplrll -0.560436 Cd55 -0.573752 Rgs4 -0.58759

Camtal -0.560626 Cplxl -0.573752 Ndufb2 -0.588812

Dennd6b -0.560699 D7Ertd715e -0.573752 Znrdl -0.58887

Zfp958 -0.561342 E030018B13Rik -0.573752 Wdr76 -0.589025

Cog7 -0.561344 Frmd5 -0.573752 Tgifl -0.589098

Slc35e4 -0.561346 Gml9466 -0.573752 Histlh2bh -0.589503

Orc5 -0.562315 Itgb2 -0.573752 Srm -0.589822

Faml32b -0.562321 Mril -0.575174 1700037C18Rik -0.59005

Tnfrsflb -0.562394 Terc -0.575417 Hmga2-psl -0.59005

Zfp551 -0.562656 Tacc2 -0.575468 Otudl -0.590053

Zfp703 -0.563343 Gprl46 -0.575474 Klhlll -0.590337

Tor4a -0.564252 Lgals6 -0.57582 Zfp606 -0.591307

Kcnk2 -0.564836 Ptpmtl -0.576346 Il2rb -0.591498

Kctdl9 -0.565341 Ngf -0.57681 Faml74a -0.592183

Zfp398 -0.565357 Mutyh -0.577625 Pacrgl -0.592657

Ift43 -0.565539 Wdr31 -0.577626 Gucdl -0.593612

Arid3a -0.565912 Hinfp -0.577643 Zfp442 -0.594297

Klfll -0.566662 Ppplrl3b -0.578079 Utp3 -0.595259

Ints5 -0.566901 Rgsl9 -0.578324 Cdkn3 -0.595313

Ppapdc2 -0.567622 Jade2 -0.579041 Apcddl -0.595463

Tmed8 -0.567747 Histlhlc -0.579818 Ccdcl73 -0.595772

Spry2 -0.56794 VsiglOI -0.580002 Fam43a -0.596216

3830406C13Rik -0.568015 SpllO -0.5801 Cirl -0.596439

Dyrk2 -0.568265 Tcea2 -0.580364 Smnl -0.596571

Cyp2j9 -0.569269 TnfsflO -0.580765 Ifi27l2a -0.596679

Ccdc55 -0.569922 Nt5m -0.581035 Siahla -0.59683

Nat6 -0.570533 Mrpsl8b -0.581333 A330021E22Rik -0.597171

Haus4 -0.57081 Fgfl8 -0.581553 Ppmld -0.597613

Tmx2 -0.571123 Arhgap26 -0.582712 Zbtb39 -0.598211

Mageel -0.571345 Brdt -0.582829 Fancf -0.598231

Urml -0.571663 Zfpl69 -0.582877 Camk2b -0.59927

Zfp512 -0.571718 Egr3 -0.583242 Oardl -0.599343

AU022252 -0.572398 Gatsl3 -0.583612 Cldnl -0.599465

Zprl -0.572764 Tbcld9 -0.584085 Npas2 -0.599465

Fam26e -0.572969 Magea8 -0.585681 Srp54b -0.599643

Tgds -0.57346 Tshzl -0.58579 Zfp930 -0.6002

Histlh2af -0.573751 Eed -0.586174 Rufyl -0.601076

4930465K10Rik -0.573752 Prdmll -0.586508 Mrpl54 -0.602695

4931431C16Rik -0.573752 Gml0336 -0.587345 Stxll -0.602949

AA388235 -0.573752 Echdc3 -0.587408 Dusp6 -0.603491 )52 log2(fold_ log2(fold_ log2(fold_ gene change) gene change) gene change)

Dnaselll -0.60358 Ddal -0.623173 Ttcl2 -0.636575

Gdnf -0.603686 Gccl -0.623266 Ypel4 -0.636706

Ldlrapl -0.604216 Gdf5 -0.623313 Onecut2 -0.637626

B230319C09Rik -0.604244 Ap5bl -0.623908 Polb -0.637657

Neu2 -0.60437 Ajuba -0.624013 Rhnol -0.637914

Zfp839 -0.605325 Nek3 -0.624323 Eapp -0.640406

Apobr -0.605604 1700052N19Rik -0.624351 Gm20748 -0.64078

Gins3 -0.60594 Zc3hl2b -0.624532 MphosphlO -0.64086

H2afj -0.606179 Frgl -0.624631 Zc3h3 -0.641326

Metapld -0.606241 Sh3bpl -0.62497 Abcd4 -0.641495

Rpap3 -0.606281 Ssscal -0.625186 Stk35 -0.641874

Fbxo48 -0.607001 Arhgefl9 -0.625299 Ccdc74a -0.643065

Scrnl -0.607001 2610035D17Rik -0.625422 Pfkfbl -0.643065

Zbtb8os -0.607287 Hps6 -0.626004 Ctbs -0.643279

Tgif2 -0.607855 C030039L03Rik -0.626041 Zfp84 -0.643772

Gstm4 -0.6093 Tstd3 -0.626207 Abtl -0.64509

Tcn2 -0.609315 Zfyve21 -0.62677 Lpar6 -0.645267

Vpsl8 -0.609317 2810032G03Rik -0.627497 Mrpl44 -0.645493

Histlh2bp -0.609375 Nfrkb -0.628125 Mapklipl -0.645745

Oscpl -0.610464 BC053749 -0.628174 Rfx5 -0.645847

Chstll -0.610524 Faml61b -0.628174 Bsn -0.645863

Efna4 -0.610525 Dctd -0.628978 Chstl -0.645863

Gm5069 -0.610917 Commd6 -0.629479 Mgst2 -0.645863

Kif3c -0.612129 Zfp59 -0.629547 Gml5401 -0.645877

Uaplll -0.612707 Edc3 -0.629571 Ptdss2 -0.64628

Slcl6a2 -0.613014 Cecr5 -0.629599 Tmedl -0.647055

Zfp960 -0.613692 Tprn -0.630454 Zbtb34 -0.648021

Histlh3d -0.613986 Ccdcl04 -0.630718 4930556M19Ri

Itpkl -0.614283 Ddx55 -0.631254 k -0.648099

Cdk6 -0.614877 Plod2 -0.632111 Ccdcl74 -0.649049

Pexllg -0.614939 Fignll -0.632171 KrtlO -0.649049

Arrdc4 -0.617362 Myo7a -0.633202 2810047C21Rik

Trp53rk -0.618256 2810408M09Ri 1 -0.649356

2410004B18Rik -0.618544 k -0.633783 Dis3l2 -0.650614

Ginsl -0.619211 Radl7 -0.634016 Gpr75 -0.651521

Zfp532 -0.620083 Rnfl38 -0.634935 Necab3 -0.651521

WntlOb -0.620199 Triml2c -0.635249 Dyrk3 -0.651559

Mrl -0.620456 Mettll5 -0.636089 Snxll -0.651727

Zfp658 -0.620595 Hfe -0.636366 Midlipl -0.652493

Ears2 -0.622258 Fdxacbl -0.636473 Rgsl7 -0.652537

Lohl2crl -0.622411 Mrps28 -0.636473 Zfp668 -0.654208 )52 log2(fold_ log2(fold_ log2(fold_ gene change) gene change) gene change)

Uhmkl -0.654745 Fbxo32 -0.670724 Spock2 -0.693274

Polr3a -0.655476 Cit -0.671092 Ttllll -0.693274

Incal -0.655784 Slcl6a9 -0.671699 5730507C01Rik -0.693346

Coq4 -0.655808 Snai2 -0.672634 Pibfl -0.693752

Ccnf -0.657503 Zfp382 -0.672674 Gml6596 -0.693878

4921513l03Rik -0.657561 Ifitl -0.672916 Lpin3 -0.694452

Fjxl -0.657561 Kcnj6 -0.673846 Zfp341 -0.695049

Gsgll -0.657561 B4galt7 -0.674757 Trhde -0.697817

5830418K08Rik -0.657611 Il6ra -0.675251 Haghl -0.69896

Tada2a -0.657686 Lrrc48 -0.675405 Sex -0.699475

Zfp599 -0.658249 Zc3hcl -0.676349 Ankrd23 -0.699539

A630066FllRik -0.658756 Trim21 -0.676785 Dok4 -0.699539

2210408l21Rik -0.659112 1134 -0.678002 Zfp759 -0.699539

Rcan2 -0.659781 Zkscan5 -0.678454 Osrl -0.700978

Zfp248 -0.660258 Fndc4 -0.679377 Cxcll -0.701207

Nipsnap3b -0.661068 Etohil -0.680126 Capn5 -0.702153

Zfp947 -0.661354 Nup210l -0.68017 Ftsj2 -0.702185

Spryd7 -0.661689 Smim8 -0.68017 Cblll -0.702813

1810043G02Rik -0.662097 Sharpin -0.680316 Trexl -0.703789

4930453N24Rik -0.662222 Ddx27 -0.681203 Terfl -0.704221

Armc8 -0.662384 Kctd21 -0.682037 Rsadl -0.704583

Tsen2 -0.66291 Ifi44 -0.682371 Gla -0.705089

Nhsll -0.663326 B4galt6 -0.682375 Ccdc77 -0.705819

Dnmt3b -0.664391 Pknox2 -0.683044 Eme2 -0.705906

Histlh2ai -0.664475 Acyl -0.683377 Tcf23 -0.70598

Apitdl -0.664838 Dtnbpl -0.683623 P2ryl3 -0.706026

Itpkc -0.665082 4931428F04Rik -0.685205 4933402D24Rik -0.706088

Foxf2 -0.665223 Sema5a -0.685834 9530026P05Rik -0.706088

Plekha5 -0.666248 Mlycd -0.686426 A330032BllRik -0.706088

3110056K07Rik -0.666493 Bncl -0.686956 AI854703 -0.706088

Ftsjl -0.666502 Hexim2 -0.687181 Aknadl -0.706088

Slc39a8 -0.666549 D330050ll6Rik -0.688364 Apon -0.706088

Primpol -0.66774 Gltscrl -0.688913 Aqp7 -0.706088

2700069ll8Rik -0.667935 Lmfl -0.689297 Cacna2d4 -0.706088

Dffb -0.667935 Ubl3 -0.689301 Dock3 -0.706088

Sgcd -0.667951 Rnf220 -0.689847 Duspl5 -0.706088

Gm5512 -0.667976 0610037L13Rik -0.690647 Efcab8 -0.706088

Mttp -0.668287 Atll -0.691053 Fbxo47 -0.706088

Crebzf -0.669662 Tpgsl -0.691596 Gjb5 -0.706088

Pdikll -0.670509 Sh3bp5 -0.692301 Gm5779 -0.706088

A430033K04Rik -0.670721 Csk -0.692498 Gm6086 -0.706088 )52 log2(fold_ log2(fold_

gene change) gene change)

Gm9047 -0.706088 Gm20362 -0.708245

Gpr84 -0.706088 9230105E05Rik -0.709777

Gstm7 -0.706088 Ikzf2 -0.710537

Hs3st6 -0.706088 Mxd3 -0.710562

Hsdl7bl4 -0.706088 Dlxl -0.712027

Kif26a -0.706088 Zfp873 -0.71301

Krtl6 -0.706088 B9dl -0.714355

Pate2 -0.706088 Esyt3 -0.71549

Phyhip -0.706088 Tritl -0.716494

Pld4 -0.706088 1810043H04Rik -0.718317

Prss38 -0.706088 Histlh2an -0.718552

Ragl -0.706088 Lipt2 -0.718794

Rasgrp2 -0.706088 Gsdmd -0.719585

Rbm3os -0.706088 4921531C22Rik -0.720481

Rimbp3 -0.706088 Asic3 -0.720481

Rnfl83 -0.706088 Fkbpl -0.720481

Ryr3 -0.706088 Galr2 -0.720481

Slcl7a9 -0.706088 Klf5 -0.720481

Snora69 -0.706088 Psmb9 -0.720481

Snord23 -0.706088 Tert -0.720481

Srpk3 -0.706088 Rbm38 -0.720904

Tmeml40 -0.706088 Potlb -0.72219

Ttc24 -0.706088 Lcmtl -0.72227

Tubg2 -0.706088 Gtf3c6 -0.722322

Uchl4 -0.706088 Cyb5dl -0.723168

Unc45b -0.706088 Alkbh4 -0.723575

Uspl7la -0.706088 Tmem205 -0.723904

Xkrx -0.706088 Foxc2 -0.724419

Zfp389 -0.706088 Slc2a8 -0.725225

Ziml -0.706088 Rinl -0.725263

2610203C22Rik -0.706095 B4galnt2 -0.725681

Amyl -0.706183 Camklg -0.725681

D630029K05Rik -0.706215 Ropnll -0.725681

Crhr2 -0.706229 Zfp455 -0.725681

Tsenl5 -0.706252 Fam83h -0.725929

Tspan32 -0.706259 Sh3yll -0.7263

5730420D15Rik -0.706377 Lyrml -0.726373

Gcntl -0.706807 Taflc -0.727469

Cntfr -0.706823 Irxl -0.72786

Fam206a -0.707078 AW209491 -0.728344

Strada -0.707297 Fbxo31 -0.72861 )52

)52 log2(fold_ log2(fold_ log2(fold_ gene change) gene change) gene change)

Fignl2 -0.841642 Zfp764 -0.894501 Kcnnl -0.918356

E130307A14Rik -0.841942 Wdr44 -0.894865 Rnpepll -0.918389

Trim34a -0.842282 Med26 -0.895078 Trmt5 -0.919185

Pankl -0.843037 Zfp763 -0.896189 Cry 11 -0.92023

Zfpl91 -0.843053 Pusll -0.896236 Egfl6 -0.921283

6430550D23Rik -0.84395 Dgka -0.89726 Gm6402 -0.921283

Syce2 -0.846123 Yaeldl -0.898458 Hotair -0.921283

Nudt22 -0.846437 2410076l21Rik -0.89981 Zfp708 -0.921564

Rbm47 -0.847476 4930521E06Rik -0.89981 Txnrd3 -0.923589

Irgm2 -0.847656 A330040F15Rik -0.89981 Zan -0.936897

Rftl -0.849209 E130018N17Rik -0.89981 Fam65b -0.936953

A330074K22Rik -0.849443 E430016F16Rik -0.89981 Parvb -0.937209

1700029H14Rik -0.85006 Faml84b -0.89981 Pigw -0.940902

Atp5sl -0.851423 Kctd4 -0.89981 Lysmd4 -0.941065

Tmeml4a -0.852202 Nipal2 -0.89981 Zfp37 -0.941341

As3mt -0.852315 Plekha7 -0.89981 Lekrl -0.943815

Mycn -0.852315 Rims2 -0.89981 Galnt9 -0.947365

Poli -0.85266 Soat2 -0.89981 Zfp943 -0.953224

Slcl8a2 -0.854831 Hhatl -0.899876 Zfp87 -0.957457

Rwdd2b -0.86081 9230110C19Rik -0.902176 Gml2669 -0.958069

Rnase4 -0.865073 Kbtbd4 -0.902319 1600029ll4Rik -0.958083

Epha7 -0.865657 Tmem8 -0.902472 2810405F15Rik -0.958083

Aqpll -0.866944 Palb2 -0.903171 Aldhlll -0.958083

Repl5 -0.866944 Pard6a -0.904017 Aplg2 -0.958083

Grin2d -0.867395 Nme3 -0.907648 Bmp8b -0.958083

Gprl62 -0.868317 Clqtnfl -0.908103 Camk2nl -0.958083

Dcbldl -0.869465 Frs3 -0.90817 Ccdc87 -0.958083

Zfp597 -0.877144 Zmatl -0.908467 Cd46 -0.958083

6330549D23Rik -0.877973 Ap5sl -0.910458 Cml5 -0.958083

Gml0658 -0.878877 Zfp39 -0.910573 Fxyd7 -0.958083

Spata5ll -0.878877 Zfp454 -0.911083 Gml4057 -0.958083

Arrbl -0.87975 Gml0532 -0.912189 Gm6642 -0.958083

Acsf2 -0.882695 Dhx35 -0.912651 Kdm4d -0.958083

Hic2 -0.886541 Histlhld -0.913021 Tsacc -0.958083

Nova 2 -0.890182 Fosb -0.913754 Urocl -0.958083

Gm7334 -0.890376 Lrfn3 -0.913776 1810019D21Rik -0.958128

Neatl -0.890741 Zfp593 -0.914014 Frs3os -0.958337

Mgmt -0.890925 Lins -0.914152 Syt8 -0.959358

Ankrd35 -0.891538 Irx5 -0.915824 Kbtbd7 -0.961542

1700019G17Rik -0.892095 4930451G09Rik -0.916876 Rpusd2 -0.962275

Atp6v0c-ps2 -0.893895 Klf2 -0.917442 Brmsl -0.962914 )52 log2(fold_ log2(fold_ log2(fold_ gene change) gene change) gene change)

Faml20aos -0.963613 Tnfsf9 -1.02444 Eiflb -1.07147

Pfkfb4 -0.963796 Abhdl -1.0251 Mpp6 -1.07444

Sv2a -0.963796 Ccdc51 -1.02514 Catip -1.07765

Tmeml85b -0.963796 Srd5al -1.02627 Drp2 -1.07888

1700086O06Rik -0.964385 Wdr53 -1.03014 Pcdhb8 -1.08078

Mitdl -0.964645 Cardl4 -1.0313 Bhlhal5 -1.08206

Smco3 -0.964993 Gml5446 -1.0313 Bricd5 -1.08206

Col9a3 -0.965064 Gm6225 -1.0313 Carl5 -1.08206

Tacr2 -0.968807 Krt80 -1.0313 Gml5612 -1.08206

Tmem80 -0.973976 Sgpp2 -1.0313 Hspb9 -1.08206

Mcf2l -0.974236 Trim36 -1.0313 Rarb -1.08206

C4a -0.976222 Dolppl -1.03212 Slc29a2 -1.08206

Zfpl09 -0.980712 Tmem220 -1.03226 Srcrb4d -1.08206

Fam53b -0.981167 Gramd3 -1.0325 Tubb4a -1.08206

4632427E13Rik -0.983515 Plekha2 -1.03449 Gsto2 -1.08209

Gml3157 -0.985491 Zfpl08 -1.03621 Gmpr -1.08297

Akap5 -0.988789 Irf7 -1.03938 Zcchc5 -1.0843

Gjb3 -0.988966 1700021F05Rik -1.03988 Pcdhgb8 -1.08517

Pgbdl -0.994904 Map9 -1.04035 Gml0509 -1.08634

Fgfbp3 -0.996304 B230217O12Rik -1.04191 Gml7769 -1.08673

Gml2070 -0.999898 Col4a4 -1.04191 Dbnddl -1.08763

Mir22hg -1.00059 Prr5l -1.04327 Katnal2 -1.0887

Msil -1.0006 Lrch4 -1.04389 Pip4k2a -1.08881

3110009E18Rik -1.00099 Snx32 -1.04743 Mthfs -1.08891

IllSra -1.00477 Bcar3 -1.04746 Casp4 -1.08983

9330151L19Rik -1.00508 Commd9 -1.05007 9130019O22Rik -1.09251

Adrb2 -1.00509 Depdclb -1.05105 Enpp3 -1.09271

Arhgef6 -1.00509 Pcdhga9 -1.05114 8430431K14Rik -1.0935

St6galnac2 -1.00509 Zfp354a -1.05515 Gml6712 -1.0935

A730017C20Rik -1.0051 Adhfel -1.0558 Nuggc -1.0935

Uspl7le -1.00834 Lcat -1.0586 Dmkn -1.09763

Gan -1.01104 Pcdhl2 -1.0586 Bambi -1.09927

Ppdpf -1.01151 Slc44a3 -1.0586 B4galnt4 -1.09955

Rassf7 -1.02042 Rpp21 -1.06131 Zfp677 -1.10137

Alyref2 -1.02132 Adamtsl3 -1.06243 Zfp870 -1.10137

A630001G21Rik -1.0214 Nafl -1.06434 Cmtr2 -1.10287

Zbtb49 -1.02217 Clhcl -1.06681 Mfsd6 -1.10351

Taf7 -1.02255 Dhrs3 -1.06694 Zfp408 -1.10399

Ppmle -1.02353 Trnaulap -1.06825 Mtap7d3 -1.10456

Zfp30 -1.02424 Ccdc64 -1.06964 Nudt6 -1.11254

Histlh3g -1.02433 Cdnf -1.06964 Larp6 -1.11285 )52 log2(fold_ log2(fold_ log2(fold_ gene change) gene change) gene change)

Gpr85 -1.11496 Gml0814 -1.18443 Acn9 -1.29475

9430018G01Rik -1.11501 Ccnj -1.18669 Hist2h2ab -1.30242

Gm 14378 -1.11501 Orail -1.18774 Cep41 -1.3043

Nmnatl -1.11501 Cabyr -1.19303 Pcdhal2 -1.30484

Calml4 -1.1162 Sh3d21 -1.19876 Cmll -1.30544

Cyb561d2 -1.11762 C030034l22Rik -1.19914 Zscanl8 -1.31459

Hspall -1.12163 Gml6740 -1.20283 Gpat2 -1.31476

Nuprl -1.12472 Crispldl -1.20403 Pkd2l2 -1.31833

Zfp825 -1.13017 Raplgap -1.20765 Nov -1.3192

Rpp40 -1.13045 Nhejl -1.21038 Slc46a3 -1.32016

Slc26all -1.1325 Apol9a -1.21719 Rgs9bp -1.32674

Trim65 -1.1325 Kbtbd3 -1.22009 Apls2 -1.33649

Ppargcla -1.13279 Slc25a23 -1.22118 Mybll -1.33714

Tmem86a -1.13369 Fbxl8 -1.22878 Tuscl -1.33963

Nudtl6 -1.13415 Hoxal -1.22939 Mzfl -1.34088

Zfp202 -1.13696 Nat2 -1.23305 Zscan20 -1.34132

Gdpgpl -1.13954 Ndufaf6 -1.23343 Tirap -1.34754

Ccdc92 -1.14011 Nlrc3 -1.23968 Marveld2 -1.37816

Pcdhgb4 -1.14036 4931414P19Rik -1.24722 AkrlblO -1.37926

Thtpa -1.14065 Slc9a9 -1.24734 Tulp2 -1.37931

Tmtcl -1.15184 Repinl -1.24919 Omg -1.38002

Mettl3 -1.15326 Tspan2 -1.25039 2300009A05Rik -1.38003

Rab3a -1.15447 Btc -1.25262 4933427EllRik -1.38003

C330006A16Rik -1.15655 Spal7 -1.25262 6230400D17Rik -1.38003

Acvrll -1.15764 Ccdcl76 -1.25346 Ankrd53 -1.38003

Fancb -1.15797 Raverl -1.26039 Car5b -1.38003

Morn2 -1.15879 2310068J16Rik -1.26102 Ccl9 -1.38003

Duspl4 -1.15914 Dusp8 -1.26364 Cd247 -1.38003

Naip6 -1.15914 Piddl -1.26865 E130102H24Rik -1.38003

2010320M18Ri PgP -1.26976 Efcab5 -1.38003 k -1.16332 LOC100505025 -1.27565 EphalO -1.38003

4932416H05Rik -1.16416 Agpat2 -1.27578 Faml54b -1.38003

Spdya -1.16524 Fprl -1.27578 Ferll5 -1.38003

Srcinl -1.16714 Gm20753 -1.27578 Gml4634 -1.38003

Dlecl -1.16812 F630042J09Rik -1.27804 Gml6523 -1.38003

Clcn2 -1.17179 Famll7a -1.28065 Gm773 -1.38003

Fam212a -1.17501 Ube2t -1.28523 Igfbp2 -1.38003

Myola -1.17567 A530032D15Rik -1.29105 Igflrl -1.38003

Tubdl -1.18154 Gml0791 -1.29105 Lama5 -1.38003

Faml9a5 -1.18349 Gm6034 -1.29105 Lectl -1.38003

Acy3 -1.18443 Poln -1.29352 Lenep -1.38003 )52 log2(fold_ log2(fold_ log2(fold_ gene change) gene change) gene change)

Lhx4 -1.38003 Cst6 -1.50625 2310009A05Rik -1.62251

Lrrcl5 -1.38003 Ydjc -1.5258 Gml5787 -1.62324

Mroh8 -1.38003 Gml4124 -1.52882 Ntf5 -1.62331

Nrg4 -1.38003 Zfp78 -1.53624 Trpc2 -1.62464

Rab20 -1.38003 Cideb -1.54305 Gm3435 -1.62687

Sag -1.38003 Col4a3 -1.54305 Slc35d2 -1.6337

Serpina3i -1.38003 E130012A19Rik -1.54305 0610039K10Rik -1.64586

Spata20 -1.38003 E230008N13Rik -1.54305 Mettl20 -1.65482

Tmeml44 -1.38003 Gm3604 -1.54305 Pde3a -1.65756

Trcgl -1.38003 Gpc3 -1.54305 Ccdcl77 -1.6754

Zbtb32 -1.38003 Lrp2 -1.54305 Mterflb -1.6754

Zfp750 -1.38003 Sh3tcl -1.54305 Gml9557 -1.68489

2610027K06Rik -1.3801 Tex26 -1.54305 Pdela -1.68652

Cct6b -1.38046 Wnt8b -1.54305 Ccr7 -1.69782

Slxlb -1.39993 Emilin3 -1.54332 Cdh22 -1.70609

Aphlc -1.4049 Abat -1.54336 E230025N22Rik -1.70609

Mapkll -1.40895 Impg2 -1.54919 Lypdl -1.70609

Rnaset2a,Rnase Kcnhl -1.54936 Olfrl417 -1.70609 t2b -1.40933 Gimap6 -1.55225 Otoa -1.70609

Grk4 -1.42973 Il20rb -1.55225 Pard3b -1.70609

4430402ll8Rik -1.43644 Wdr93 -1.55225 Ppmlj -1.70609

Foxd2 -1.44034 Gfil -1.55229 Siglecl5 -1.70609

Mndl -1.44746 Tnfsfl2Tnfsfl3 -1.55406 St8sial -1.70609

Phxr4 -1.45029 Lcmt2 -1.55828 Vmn2r-ps54 -1.70609

Hoxd3 -1.45722 Lsr -1.55834 Col2al -1.70638

Spata24 -1.45823 1190005l06Rik -1.56266 Fam73a -1.70643

Tremll -1.46198 Gls2 -1.56293 Plekhgl -1.70665

Gdaplll -1.46266 8430408G22Rik -1.5646 Plbl -1.70728

Cptlb -1.46299 Ppplr3c -1.57178 Tenm2 -1.70774

Elovl4 -1.46384 3000002C10Rik -1.57375 Misl8a -1.71264

Ggct -1.46384 4930552P12Rik -1.57375 Pcbd2 -1.71272

Tbx6 -1.46384 4931430N09Rik -1.57375 Bbs5 -1.72048

Zfp647 -1.46627 Prssl2 -1.57375 Jph2 -1.73714

2410016O06Rik -1.46954 Gm2897 -1.57379 Cfp -1.7401

Rpll4-psl -1.48126 Pcdhga2 -1.57681 1700019L03Rik -1.74597

G630090E17Rik -1.48442 Vashl -1.58534 Ushbpl -1.74597

Svop -1.48477 Samd5 -1.58875 Dlgapl -1.74779

Tmem235 -1.48477 Fhl4 -1.59947 Cobl -1.75624

Ifitml -1.4849 2810008D09Rik -1.60233 Siglecl -1.76063

Leng9 -1.49253 Dand5 -1.60242 Cdhl7 -1.76544

Slc25a2 -1.4971 Dnajcl2 -1.61231 4930528A17Rik -1.77333 )52 log2(fold_ log2(fold_ log2(fold_ gene change) gene change) gene change)

Gbp6 -1.77333 Gml0432 -1.95808 Usp27x -2.19883

2810410L24Rik -1.78516 Vmnlr43 -1.95808 Ubald2 -2.22255

Chrnbl -1.78516 Scnnla -1.96311 2310009B15Rik -2.25952

Kcnip3 -1.7866 Abhd3 -1.9638 Stc2 -2.28001

Cstad -1.80581 Gprl37c -1.96499 Ppplrlb -2.28554

Rab27a -1.80581 Mapkl2 -1.96499 4930519F09Rik -2.29105

Edaradd -1.82059 Itgae -1.96724 Chnlos3 -2.29105

2700097O09Rik -1.82068 Zfp784 -1.99119 E130309D14Rik -2.29105

Plpl -1.8211 Faml95a -2.00996 Gsdmcl-ps -2.29105

1810034E14Rik -1.83758 Plxdcl -2.02214 Zfp946 -2.31977

4933430ll7Rik -1.83758 Rnasel -2.04804 Fratl -2.32787

Angptl7 -1.83758 Dtwdl -2.05688 Scd4 -2.32787

BC039771 -1.83758 LOC100861615 -2.06437 Tex30 -2.32948

Ccdc38 -1.83758 3300002l08Rik -2.08206 Lincrna-cox2 -2.33623

CcrlO -1.83758 Atg9b -2.08206 E2f2 -2.35593

FamllOc -1.83758 B3galtl -2.08206 Faml69b -2.38003

Gata3 -1.83758 Ccdcl7 -2.08206 Gml6062 -2.38003

Gliprl -1.83758 Foxql -2.08206 Nod2 -2.38003

Npm2 -1.83758 Gnat2 -2.08206 Uspl3 -2.38003

Rgagl -1.83758 Krt83 -2.08206 12-Sep -2.42791

Serpindl -1.83758 Prlr -2.08206 Ino80dos -2.44136

Gml6853 -1.83759 Zfp786 -2.08206 Slc3al -2.46402

Trim43c -1.8376 Gml9897 -2.08215 1110019D14Rik -2.55225

Spns2 -1.83764 Aatk -2.08227 B3gnt4 -2.55225

4930506M07Ri 9330159M07Ri Ces4a -2.55225 k -1.83767 k -2.11376 DII4 -2.55225

Crmpl -1.83774 1500011K16Rik -2.11501 Uspl8 -2.57375

Fyb -1.83785 Mettll8 -2.1325 C230029M16 -2.58557

Freml -1.87112 0610009L18Rik -2.13415 Snrnp35 -2.59005

Grbl4 -1.87888 2810002D19Rik -2.13415 Ednl -2.62687

Hspbapl -1.8899 Anxa8 -2.15117 Luzp4 -2.62687

Gml5987 -1.89981 Fsbp -2.15649 Tssk2 -2.62687

Lpcat2b -1.89981 1700024P16Rik -2.1728 Mme -2.62733

Neb -1.89981 Axin2 -2.18443 A530016L24Rik -2.65376

Timp4 -1.89981 Ptprv -2.18443 Optc -2.65956

Gm9855 -1.90588 Samdl5 -2.18443 Cagel -2.6754

Paqr7 -1.90629 Tmem252 -2.18443 Hpx -2.70609

Tmc3 -1.90629 1600020E01Rik -2.18457 Armc2 -2.77333

Tnfrsfl4 -1.91198 Gm2373 -2.18509 Gm20257 -2.77333

Lhx6 -1.92398 Hdhd3 -2.1864 Lmcdl -2.77333

Btbd8 -1.93985 Zfp472 -2.18696 Adcy3 -2.78028 )52 log2(fold_ log2(fold_

gene change) gene change)

Ttc30al -2.81623 Endog -3.0214

Ccdcl51 -2.82116 ItgalO -3.13415

Ankddlb -2.83758 Emc9 -3.18443

Atp8b4 -2.83758 D6Ertd527e -3.23872

Zfp712 -2.83758 Dmrta2 -3.28554

Mterfla -2.87286 Gml4827 -3.33089

Seel -2.90629 Lrrc51 -3.86552

Tmeml69 -2.96499 Jmjd7-pla2g4b -4.26272

REFERENCES

Afgan, E., Baker, D., van den Beek, M., Blankenberg, D., Bouvier, D., Cech, M., Chilton, J., Clements, D., Coraor, N., Eberhard, C, et al. (2016). The Galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2016 update. Nucleic Acids Res.

Allen, T.A., Von Kaenel, S., Goodrich, J.A., and Kugel, J.F. (2004). The SINE-encoded mouse B2 RNA represses mRNA transcription in response to heat shock. Nat Struct Mol Biol 1 1, 816-821.

Bachvarova, R. (1988). Small B2 RNAs in mouse oocytes, embryos, and somatic tissues. Developmental biology 130, 513-523.

Basenko, E.Y., Sasaki, T., Ji, L., Prybol, C.J., Burckhardt, R.M., Schmitz, R.J., and Lewis, Z.A. (2015). Genome-wide redistribution of H3K27me3 is linked to genotoxic stress and defective growth. Proc Natl Acad Sci U S A 1 12, E6339-6348.

Bourque, G., Leong, B., Vega, V.B., Chen, X., Lee, Y.L., Srinivasan, K.G., Chew, J.L., Ruan, Y., Wei, C.L., Ng, H.H., et al. (2008). Evolution of the mammalian transcription factor binding repertoire via transposable elements. Genome Res 18, 1752-1762.

Brown, S.A., Imbalzano, A.N., and Kingston, R.E. (1996). Activator- dependent regulation of transcriptional pausing on nucleosomal templates. Genes Dev 10, 1479- 1490.

Chircop, M., and Speidel, D. (2014). Cellular stress responses in cancer and cancer therapy. Frontiers in oncology 4, 304.

Cifuentes-Rojas, C, Hernandez, A. J., Sarma, K., and Lee, J.T. (2014).

Regulatory interactions between RNA and poly comb repressive complex 2. Mol Cell 55, 171-185.

Consortium, E.P., Birney, E., Stamatoyannopoulos, J.A., Dutta, A., Guigo, R., Gingeras, T.R., Margulies, E.H., Weng, Z., Snyder, M., Dermitzakis, E.T., et al. (2007). Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project. Nature 447, 799-816.

Daniels, G.R., and Deininger, P.L. ( 1985). Repeat sequence families derived from mammalian tRNA genes. Nature 317, 819-822. Davidovich, C, Wang, X., Cifuentes-Rojas, C, Goodrich, K.J., Gooding, A.R., Lee, J.T., and Cech, T.R. (2015). Toward a consensus on the binding specificity and promiscuity of PRC2 for RNA. Mol Cell 57, 552-558.

Davidovich, C, Zheng, L., Goodrich, K.J., and Cech, T.R. (2013).

Promiscuous RNA binding by Poly comb repressive complex 2. Nat Struct Mol Biol 20, 1250-1257.

de Koning, A.P., Gu, W., Castoe, T.A., Batzer, M.A., and Pollock, D.D. (2011). Repetitive elements may comprise over two-thirds of the human genome. PLoS Genet 7, el002384.

de Nadal, E., Ammerer, G., and Posas, F. (2011). Controlling gene expression in response to stress. Nature reviews Genetics 12, 833-845.

Down, T.A., and Hubbard, T.J. (2002). Computational detection and location of transcription start sites in mammalian genomic DNA. Genome Res 12, 458-461.

Espinoza, C.A., Allen, T.A., Hieb, A.R., Kugel, J.F., and Goodrich, J.A. (2004). B2 RNA binds directly to RNA polymerase II to repress transcript synthesis. Nat Struct Mol Biol 11, 822-829.

Espinoza, C.A., Goodrich, J.A., and Kugel, J.F. (2007). Characterization of the structure, function, and mechanism of B2 RNA, an ncRNA repressor of RNA polymerase II transcription. RNA 13, 583-596.

Ferrigno, O., Virolle, T., Djabari, Z., Ortonne, J.P., White, R.J., and Aberdam,

D. (2001). Transposable B2 SINE elements can provide mobile RNA polymerase II promoters. Nature genetics 28, 77-81.

Fornace, A.J., Jr., and Mitchell, J.B. (1986). Induction of B2 RNA polymerase III transcription by heat shock: enrichment for heat shock induced sequences in rodent cells by hybridization subtraction. Nucleic Acids Res 14, 5793-5811.

Gall, J.G. (1981). Chromosome structure and the C-value paradox. J Cell Biol 91, 3s-14s.

Hasties, N. (1989). Highly repeated DNA families in the genome of Mus musculus. In Genetic Variants and Strains of the Laboratory Mouse (Oxford: Oxford University Press).

Huang, W., Loganantharaj, R., Schroeder, B., Fargo, D., and Li, L. (2013). PA VIS: a tool for Peak Annotation and Visualization. Bioinformatics 29, 3097-3099. Kaczkowski, B., Tanaka, Y., Kawaji, H., Sandelin, A., Andersson, R., Itoh, M., Lassmann, T., Hayashizaki, Y., Carninci, P., Forrest, A.R., et al. (2016).

Transcriptome Analysis of Recurrently Deregulated Genes across Multiple Cancers Identifies New Pan-Cancer Biomarkers. Cancer research 76, 216-226.

Kaneko, H., Dridi, S., Tarallo, V., Gelfand, B.D., Fowler, B.J., Cho, W.G.,

Kleinman, M.E., Ponicsan, S.L., Hauswirth, W.W., Chiodo, V.A., et al. (2011).

DICERl deficit induces Alu RNA toxicity in age-related macular degeneration. Nature 471, 325-330.

Kaneko, S., Son, J., Shen, S.S., Reinberg, D., and Bonasio, R. (2013). PRC2 binds active promoters and contacts nascent RNAs in embryonic stem cells. Nat Struct Mol Biol 20, 1258-1264.

Kapranov, P., Willingham, A.T., and Gingeras, T.R. (2007). Genome-wide transcription and the implications for genomic organization. Nature reviews Genetics 8, 413-423.

Kleinmanns, J.A., and Schubert, D. (2014). Polycomb and Trithorax group protein-mediated control of stress responses in plants. Biological chemistry 395, 1291-1300.

Kramerov, D.A., Lekakh, I.V., Samarina, O.P., and Ryskov, A.P. (1982). The sequences homologous to major interspersed repeats B l and B2 of mouse genome are present in mRNA and small cytoplasmic poly(A) + RNA. Nucleic Acids Res 10, 7477-7491.

Kramerov, D.A., and Vassetzky, N.S. (2011). SINEs. Wiley Interdiscip Rev RNA 2, 772-786.

Krayev, A.S., Markusheva, T.V., Kramerov, D.A., Ryskov, A.P., Skryabin, K.G., Bayev, A.A., and Georgiev, G.P. (1982). Ubiquitous transposon-like repeats Bl and B2 of the mouse genome: B2 sequencing. Nucleic Acids Res 10, 7461-7475.

Kung, J.T., Kesner, B., An, J.Y., Ahn, J.Y., Cifuentes-Rojas, C, Colognori, D., Jeon, Y., Szanto, A., del Rosario, B.C., Pinter, S.F., et al. (2015). Locus-specific targeting to the X chromosome revealed by the RNA interactome of CTCF. Mol Cell 57, 361-375.

Kwak, H., Fuda, N.J., Core, L.J., and Lis, J.T. (2013). Precise maps of RNA polymerase reveal how promoters direct initiation and pausing. Science 339, 950-953. Lawrence, C.B., McDonnell, D.P., and Ramsey, W.J. (1985). Analysis of repetitive sequence elements containing tRNA-like sequences. Nucleic Acids Res 13, 4239-4252.

Lee, J.T., and Bartolomei, M.S. (2013). X-Inactivation, Imprinting, and Long Noncoding RNAs in Health and Disease. Cell 152, 1308-1323.

Li, H., and Durbin, R. (2010). Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics 26, 589-595.

Li, T., Spearow, J., Rubin, CM., and Schmid, C.W. (1999). Physiological stresses increase mouse short interspersed element (SINE) RNA expression in vivo. Gene 239, 367-372.

Li, W., Notani, D., and Rosenfeld, M.G. (2016). Enhancers as non-coding RNA transcription units: recent insights and future perspectives. Nature reviews Genetics 17, 207-223.

Lowe, C.B., and Haussler, D. (2012). 29 mammalian genomes reveal novel exaptations of mobile elements for likely regulatory functions in the human genome. PLoS One 7, e43128.

Lunyak, V.V., Prefontaine, G.G., Nunez, E., Cramer, T., Ju, B.G., Ohgi, K.A., Hutt, K., Roy, R., Garcia-Diaz, A., Zhu, X., et al. (2007). Developmentally regulated activation of a SINE B2 repeat as a domain boundary in organogenesis. Science 317, 248-251.

Margueron, R., and Reinberg, D. (2011). The Poly comb complex PRC2 and its mark in life. Nature 469, 343-349.

Mirsky, A.E., Ris H. (1951). The desoxyribonucleic acid content of animal cells and its evolutionary significance. J Gen Physiol 34, 451-462.

Moolhuijzen, P., Kulski, J.K., Dunn, D.S., Schibeci, D., Barrero, R., Gojobori,

T., and Bellgard, M. (2010). The transcript repeat element: the human Alu sequence as a component of gene networks influencing cancer. Functional & integrative genomics 10, 307-319.

Pandey, R.R., Mondal, T., Mohammad, F., Enroth, S., Redrup, L.,

Komorowski, J., Nagano, T., Mancini-DiNardo, D., and Kanduri, C. (2008).

Kcnqlotl Antisense Noncoding RNA Mediates Lineage-Specific Transcriptional Silencing through Chromatin-Level Regulation. Molecular cell 32, 232-246. Ponicsan, S.L., Kugel, J.F., and Goodrich, J.A. (2010). Genomic gems: SINE RNAs regulate mRNA production. Curr Opin Genet Dev 20, 149-155.

Ponicsan, S.L., Kugel, J.F., and Goodrich, J.A. (2015). Repression of RNA Polymerase II Transcription by B2 RNA Depends on a Specific Pattern of Structural Regions in the RNA. Noncoding RNA 1, 4-16.

Quinlan, A.R., and Hall, I.M. (2010). BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841-842.

Rinn, J.L., and Chang, H.Y. (2012). Genome regulation by long noncoding RNAs. Annu Rev Biochem 81, 145-166.

Robinson, J.T., Thorvaldsdottir, H., Winckler, W., Guttman, M., Lander, E.S., Getz, G., and Mesirov, J.P. (2011). Integrative genomics viewer. Nat Biotechnol 29, 24-26.

Siebold, A.P., Banerjee, R., Tie, F., Kiss, D.L., Moskowitz, J., and Harte, P.J. (2010). Poly comb Repressive Complex 2 and Trithorax modulate Drosophila longevity and stress resistance. Proc Natl Acad Sci U S A 107, 169-174.

Simon, M.D. (2013). Capture hybridization analysis of RNA targets

(CHART). Current protocols in molecular biology / edited by Frederick M Ausubel [et al] Chapter 21, Unit 21 25.

Simon, M.D., Pinter, S.F., Fang, R., Sarma, K., Rutenberg-Schoenberg, M., Bowman, S.K., Kesner, B.A., Maier, V.K., Kingston, R.E., and Lee, J.T. (2013). High-resolution Xist binding maps reveal two-step spreading during X-chromosome inactivation. Nature 504, 465-469.

Singh, K., Carey, M., Saragosti, S., and Botchan, M. (1985). Expression of enhanced levels of small RNA polymerase III transcripts encoded by the B2 repeats in simian virus 40-transformed mouse cells. Nature 314, 553-556.

Tarallo, V., Hirano, Y., Gelfand, B.D., Dridi, S., Kerur, N., Kim, Y., Cho, W.G., Kaneko, H., Fowler, B.J., Bogdanovich, S., et al. (2012). DICERl loss and Alu RNA induce age-related macular degeneration via the NLRP3 inflammasome and MyD88. Cell 149, 847-859.

Tay, Y., Rinn, J., and Pandolfi, P.P. (2014). The multilayered complexity of ceRNA crosstalk and competition. Nature 505, 344-352.

Thomas, C.A. (1971). The genetic organization of chromosomes. Annu Rev Genet 5, 237-256. Trapnell, C, Pachter, L., and Salzberg, S.L. (2009). TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 25, 1105-1111.

Treangen, T.J., and Salzberg, S.L. (2012). Repetitive DNA and next- generation sequencing: computational challenges and solutions. Nature reviews Genetics 13, 36-46.

Xu, S., Grullon, S., Ge, K., and Peng, W. (2014). Spatial clustering for identification of ChlP-enriched regions (SICER) to map regions of histone methylation patterns in embryonic stem cells. Methods Mol Biol 1150, 97-111.

Yakovchuk, P., Goodrich, J.A., and Kugel, J.F. (2009). B2 RNA and Alu RNA repress transcription by disrupting contacts between RNA polymerase II and promoter DNA within assembled complexes. Proc Natl Acad Sci U S A 106, 5569- 5574.

Zhao, J., Ohsumi, T.K., Kung, J.T., Ogawa, Y., Grau, D.J., Sarma, K., Song, J.J., Kingston, R.E., Borowsky, M., and Lee, J.T. (2010). Genome-wide identification of polycomb-associated RNAs by RIP-seq. Mol Cell 40, 939-953.

Zhao, J., Sun, B.K., Erwin, J.A., Song, J.J., and Lee, J.T. (2008). Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome. Science 322, 750-756.

OTHER EMBODIMENTS

It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.