PREPARATION OF A FUNCTIONAL RAT LDL RECEPTOR MINIGENE BACKGROUND OF THE INVENTION The hepatic low density lipoprotein (LDL) receptor is critical in cholesterol homeostasis since it removes highly atherogenic LDL particles from circulation [1, 2]. The primary determinant of plasma low density lipoprotein (LDL) levels is the hepatic LDL receptor [2-4]. The liver expresses about 70% of the total LDL receptors present in the body so that plasma LDL levels usually vary in correlation with variations in the activity of the hepatic LDL receptor [2]. Mutations in the LDL receptor gene have been identified as the main cause of familial hypercholesterolemia (FH1; MIN # 606945) [5-8]. Heterozygous FH patients usually have low hepatic uptake of LDL, increased plasma LDL concentrations, and premature cardiovascular disease [8]. Although rare to find, homozygous FH patients have extremely low or absent plasma clearance of LDL, substantially raised LDL concentrations, and accelerated development of cardiovascular disease [8]. The 45 kb-long human LDL receptor gene is located on chromosome 19p13.1–13.3 [9]. The promoter of this gene has two TATA-like sequences and three 16- bp direct repeats critical for gene transcription [10]. Repeats 1 and 3 are recognized by the transcription factor Sp1 and are essential for basal transcription levels of the LDL receptor, in the presence or absence of sterols [10, 11]. Repeat 2 contains a sterol regulatory element (SRE) that controls transcription of the LDL receptor in response to cholesterol levels [12]. Other critical transcriptional response elements identified in the promoter of the LDL receptor gene are thyroid hormone response elements, which are responsible for the hypercholesterolemia typically seen in hypothyroid patients [13, 14]. There is about 78% similarity between the human, mouse, and rat LDL receptor genes (http://www.genecards.org/cgi-bin/carddisp.pl?gene=LDLR). The LDL receptor is a mature type 1 transmembrane protein containing 839 amino acids and five functionally distinct domains [15]. The ligand binding domain (determined by exons 2 to 6) is at the N-terminal region and is composed of seven adjacent LDL receptor type-A (LA) repeats [16]. Each LA repeat uses three conserved calcium-binding acidic residues for protein-protein interactions [17]. The second domain is the epidermal growth factor (EGF) precursor domain (determined by exons 7 to 14) [16]. This domain is composed of two EGF repeats (EGF-A and EGF-B), the YWTD region, and a third EGF repeat (EGF-C) [16]. The YWTD region folds into a six-bladed E-propeller, which is involved in the release of lipoprotein particles from the receptor within the endosome [17, 18]. Next is the O-linked glycosylation domain (encoded by exon 15), which is rich in serine and threonine residues that get glycosylated in the Golgi leading to an increase in the molecular weight of the newly synthesized receptor from 120 kDa up to 160 kDa [16, 19]. The following region is the transmembrane domain (encoded by exons 16 & 17) that anchors the receptor to the plasma membrane [16]. The final domain is the 50-residues cytoplasmic tail (encoded by exons 17 &18), which is necessary for receptor localization in clathrin-coated pits and endocytosis [20]. There is a need to understand the regulatory mechanisms that control the hepatic expression of the LDL receptor including identification of transcriptional regulators of this gene. SUMMARY OF THE INVENTION An aspect of the invention is preparation of minigene constructs of LDL receptors. Another aspect of the invention is preparation of minigene constructs of human, mice and rat LDL receptors. Another aspect of the invention is a LDL receptor minigene construct for use in the identification of transcriptional activators of the LDL receptor with potential therapeutic use. Yet another aspect of the invention is preparation of a minigene that can be used to find transcriptional regulators of the LDL receptor without affecting the normal splicing of the minigene. Additional features and advantages of exemplary implementations of the invention will be set forth in the description, figures and claims that follow, and in part will be obvious from the description, figures and claims or may be learned by the practice of such exemplary implementations. BRIEF DESCRIPTION OF THE FIGURES In order to describe the manner in which the above recited and other advantages and features of the invention can be obtained, a more particular description of the invention briefly described will be rendered in the following by reference to the appended drawings. Understanding that these drawings depict only exemplary or typical implementations of the invention and are not therefore to be considered to be limiting of its scope, the invention will be described and explained with additional specificity and detail through the use of the accompanying drawings. Fig. 1. shows a schematic representation of a assembled rat LDL receptor minigene. This LDL receptor minigene contains sections of the promoter, exons 1-3, partial sequences of exon 4, and sufficient intronic (1-3) sequence to allow splicing of the minigene. Essential motifs found in the promoter of the minigene are illustrated. The position of the eight primers P1-P8 used to clone these four main regions of the minigene, as well as the restriction enzyme sites added to each primer to facilitate assembling, are also shown. After assembling, the size of the minigene, including restriction enzyme sites, should be about or 1.588 kb. Fig. 2. shows a sequence of a rat LDL receptor minigene confirmed using sequencing. Primers used for cloning are aligned to the sequence. The regions corresponding to each part of the gene have been labeled. The size of each fragment of the minigene is shown. Fig. 3. shows a schematic structure of the modified (m) pSG5 construct indicating which regions of the original vector are replaced with the assembled rat LDL receptor minigene. Schematics of the linear map of the minigene in mpSG5 and the predicted minigene-specific mRNA that should be produced from the construct are also shown. Fig. 4. shows a DNA electrophoresis showing the cutting of the assembled LDL receptor minigene-pCR 2.1 plasmid and the mpSG5 vector (empty) with Mlu I/EcoR I. The main DNA fragments obtained after the digestion reactions are indicated using arrows. The sizes of the DNA fragments were estimated by comparing to the 1000- bp and 100-bp DNA ladders. Fig. 5. shows a restriction enzyme map of the assembled-minigene- mpSG5 construct. The construct was digested with different combinations of restriction enzymes to release specific regions of the minigene. The sizes of the resulting DNA fragments after digestion and electrophoresis were determined by comparing to the 1000- bp and 100-bp ladders. Fig. 6. shows testing of the minigene using standard PCR. A schematic representation of the position of the primers used in the PCR relative to the minigene map is shown. A typical DNA electrophoresis of the PCR reactions performed with the empty mpSG5 vector and the minigene-mpSG5 construct is illustrated. The primers used in each reaction and the expected sizes of the products are indicated. Fig. 7. shows testing of four minigene-mpSG5 constructs using restriction enzyme analysis. The wild-type (WT) and three mutated versions (-612, -156, and Db) of the minigene-mpSG5 were employed in this test. The mutated constructs were prepared using site-directed mutagenesis as described below. Three different restriction enzyme reactions were used to test each construct. The restriction enzymes used are indicated. A typical DNA electrophoresis is shown. Fig. 8. Shows testing of four minigene constructs using standard PCR. A schematic representation of the position of the primers used in the PCR relative to the minigene map, as well as the expected size of the amplified product, are shown. The same constructs (WT and three mutants) described in Fig. 7 were used here. A typical DNA electrophoresis of the PCR reactions is depicted. Fig. 9. shows DNA electrophoresis illustrating the bands amplified by qRT-PCR using new sense primer (4) and new antisense primer (5) and the four minigene constructs. RNA and ssDNA preparation and analysis using qRT-PCR were done using the methods described in the text. An aliquot of the resulting reactions was used in the electrophoresis. A schematic representation of the position of the primers used in the qRT-PCR relative to the minigene map, as well as the expected size of the amplified product, are shown. Fig. 10. shows calculations for the qRT-PCR described in Fig. 9 performed employing the comparative Ct method and the data obtained with primers specific for 18s rRNA. Representative data are shown for n=3 per construct. The graph shows relative minigene mRNA levels. Fig. 11. shows predicted mRNA and protein sequences of the rat LDL receptor minigene construct. The first (ATG; provided by the minigene) and stop codons (provided by the mpSG5 vector) are highlighted in grey. The first amino acid after the cleavage of the signal peptide for the truncated protein is underlined. Rectangles indicate the exon junctions. The italic, uppercase sequence corresponds to the SV40 poly A region provided by the mpSG5 vector. DETAILED DESCRIPTION OF THE INVENTION Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The contents of the references cited herein are incorporated by reference as if fully disclosed herein. As used herein, unless otherwise expressly specified, all numbers such as those expressing values, ranges, amounts or percentages may be read as if prefaced by the word "about", even if the term does not expressly appear. The term "about" will be understood by persons of ordinary skill in the art and will vary to some extent on the context in which it is used. In addition, any numerical range recited herein is intended to include all sub-ranges subsumed therein. Singular encompasses plural and vice versa. When ranges are given, any endpoints of those ranges and/or numbers within those ranges can be included. The use of “or” means “and/or” unless stated specifically otherwise. The articles "a" and "an" are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element. The term "antisense" refers particularly to the nucleic acid sequence of the non-coding strand of a double stranded DNA molecule encoding a protein, or to a sequence which is substantially homologous to the non-coding strand. An antisense sequence is complementary to the sequence of a double stranded DNA molecule encoding a protein. It is not necessary that the antisense sequence be complementary solely to the coding portion of the coding strand of the DNA molecule. The term "complementary" as used herein refers to the broad concept of subunit sequence complementarity between two nucleic acids, e.g., two DNA molecules. When a nucleotide position in both of the molecules is occupied by nucleotides normally capable of base pairing with each other, then the nucleic acids are considered to be complementary to each other at this position. Thus, two nucleic acids are substantially complementary to each other when at least about 50%, preferably at least about 60% and more preferably at least about 80% of corresponding positions in each of the molecules are occupied by nucleotides which normally base pair with each other (e.g., A:T and G:C nucleotide pairs). The term “comprising” and forms of the word “comprising,” as used in the specification and claims does not limit the present invention to exclude any variants or additions. Additionally, although the present invention has been described in terms of “comprising,” the invention may also be described as “consisting essentially of” or “consisting of.” The term “expression” as used herein is defined as the transcription and/or translation of a particular nucleotide sequence. The term "fragment" refers to a portion of an amino acid or nucleotide sequence comprising a specified number of contiguous amino acid or nucleotide residues. Fragments of a polynucleotide may encode protein fragments that retain the biological activity of the protein and hence are immunogenic. Alternatively, fragments of a polynucleotide that are useful as PCR primers generally do not encode protein fragments that retain biological activity. Active variants and fragments of the disclosed polynucleotides and polypeptides are also described herein. "Variants" refer to substantially similar sequences. As used herein, a "variant polypeptide" refers to a polypeptide derived from the native protein by a modification of one or more amino acid residues at any position of the native protein. The modification may include a deletion (so-called truncation) of one or more amino acid residues at the N-terminal and/or C-terminal end of the native protein, deletion and/or addition of one or more amino acid residues at one or more internal sites in the native protein, or a substitution of one or more amino acid residues at one or more sites in the native protein. Variant polypeptides continue to possess the desired biological activity of the native polypeptide, that is, they are immunogenic. A variant of a polypeptide or polynucleotide sequence disclosed herein will typically have at least about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity with the reference sequence. As used herein, the term “promoter/regulatory sequence” means a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter/regulatory sequence. Conventional notation is used herein to describe polynucleotide sequences: the left-hand end of a single stranded polynucleotide sequence is the 5’ end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5’ direction. A minigene with restriction enzyme sites is shown in Fig 1. The minigene is shown as four fragments. The first fragment of 816 base pairs (SEQ ID NO:1) comprises 546 base pairs of promoter, 217 bases pairs of cDNA and 53 base pairs of intron #1. The second fragment of 223 base pairs (SEQ ID NO:5) comprises 47 base pairs of intron #1, 127 base pairs of cDNA and 49 base pairs of intron #2. The third fragment of 224 base pairs (SEQ ID NO:9) comprises 52 base pairs of intron #2, 123 base pairs of cDNA and 49 base pairs of intron #3. The fourth fragment of 293 base pairs (SEQ ID NO:13) comprises 51 base pairs of intron #3, and 242 base pairs of cDNA. In Fig. 2, the first fragment is shown as 830 bp including the restriction enzyme overhangs; the second fragment is shown as 237 bp including restriction enzyme overhangs; fragment 3 is shown as 236 bp including restriction enzyme overhangs and fragment 4 is shown as 305 bp including restriction enyzyme overhangs. These are SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:10 and SEQ ID NO:14 respectively. Eight primers (P1-P8) were designed (including specific restriction enzymes at the 5’-end of each primer), synthesized, and employed in PCR reactions using whole rat genomic DNA as the template. The genomic sequence used to design the primers was obtained from GenBank (chromosome 8, location 8q13, Gene ID # 300438, Source RGD: 2998) and Biochem. Biophys. Acta 1761 (2006) 492-500 [14] the contents of which are incorporated by reference. Fig. 1 shows the positions of the primers, P1-P8, in each section of the minigene. The restriction sites are also shown. The primer sequences (also shown in Fig. 2) are as follow: P1: 5’-ACGCGT ( Q ); (SEQ ID NO:16). The position of the different introns was obtained by aligning the genomic sequence from GenBank with the rat LDL receptor cDNA sequence [21]. About 50 bp on each end of the intronic regions was cloned since it has been predicted that all the intronic regulatory regions are located within the first 48 nucleotides upstream of the 5’-splice site [22]. The conditions of the PCR reactions are described below. All four genomic regions (830 bp, 237 bp, 236 bp, and 305 bp, respectively, see Fig. 2), labeled fragments #1 through #4, were successfully amplified. Resulting PCR fragments were individually cloned into the pCR2.1 TA cloning vector (Invitrogen), and their sequences were confirmed in both directions. The sequencing results are shown in Fig. 2. The minigene was first assembled into the pCR2.1 TA cloning vector using restriction enzymes Mlu I/Not I for the 830 bp fragment; Not I/EcoR V for the 237 bp fragment; EcoR V/Xho I for the 236 bp fragment; and Xho I/EcoR I for the 305 bp fragment. The order in which the fragments were combined to assemble the minigene is described below. The assembled-minigene was then subcloned into a modified (m) pSG5 (mpSG5) vector using the restriction enzymes Mlu I/EcoR I, which cuts around the assembled minigene in the pCR2.1 TA vector. The original (unmodified) pSG5 vector is a eukaryotic expression vector characterized by having the SV40 early promoter and SV40 polyadenylation signal to promote expression in vivo, the T7 bacteriophage promoter to facilitate in vitro transcription of cloned inserts, and the β-globin intron II to allow splicing of expressed transcripts. Specific details about the assembling of the minigene in pCR2.1 and the modification of the pSG5 vector are discussed below. Since our interest was to prepare a minigene that could be used to find transcriptional regulators of the rat LDL receptor without affecting the normal splicing of the minigene, the pSG5 vector region containing the SV40 early promoter, the β-globin intron II, and the T7 bacteriophage promoter were replaced with the assembled rat LDL receptor minigene. Only the SV40 polyadenylation signal remained in the vector after the insertion of the assembled minigene. These changes in the mpSG5 vector did not affect the vector’s ability to replicate into bacterial cells (data not shown). To perform this substitution, the original vector was modified to include a Mlu I restriction enzyme site upstream of the SV40 promoter using site-directed mutagenesis. This modification of the pSG5 vector was done before subcloning the assembled minigene into this vector. The insertion of the Mlu I site into the pSG5 vector was confirmed using restriction enzyme analysis. Fig. 3 shows the parts of the pSG5 vector (the SV40 early promoter, the β-globin intron II, and the T7 bacteriophage promoter) replaced by the assembled rat LDL receptor minigene. The promoter to control the expression of the rat LDL receptor minigene was provided by the minigene itself. The empty mpSG5 vector, which is the mpSG5 vector before the insertion of the assembled rat LDL receptor minigene, was used as the negative control in the confirmation experiments reported below. Restriction enzyme analysis was conducted next. Fig. 4 shows the cutting of the LDL receptor minigene-pCR 2.1 plasmid and the empty mpSG5 vector using Mlu I/EcoR I. The size of the minigene fragment was about 1.6 kb, whereas the size of the DNA fragment cut out from the mpSG5 vector (later replaced with the minigene) was about 1.2 kb. The 1.6 kb assembled minigene insert was subsequently ligated to mpSG5 vector (about 3 kb) using T4 DNA ligase. The size of the assembled-minigene-mpSG5 construct after cloning was 4.6 kb. Fig. 5 shows a restriction enzyme map of the minigene-mpSG5 construct. As shown, digesting with Mlu I alone linearized the plasmid that had a size of 4.6 kb. Digesting with Mlu I/Not I released fragment #1 from the construct resulting in two DNA fragments of 3.75 kb (vector-fragments #2-#4) and 850 bp (fragment #1), respectively. Digesting with Mlu I/EcoR V released fragments #1-#2 from the construct resulting in two DNA fragments of about 3.5 kb (vector-fragments #3-#4) and 1.1 kb (fragments #1- #2), respectively. Digesting with Mlu I/Xho I released fragments #1-#3 from the construct, but it also cut this genomic region at about 400 bp from the 5’-end (see Fig. 2 for information about this restriction enzyme site). This resulted in three DNA fragments of about 3.3 kb (vector-fragment #4), 400 bp (corresponding to the beginning of fragment #1), and 920 bp (the remaining of fragment #1-#2-#3), respectively. Digesting with Mlu I/EcoR I released the assembled minigene from the vector resulting in two DNA fragments of about 3 kb (empty vector) and 1.6 kb (assembled minigene), respectively. TESTING OF THE MINIGENE CONSTRUCT USING STANDARD PCR The minigene-mpSG5 construct was also tested using a combination of primers in standard PCR. The position of the primers in the minigene-mpSG5 construct are shown in Fig. 6. The sequences of these primers are: ’ 3’ (SEQ ID NO:20) for sequencing primer (1); 5’- TGAGCACCGCGGATCTGATG 3’ (SEQ ID NO:21) for sense primer (2); and 5’- ’ (SEQ ID NO:22) for antisense primer (3). The sequencing primer (1) and antisense primer (3) are specific for the mpSG5 regions around the minigene. The sense primer (2) was specific for the rat LDL receptor cDNA sequence included in fragment #1 of the minigene. These primers are different from the eight primers used in amplifying the LDL receptor genomic regions employed in the assembling of the minigene described above. The expected sizes of the DNA regions that are amplified using each primer set, according to the genomic sequences of the mpSG5 vector and the minigene-mpSG5 construct, are also shown in Fig. 6. As shown, using the sequencing primer (1) and antisense primer (3), the expected sizes of 1.2 and 1.73 kb for the empty mpSG5 vector (still containing the region later replaced by the assembled minigene) and the minigene-mpSG5 construct, respectively, were obtained. Amplifying using the sense primer (2) and antisense primer (3) resulted in a DNA fragment of about 930 bp which was the expected fragment size when using the minigene-mpSG5 construct as the template for the PCR reaction. Mutated versions of the rat LDL receptor minigene-mpSG5 construct were prepared. For this, site-directed mutagenesis was employed as described below. The mutations inserted have been previously shown to affect the thyroid hormone regulation of the rat LDL receptor gene [13, 14, 23]. The presence of these mutations within the LDL receptor promoter in the minigene was confirmed using sequencing. This process resulted in four minigene-mpSG5 constructs: wild-type (WT, no modifications), -612 mutant, -156 mutant, and double (Db) mutant (including both -612 and -156 mutations). Additional tests were performed on the four constructs including restriction enzyme analysis, and standard PCR analysis. The results of the restriction enzyme analysis are shown in Fig. 7. For this test, constructs were digested with Mlu I, Mlu I & Xho I, or Mlu I & EcoR I. As expected, no changes in the restriction enzyme map of these constructs occurred as a result of the different mutations. Fig. 8, illustrates that when standard PCR was performed using sequencing primer (1) (SEQ ID NO:20) and new antisense primer (5), 5 CC GC GC-3’ (SEQ ID NO:23) the sizes of the PCR products produced from the four minigene constructs (WT and the three mutants) were the same. To test the functionality of the four minigene constructs (WT and the three mutants), transfection studies were carried out in human hepatocyte-like C3A cells. RNA samples prepared from cells transfected with the different constructs were utilized in the synthesis of ssDNA samples for qRT-PCR analysis as described below. The primers used in these studies were new sense primer (4), 5 , (SEQ ID NO:24) and new antisense primer (5) (SEQ ID NO:23). After qRT-PCR, an aliquot of the PCR reaction was run on a DNA gel. Fig. 9 shows that the minigene vectors (WT and mutant) spliced correctly since the amplified fragments had the expected size of about 300 bp. Since a single product was amplified in the qRT-PCR, quantitation of the results were performed using the comparative CT method as described in Niesen, M., M. Bedi, and D. Lopez, Diabetes alters LDL receptor and PCSK9 expression in rat liver. Arch Biochem Biophys, 2008.470(2): p. 111-5 (24). As shown in Fig. 10, there was no significant differences (p=0.703; n=3) in the basal levels of mRNA produced from the four constructs. Based on the analysis of the mRNA sequence produced from the WT minigene-mpSG5 construct (868+ bp; (SEQ ID NO:27) see Fig. 11), it appears that this minigene encodes for an extracellular secreted protein of 18.7 kDa corresponding to the N-terminal region (not including the signal peptide) of the rat LDL receptor protein. Fig. 11 illustrates the messenger RNA and protein sequences of the WT rat LDL receptor minigene construct. See SEQ ID NO:29. The first codon (ATG); highlighted in gray is provided by the minigene sequence. The first amino acid after the cleavage of the signal peptide is underlined. The mpSG5 vector provides the stop codon (also highlighted in gray). The coding sequences enclosed in rectangles corresponds to the exon junctions. The italic, uppercase sequence corresponds to the SV40 poly A region given by the mpSG5 vector. This is the first minigene that has been reported for the LDL receptor of humans, mice, and rats. This minigene is not only functional, producing mRNA after splicing, but it also has the potential to secrete a truncated version of LDL receptor protein. This can permit adding fluorescent signals, markers or compounds to the minigene-derived protein that could be used for quicker detection methods. The minigene could be used to identify compounds, small molecules, natural products, and regulators of the LDL receptor gene that could be developed into LDL receptor-specific activators or inhibitors for therapeutic use. Each of the characteristics and examples described above, and combinations thereof, may be said to be encompassed by the present invention. The present invention is thus drawn to the following non-limiting aspects: Aspect 1. An isolated nucleotide sequence encoding a LDL receptor minigene. Aspect 2. The isolated nucleotide sequence according to aspect 1, wherein the LDL receptor minigene is a rat, mouse or human minigene. Aspect 3. The isolated nucleotide sequence according to any of aspects 1 or 2, wherein the LDL receptor minigene is a rat LDL receptor minigene. Aspect 4. The isolated nucleotide sequence according to any of aspects 1 to 3, wherein the nucleotide sequence comprises SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:9 and SEQ ID NO:13. Aspect 5. The isolated nucleotide sequence according to any of aspects 1 to 3, wherein the nucleotide sequence comprises SEQ ID NO:2 , SEQ ID NO:6 SEQ ID NO:10 and SEQ ID NO:14. Aspect 6. An isolated nucleotide sequence comprising one of SEQ ID NO:1 or SEQ ID NO:2; one of SEQ ID NO:5 or SEQ ID NO:6; one of SEQ ID NO:9 or SEQ ID NO:10 and one of SEQ ID NO:13 or SEQ ID NO:14. Aspect 7. An isolated nucleotide sequence comprising a LDL receptor minigene comprising SEQ ID NO:1, SEQ ID NO:5, SEQ ID NO:9 and SEQ ID NO:13. Aspect 8. An isolated nucleotide sequence comprising a LDL receptor minigene comprising SEQ ID NO:2 , SEQ ID NO:6 SEQ ID NO:10 and SEQ ID NO:14. Aspect 9. An isolated nucleotide sequence comprising a LDL receptor minigene comprising one of SEQ ID NO:1 or SEQ ID NO:2; one of SEQ ID NO:5 or SEQ ID NO:6; one of SEQ ID NO:9 or SEQ ID NO:10 and one of SEQ ID NO:13 or SEQ ID NO:14. Aspect 10. An isolated nucleotide sequence comprising a LDL receptor minigene encoding a protein comprising SEQ ID NO:29. Aspect 11. An isolated nucleotide sequence comprising a LDL receptor minigene encoding a protein as shown in Figure 11. Aspect 12. A minigene that incorporates part or all of a polynucleotide encoding a LDL receptor protein. Aspect 13. The minigene according to aspect 12 wherein the LDL receptor protein is a rat, mouse or human LDL receptor protein. Aspect 14. The minigene according to aspect 12 or 13 wherein the LDL receptor protein is a rat LDL receptor protein. Aspect 15. A LDL receptor minigene comprising SEQ ID NO: 1, SEQ ID NO:4, SEQ ID NO:7 and SEQ ID NO:10. Aspect 16. A LDL receptor minigene comprising SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:10 and SEQ ID NO:14. Aspect 17. A LDL receptor minigene comprising one of SEQ ID NO:1 or SEQ ID NO:2; one of SEQ ID NO:5 or SEQ ID NO:6; one of SEQ ID NO:9 or SEQ ID NO:10 and one of SEQ ID NO:13 or SEQ ID NO:14. Aspect 18. A LDL receptor minigene encoding a truncated version of LDL receptor protein. Aspect 19. A LDL receptor minigene encoding a LDL receptor protein wherein the protein comprises SEQ ID NO:29. Aspect 20. A LDL receptor minigene encoding a messenger RNA sequence as shown in Figure 11. Aspect 21. A LDL receptor minigene encoding a messenger RNA sequence of SEQ ID NO:27. Aspect 22. An isolated nucleotide sequence comprising a LDL receptor minigene encoding a LDL receptor protein for identifying a LDL receptor activator. Aspect 23. A vector comprising a nucleic acid sequence encoding a minigene for a LDL receptor. Aspect 24. The vector according to aspect 23 which is a mpSG5 vector encoding a LDL receptor minigene. Aspect 25. The vector according at any of aspects 23 or 24 wherein the minigene encodes a LDL receptor protein wherein the protein comprises SEQ ID NO:29. Aspect 26. The vector according to any of aspects 23 to 25 wherein the minigene encodes a messenger RNA sequence of SEQ ID NO:27. Aspect 27. The vector according to any of aspects 23 to 25 wherein the minigene encodes a messenger RNA sequence as shown in Figure 11. Aspect 28. A vector comprising the isolated nucleotide of any one of aspects 1 to 11. Aspect 29. A method for preparing a vector comprising a) assembling a minigene comprising genomic fragments of one of SEQ ID NO:1 or SEQ ID NO:2; one of SEQ ID NO:5 or SEQ ID NO:6; one of SEQ ID NO:9 or SEQ ID NO:10 and one of SEQ ID NO:13 or SEQ ID NO:14 into a cloning vector, and b) subcloning the minigene into a modified (m) pSG5 (mpSG5) vector by replacing the SV40 early promoter, the β- globin intron II, and the T7 bacteriophage promoter of the mpSG5 with the LDL receptor minigene. The following examples are intended to illustrate the invention, and should be construed as limiting the invention in any way. EXAMPLES Materials and Methods Materials - The whole rat genomic DNA used as template in PCR reactions was obtained from BD Biosciences (San Jose, CA). Primers and oligonucleotides were synthesized by Eurofins Genomics (Huntsville, AL). Invitrogen ThermoFisher Scientific (Carlsbad, CA) was the source of Taq DNA polymerase, dNTPs (blended deoxynucleotide triphosphates), the pCR 2.1 TA cloning vector, the One Shot® INVF' Chemically Competent bacterial cells, the T4 DNA ligase kit, 2 × PCR Master Mix, low glucose (5.55 mM) Dulbecco’s modified Eagle’s medium (LG-DMEM), standard fetal bovine serum (FBS), antibiotics (penicillin/streptomycin solution), the AB reverse transcriptase system, and AB SYBR Green PCR Master Mix were from Invitrogen ThermoFisher Scientific (Carlsbad, CA). The 1-kb and 100-bp DNA ladders, all the restriction enzymes, the FuGENE® 6 Transfection Reagent, and the DNA removal kit were purchased from Promega (Madison, WI). The GenElute extraction kit was from Sigma-Aldrich (St. Louis, MO). The Qiagen plasmid prep kit was obtained from Qiagen (Germantown, MD). The original (unmodified) pSG5 vector was purchased from Stratagene (La Jolla, CA). The QuickChange Site-Directed Mutagenesis Kit was obtained from Agilent (Santa Clara, CA). American Type Culture Collection (Manassas, VA) supplied the human hepatocyte-like C3A cell line. The Molecular Research Center (Cincinnati, OH) was the source of TRI Reagent. Other chemicals not mentioned in this section were from Fisher Scientific (Pittsburgh, PA). PCR Amplification of the Minigene Fragments - PCR reactions to amplify the individual genomic fragments for the rat LDL receptor minigene were set as follows: 10 PL of whole rat genomic DNA (stock concentration = 0.1 Pg/PL), 0.5 Pl of Taq DNA polymerase (stock concentration = 1 units/PL), 5 PL of 10 × Buffer included with the Taq DNA polymerase, 1 PL of dNTPs (blended deoxynucleotide triphosphates) (stock concentration = 100 mM), 2 PL of primer mix (stock concentration = 0.1 Pg/PL), and 31.5 PL of nuclease-free water. Primer mixtures were prepared in nuclease free water. The total volume of each PCR reaction was 50 PL. Each primer mix was designed to be specific for a genomic fragment. To clone genomic fragment #1 (830 bp) (SEQ ID NO:2), primers P1 and P2 were mixed. To clone genomic fragment #2 (237 bp) (SEQ ID NO:6), primers P3 and P4 were mixed. To clone genomic fragment #3 (236 bp) (SEQ ID NO:10), primers P5 and P6 were mixed. To clone genomic fragment #4 (305 bp) (SEQ ID NO:14), primers P7 and P8 were mixed. These primers (P1-P8) were designed to include restriction enzymes at their 5’-end to facilitate their assembling into the minigene. Fig. 1 shows the positions of these primers in each section of the minigene. The primer sequences are shown above, in Fig. 2 and in the accompanying sequence listing. The restriction enzyme sites were Mlu I in P1; Not I in P2 and P3; EcoR V in P4 and 5; Xho I in P6 and P7; and EcoR I in P8. PCR amplifications were carried out using an Eppendorf thermal cycler (Eppendorf AG, Hamburg Germany) with the following parameters: 1 cycle at 95 ^o C for 1 minute, followed by 35 cycles of denaturation at 95°C for 1 min, annealing at 60°C for 1 min, and extension at 72°C for 2 min. To confirm the presence of a single DNA fragment in each PCR reaction after amplification, DNA electrophoresis was performed. For this, a 1% agarose (genetic technology grade; w/v) gel was prepared in 1× TAE buffer supplemented with 0.5 μg/mL of ethidium bromide. Samples and either 1 kb or 100 bp DNA ladder were prepared for electrophoresis in 1× loading dye (Promega). Electrophoresis was carried out in an Owl separation system using 1× TAE buffer for 50 minutes at 100 volts. Electrophoresed DNA samples were visualized using the Kodak Image Station 4000R Pro Imaging System and the Kodak Molecular Imaging software (New Haven, CT). The sizes of the amplified DNA fragments were estimated by comparing to a 100-bp DNA ladder. PCR products of the correct size were eluted from the DNA gel using the GenElute extraction kit [25] and cloned into the pCR 2.1 TA cloning vector (Invitrogen) [26] according to the manufacturers’ protocols. Vectors containing the genomic fragments were transformed into competent bacterial cells (One Shot® INVF' Chemically Competent E. coli, Invitrogen) according to the protocol provided by the company [26]. Plasmid preparation was performed using a Qiagen plasmid prep kit [27]. Vectors containing the genomic fragments were sequenced by Eurofins Genomics, Louisville, KY to confirm the presence of the expected genomic fragments. Plasmids containing the expected genomic regions were used in follow-up studies. Site-Directed Mutagenesis – This technique was used to prepare the modified (m) pSG5 (mpSG5) vector and the mutated versions of the rat LDL receptor minigene in mpSG5 vector. The protocol was performed using the QuickChange Site- Directed Mutagenesis kit [14, 30]. Oligonucleotides used to insert the Mlu I site into the pSG5 vector, so the site can be used to clone in the assembled rat LDL receptor minigene, were (SEQ ID NO:17) and its complement. Oligonucleotides used for site-directed mutagenesis of the LDL receptor to mutate the LDL receptor promoter within the assembled-minigene were (SEQ ID NO:18); and its complement for the motif at -156 (-156 mutant), and 5′- (SEQ ID NO:19); and its complement for the motif at -612 (-612 mutant). The nucleotides that are underlined correspond to the modified/mutated bases that were introduced. After PCR amplification, the original DNA templates were digested with Dpn I and transformation of the modified/mutated newly synthesized DNAs into competent cells according to the manufacturer’s instructions. [30] Plasmid preparation was done using the Qiagen protocol as described above. The modification in the mpSG5 vector was confirmed using restriction enzyme analysis. Mutations in the rat LDL receptor minigene were confirmed by sequencing also described above. Assembling of the Rat LDL Receptor Minigene- The restriction enzymes were purchased from Promega. Restriction enzyme reactions were performed using 1 PL of DNA sample (stock concentrations = 0.1-1 Pg/PL), 19 PL of nuclease-free water, 2.5 PL of 10 × Buffer (according to the enzyme mixture used in each reaction) [28], and 2.5 PL of enzyme mixture (one or two enzymes, depending on the reaction). Reactions were incubated at 37 ^o C for 30 minutes to allow digestion of the DNA samples. The resulting digested products were analyzed by DNA electrophoresis as described in the previous section using 1% agarose gels and 1× TAE buffer supplemented with 0.5 μg/mL of ethidium bromide. Again, samples prepared 1× loading dye were run along with either 1 kb or 100 bp DNA ladder. After imaging, if applicable, inserts, fragments and/or vectors required for ligation reactions were eluted from the DNA gels using the GenElute extraction kit and used in subcloning as described below. Ligations were performed overnight using T4 DNA ligase. The pCR 2.1 vector containing fragment #3 was digested with Xho I/Xba I to linearize the vector. The vector containing fragment #4; was digested with Xho I/Spe I to cut out the insert (fragment #4). The linearized vector containing fragment #3 and the fragment #4 insert were isolated from the gel using the GenElute extraction kit and then ligated using the T4 ligase system (stock concentration of the enzyme = 1 unit/PL) according to the instructions from Invitrogen [30]. The ligated samples were transformed into OneShot competent cells as described above. Colonies were grown using the Qiagen plasmid prep kit, and tested for the inclusion of the two fragments using restriction enzyme analysis. The resulting vector containing fragments #3-#4 was digested with EcoR V/Spe I to linearize the vector. The plasmid containing fragment #2 was also digested with EcoR V & Spe I to cut out the insert (fragment #2). The linearized vector containing fragments #3-#4 and the fragment #2 insert were isolated from the gel using the GenElute extraction kit and ligated using the T4 DNA ligase. After ligation and transformation into competent bacterial cells, colonies were grown, and plasmids prepared using the Qiagen plasmid prep kit, and tested for the inclusion of the three fragments using different restriction enzymes. The resulting vector containing fragments #2, #3 and #4, was digested with Not I & Spe I to linearize the vector. The plasmid containing fragment #1 was also digested with Not I & Spe I to cut the insert (fragment #1) out. The linearized vector containing fragments #2, # 3 and #4 and the fragment #1 insert were isolated from the gel using the GenElute extraction kit and ligated using T4 DNA ligase. Again, after ligation and transformation into competent bacterial cells, colonies were grown, and plasmids prepared using the Qiagen plasmid prep kit and were tested for the inclusion of all four fragments. The resulting vector contained the assembled-minigene, which was next inserted into the mpSG5 vector. Subcloning the Assembled Minigene into the mpSG5 Vector-The assembled-minigene-pCR 2.1 plasmid and the mpSG5 vector prepared by site-directed mutagenesis were digested with Mlu I/EcoR I to cut out the assembled-minigene insert. The mpSG5 vector was also digested with Mlu I/EcoR I to cut out of the original mpSG5 vector region to be replaced by the minigene. The digested mpSG5 vector and the assembled-minigene insert were isolated from the gel using the GenElute extraction kit and ligated using T4 DNA ligase. After ligation and transformation into OneShot competent bacterial cells, colonies were grown and tested for the inclusion of the assembled-minigene using different restriction enzymes. The rat LDL receptor minigene rat LDL receptor minigene-mpSG5 construct was used in various tests, including restriction enzyme analysis, and in site-directed mutagenesis to prepare minigene mutants as described above. Testing of the Minigene Constructs using Standard PCR - PCR reactions used to test the amplification of sections of the assembled-minigene-mpSG5 construct were as follows: 5 PL of template (minigene-mpSG5 constructs or empty mpSG5 plasmid; stock concentration = 2 ng/PL), 25 Pl of 2 × PCR Master Mix (Thermo Fisher) [31], 2 PL each of each primer (stock concentration = 0.05 Pg/PL), and 16 PL of nuclease-free water. The empty mpSG5 vector (negative control) and the minigene- mpSG5 construct were tested in reactions with the sequencing primer (1) and antisense primer (3). The minigene-mpSG5 construct was also tested in a reaction with the sense primer (2) and antisense primer (3). The minigene-mpSG5 construct along with three mutants were tested in reactions including sequencing primer (1) and new antisense primer (5). The sequences of these primers are ’ ’ (SEQ ID NO:20) for sequencing primer (1); 5 (SEQ ID NO:21) for sense primer (2); 5’- GTAACCATTATAAGCTGC 3’ (SEQ ID NO:22) for antisense primer (3); and 5’- 3’ (SEQ ID NO:23) for new antisense primer (5). The sequencing primer (1) and antisense primer (3) were specific for the mpSG5 regions around the assembled minigene. The sense primer (2) was specific for the rat LDL receptor cDNA sequence within fragment #1. The new antisense primer (5) was designed to the region of the mpSG5 vector that was transcribed as part of the minigene mRNA sequence. PCR amplifications were done using an Eppendorf thermal cycler with the following parameters: 1 cycle at 95 ^o C for 2 minutes, followed by 40 cycles of denaturation at 95°C for 1 min, annealing at 55°C for 1 min, and extension at 72°C for 2 min. To confirm the presence of a single DNA fragment after amplification, DNA electrophoresis was performed. The sizes of the amplified fragments were estimated by comparing to the DNA ladder. Transfections into Human Hepatocyte-like C3A Cells - Human C3A cells were obtained from American Type Culture Collection (Manassas, VA) and cultured in low-glucose Dulbecco’s Modified Eagle’s Medium + supplemented with 10% fetal bovine serum (FBS) and antibiotics, at 37°C, with humidified atmosphere and 5% CO ₂ . For experiments, cells were plated in 12-well plates, and 24 hrs later, they were transfected with the rat LDL receptor minigene-mpSG5 constructs, 1 μg DNA per well, using the FuGENE® 6 transfection reagent protocol [13, 32]. Briefly, each plasmid to be transfected was incubated with FuGENE® 6 (3:1; transfection reagent:DNA) in 100 μL of medium for 20 min. The DNA– FuGENE® 6 complexes were then added to the cells containing fresh medium. Cells were incubated for 48 hours at 37 °C before they were used in the preparation of RNA. RNA Preparation and Quantitative Real-time PCR (qRT-PCR) – The isolation of RNA samples was performed using the TRI reagent method as previously described [24]. The concentrations and purity of the RNA samples were determined using a Nanodrop 2000 (Wilmington, DE). RNA electrophoresis was done to confirm the integrity of the RNA (data not shown). DNAse I treatment (Turbo DNA-free kit) of the RNA samples [33] and preparation of ssDNA by reverse transcription with the AB Reverse transcriptase system and random primers [34] were done. The qRT-PCR reactions were performed with 100 ng of ssDNA, the Applied Biosystems SYBR Green PCR Master Mix, and the AB real-time PCR system (Applied Biosystems; Foster City, CA [35], with the following parameters: denaturation at 95 ^o C for 10 minutes, and then 45 cycles of denaturation at 95 ^o C for 30 seconds, annealing at 60 ^o C for 15 seconds, extension at 72°C for 30 seconds, and photo documentation at 80°C for 15 seconds. A melt curve was proceeded to determine if each primer set was amplifying as a single band. The minigene-specific primers for qRT-PCR were new sense primer (4) and new antisense primer (5). The new sense primer (4) was designed to overlap the junction between exons 3 and 4 within the rat LDL receptor minigene. The sequence for the new sense primer (4) is ’ ’ (SEQ ID NO:24). The new sense primer (4) could be used in qRT-PCR only since splicing of the minigene was required before it could anneal to the sequence. The new antisense primer (5) was designed as described in the standard PCR section and could be used in both standard and qRT-PCR. The primers 5 ’ GGGACAAGTGGCGTTCAG 3’ (SEQ ID NO:25) and 5’- 3’ (SEQ ID NO:26) to detect human 18s rRNA were used as internal control for the RNA preparation and the calculations. The 18s rRNA specific primers were obtained from SA Biosciences (Frederick, MD). The sizes of the amplified PCR fragments were 300 bp for the minigene and 100 bp for 18s rRNA. The Comparative CT method was used for quantitation as previously reported [24]. Data from at least three independent measurements (n = 3) per construct were compared employing analysis of variance (ANOVA) followed by Dunnett’s multiple comparison tests. The significance level was set at α = 0.05. All the calculations and graphing were done using the GraphPad Prism 7 software (GraphPad Software, Inc., La Jolla, CA). Some aliquots of the qRT-PCR reactions were also analyzed using DNA electrophoresis, and the sizes of the DNA fragments were estimated by comparing to a 100-bp DNA ladder. The minigene-specific primers for qRT-PCR, new sense primer (4) and new antisense primer (5), were described above. The sizes of PCR fragments that were amplified were 300 and 100 bp, respectively. The qRT-PCR parameters were: denaturation at 95 ^o C for 10 minutes, followed by 45 cycles of denaturation at 95 ^o C for 30 seconds, annealing at 60 ^o C for 15 seconds, and extension at 72 ^o C for 30 seconds. The Comparative CT method was used for quantitation as previously done [36]. Some aliquots of the qRT-PCR reactions were analyzed using DNA electrophoresis, and the sizes of the DNA fragments were determined by comparing to a 100 bp DNA ladder.

References: 1. Brown BG. Contemporary Insights. Cholesterol metabolism and its regulation. 2003. 2. Bilheimer DW et al., Liver transplantation to provide LDL receptors and lower plasma cholesterol in a child with homozygous familial hypercholesterolemia. N Engl J Med 311:1658-1664, 1984. 3. Ramasamy, I., Update on the molecular biology of dyslipidemias. Clin Chim Acta, 2016. 454: p. 143-85. 4. Braenne, I., et al., Systematic analysis of variants related to familial hypercholesterolemia in families with premature myocardial infarction. Eur J Hum Genet, 2016. 24(2): p. 191-7. 5. Fernandez-Higuero, J.A., et al., Structural analysis of APOB variants, p.(Arg3527Gln), p.(Arg1164Thr) and p.(Gln4494del), causing Familial Hypercholesterolaemia provides novel insights into variant pathogenicity. Sci Rep, 2015. 5: p. 18184. 6. Gu, H.M. and D.W. Zhang, Hypercholesterolemia, low density lipoprotein receptor and proprotein convertase subtilisin/kexin-type 9. J Biomed Res, 2015. 29(5): p. 356-61. 7. Di Taranto, M.D., M.N. D'Agostino, and G. Fortunato, Functional characterization of mutant genes associated with autosomal dominant familial hypercholesterolemia: integration and evolution of genetic diagnosis. Nutr Metab Cardiovasc Dis, 2015. 25(11): p. 979-87. 8. Sjouke, B., et al., Homozygous autosomal dominant hypercholesterolaemia: prevalence, diagnosis, and current and future treatment perspectives. Curr Opin Lipidol, 2015. 26(3): p. 200-9. 9. Francke, U., M.S. Brown, and J.L. Goldstein, Assignment of the human gene for the low density lipoprotein receptor to chromosome 19: synteny of a receptor, a ligand, and a genetic disease. Proc Natl Acad Sci U S A, 1984. 81(9): p. 2826-30. 10. Sudhof, T.C., et al., Three direct repeats and a TATA-like sequence are required for regulated expression of the human low density lipoprotein receptor gene. J Biol Chem, 1987.262(22): p. 10773-9. 11. Chang, R., et al., In vivo role of the Sp1 site neighboring sterol-responsive element-1 in controlling low-density lipoprotein receptor gene expression. Biochem Biophys Res Commun, 1996. 218(3): p. 733-9. 12. Smith, J.R., et al., Identification of nucleotides responsible for enhancer activity of sterol regulatory element in low density lipoprotein receptor gene. J Biol Chem, 1990. 265(4): p. 2306-10. 13. Lopez, D., et al., Activation of the hepatic LDL receptor promoter by thyroid hormone. Biochim Biophys Acta, 2007. 1771(9): p. 1216-25. 14. Lopez, D. and G.C. Ness, Characterization of the rat LDL receptor 5'-flanking region. Biochim Biophys Acta, 2006. 1761(4): p. 492-500. 15. Sudhof, T.C., et al., The LDL receptor gene: a mosaic of exons shared with different proteins. Science, 1985.228(4701): p. 815-22. 16. Russell, D.W., M.S. Brown, and J.L. Goldstein, Different combinations of cysteine-rich repeats mediate binding of low density lipoprotein receptor to two different proteins. J Biol Chem, 1989. 264(36): p. 21682-8. 17. Jeon, H., et al., Implications for familial hypercholesterolemia from the structure of the LDL receptor YWTD-EGF domain pair. Nat Struct Biol, 2001. 8(6): p. 499- 504. 18. Davis, C.G., et al., Acid-dependent ligand dissociation and recycling of LDL receptor mediated by growth factor homology region. Nature, 1987. 326(6115): p. 760-5. 19. Beglova, N. and S.C. Blacklow, The LDL receptor: how acid pulls the trigger. Trends Biochem Sci, 2005. 30(6): p. 309-17. 20. Davis, C.G., et al., The low density lipoprotein receptor. Identification of amino acids in cytoplasmic domain required for rapid endocytosis. J Biol Chem, 1987. 262(9): p. 4075-82. 21. Lee LY et al., Nucleotide sequence of the rat low density lipoprotein receptor cDNA. Nucleic Acids Res 17:1259-1260, 1989. 22. Smith CW, Valcarcel J. Alternative pre-mRNA splicing: the logic of combinatorial control. Trends Biochem Sci 25:381-388, 2000. 23. Lopez, D., et al., Using in vivo electroporation to identify hepatic LDL receptor promoter elements and transcription factors mediating activation of transcription by T3. Appl Transl Genom, 2012. 1: p. 30-36. 24. Niesen M, Bedi M, Lopez D. Diabetes alters LDL receptor and PCSK9 expression in rat liver. Arch. Biochem. Biophys.470:111-115, 2008. 25. Instructions for the GenElute extraction kit: http://www.sigmaaldrich.com/content/dam/sigma- aldrich/docs/Sigma/Bulletin/na1111bul.pdf 26. Instructions for the pCR2.1 TA cloning vector and transformation into OneShot competent cells: https://tools.thermofisher.com/content/sfs/manuals/ta_man.pd f 27. Instructions for the Qiagen plasmid prep kits could be obtained here: https://www.qiagen.com/us/resources/resourcedetail?id=462055 95-0440-459e- 9d93-50eb02e5707e&lang=en 28. Web tool to determine the buffer for the restriction enzyme reactions: https://www.promega.com/a/apps/reTool/index.html 29. Instructions for the T4 DNA ligase system: https://tools.thermofisher.com/content/sfs/manuals/t4dnaliga se_1U_man.pdf 30. Instructions for the Site-directed mutagenesis kit: http://www.agilent.com/cs/library/usermanuals/Public/200523. pdf 31. Instructions for the 2× PCR Master Mix: https://tools.thermofisher.com/content/sfs/manuals/MAN001262 2_PCR_Master_2 X_K0171_UG.pdf 32. Instructions for the FuGENE® Transfection Reagent: https://www.promega.com/- /media/files/resources/protocols/technical-manuals/101/fugen e-6-transfection- reagent-protocol.pdf?la=en 33. Instructions for the Turbo DNA-free kit: https://tools.thermofisher.com/content/sfs/manuals/cms_05574 0.pdf 34. Instructions for the AB Reverse transcriptasesystem: https://tools.thermofisher.com/content/sfs/manuals/cms_04255 7.pdf 35. Instructions for the Applied Biosystems SYBR Green PCR Master Mix: https://tools.thermofisher.com/content/sfs/manuals/cms_04105 3.pdf 36. Schefe JH et al. Quantitative real-time RT-PCR data analysis: current concepts and the novel ‘‘gene expression’s CT difference’’ formula. J. Mol. Med. 84:901– 910, 2006.