DOUSIS, Athanasios (Cambridge, Massachusetts, US)
JAIN, Ruchi (Cambridge, Massachusetts, US)
RAVICHANDRAN, Kanchana (Cambridge, Massachusetts, US)
| Attorney Docket No.45817-0124WO1 / MTX959.20 WHAT IS CLAIMED IS: 1. A polypeptide comprising an amino acid sequence that is at least 80% identical to the amino acid sequence of SEQ ID NO:1, wherein the amino acid sequence comprises: (i) an amino acid other than leucine (L) at the position corresponding to position 35 of SEQ ID NO:1; (ii) an amino acid other than lysine (K) at the position corresponding to position 37 of SEQ ID NO:1; (iii) an amino acid other than alanine (A) at the position corresponding to position 39 of SEQ ID NO:1; (iv) an amino acid other than asparagine (N) at the position corresponding to position 40 of SEQ ID NO:1; (v) an amino acid other than alanine (A) at the position corresponding to position 42 of SEQ ID NO:1; (vi) an amino acid other than aspartic acid (D) at the position corresponding to position 59 of SEQ ID NO:1; (vii) an amino acid other than alanine (A) at the position corresponding to position 60 of SEQ ID NO:1; (viii) an amino acid other than glutamic acid (E) at the position corresponding to position 61 of SEQ ID NO:1; (ix) an amino acid other than proline (P) at the position corresponding to position 62 of SEQ ID NO:1; (x) an amino acid other than isoleucine (I) at the position corresponding to position 65 of SEQ ID NO:1; (xi) an amino acid other than isoleucine (I) at the position corresponding to position 66 of SEQ ID NO:1; (xii) an amino acid other than proline (P) at the position corresponding to position 70 of SEQ ID NO:1; (xiii) an amino acid other than lysine (K) at the position corresponding to position 86 of SEQ ID NO:1; Attorney Docket No.45817-0124WO1 / MTX959.20 (xiv) an amino acid other than valine (V) at the position corresponding to position 95 of SEQ ID NO:1; (xv) an amino acid other than serine (S) at the position corresponding to position 96 of SEQ ID NO:1; (xvi) an amino acid other than arginine (R) at the position corresponding to position 97 of SEQ ID NO:1; (xvii) an amino acid other than proline (P) at the position corresponding to position 98 of SEQ ID NO:1; (xviii) an amino acid other than valine (V) at the position corresponding to position 99 of SEQ ID NO:1; (xix) an amino acid other than isoleucine (I) at the position corresponding to position 100 of SEQ ID NO:1; (xx) an amino acid other than alanine (A) at the position corresponding to position 101 of SEQ ID NO:1; (xxi) an amino acid other than serine (S) at the position corresponding to position 110 of SEQ ID NO:1; (xxii) an amino acid other than leucine (L) at the position corresponding to position 112 of SEQ ID NO:1; (xxiii) an amino acid other than lysine (K) at the position corresponding to position 113 of SEQ ID NO:1; and/or (xxiv) an amino acid other than glutamine (Q) at the position corresponding to position 114 of SEQ ID NO:1; wherein the polypeptide binds to a repressor binding site comprising the nucleotide sequence set forth in any one of SEQ ID NOs:500-521 and represses translation of a target RNA comprising the repressor binding site. 2. The polypeptide of claim 1, wherein the amino acid sequence comprises: (a) (i) an amino acid other than alanine (A) at the position corresponding to position 39 of SEQ ID NO:1, (ii) an amino acid other than asparagine (N) at the position corresponding to position 40 of SEQ ID NO:1, (iii) an amino acid other than glutamic acid Attorney Docket No.45817-0124WO1 / MTX959.20 (E) at the position corresponding to position 61 of SEQ ID NO:1, (iv) an amino acid other than isoleucine (I) at the position corresponding to position 65 of SEQ ID NO:1, (v) an amino acid other than lysine (K) at the position corresponding to position 86 of SEQ ID NO:1, and (vi) an amino acid other than glutamine (Q) at the position corresponding to position 114 of SEQ ID NO:1; (b) (i) an amino acid other than lysine (K) at the position corresponding to position 37 of SEQ ID NO:1; (ii) an amino acid other than alanine (A) at the position corresponding to position 39 of SEQ ID NO:1; (iii) an amino acid other than asparagine (N) at the position corresponding to position 40 of SEQ ID NO:1; (iv) an amino acid other than glutamic acid (E) at the position corresponding to position 61 of SEQ ID NO:1; (v) an amino acid other than proline (P) at the position corresponding to position 62 of SEQ ID NO:1; (vi) an amino acid other than isoleucine (I) at the position corresponding to position 65 of SEQ ID NO:1; (vii) an amino acid other than isoleucine (I) at the position corresponding to position 66 of SEQ ID NO:1; and (viii) an amino acid other than lysine (K) at the position corresponding to position 86 of SEQ ID NO:1; (c) (i) an amino acid other than lysine (K) at the position corresponding to position 37 of SEQ ID NO:1; (ii) an amino acid other than alanine (A) at the position corresponding to position 39 of SEQ ID NO:1; (iii) an amino acid other than asparagine (N) at the position corresponding to position 40 of SEQ ID NO:1; (iv) an amino acid other than isoleucine (I) at the position corresponding to position 65 of SEQ ID NO:1; (v) an amino acid other than isoleucine (I) at the position corresponding to position 66 of SEQ ID NO:1; and (vi) an amino acid other than lysine (K) at the position corresponding to position 86 of SEQ ID NO:1; (d) (i) an amino acid other than alanine (A) at the position corresponding to position 39 of SEQ ID NO:1; (ii) an amino acid Attorney Docket No.45817-0124WO1 / MTX959.20 other than asparagine (N) at the position corresponding to position 40 of SEQ ID NO:1; (iii) an amino acid other than alanine (A) at the position corresponding to position 42 of SEQ ID NO:1; (iv) an amino acid other than alanine (A) at the position corresponding to position 60 of SEQ ID NO:1; (v) an amino acid other than glutamic acid (E) at the position corresponding to position 61 of SEQ ID NO:1; (vi) an amino acid other than isoleucine (I) at the position corresponding to position 65 of SEQ ID NO:1; (vii) an amino acid other than valine (V) at the position corresponding to position 95 of SEQ ID NO:1; (viii) an amino acid other than serine (S) at the position corresponding to position 96 of SEQ ID NO:1; (ix) an amino acid other than arginine (R) at the position corresponding to position 97 of SEQ ID NO:1; (x) an amino acid other than valine (V) at the position corresponding to position 99 of SEQ ID NO:1; (xi) an amino acid other than alanine (A) at the position corresponding to position 101 of SEQ ID NO:1; (xii) an amino acid other than lysine (K) at the position corresponding to position 113 of SEQ ID NO:1; and (xiii) an amino acid other than glutamine (Q) at the position corresponding to position 114 of SEQ ID NO:1; (e) (i) an amino acid other than alanine (A) at the position corresponding to position 39 of SEQ ID NO:1; (ii) an amino acid other than asparagine (N) at the position corresponding to position 40 of SEQ ID NO:1; (iii) an amino acid other than glutamic acid (E) at the position corresponding to position 61 of SEQ ID NO:1; (iv) an amino acid other than isoleucine (I) at the position corresponding to position 66 of SEQ ID NO:1; (v) an amino acid other than proline (P) at the position corresponding to position 70 of SEQ ID NO:1; (vi) an amino acid other than proline (P) at the position corresponding to position 98 of SEQ ID NO:1; (vii) an amino acid other than valine (V) at the position corresponding to position 99 of SEQ ID NO:1; (viii) an amino acid other than isoleucine (I) at the position corresponding to position 100 of SEQ Attorney Docket No.45817-0124WO1 / MTX959.20 ID NO:1; and (ix) an amino acid other than alanine (A) at the position corresponding to position 101 of SEQ ID NO:1; (f) ((i) an amino acid other than leucine (L) at the position corresponding to position 35 of SEQ ID NO:1; (ii) an amino acid other than lysine (K) at the position corresponding to position 37 of SEQ ID NO:1; (iii) an amino acid other than alanine (A) at the position corresponding to position 39 of SEQ ID NO:1; (iv) an amino acid other than alanine (A) at the position corresponding to position 42 of SEQ ID NO:1; (v) an amino acid other than isoleucine (I) at the position corresponding to position 65 of SEQ ID NO:1; (vi) an amino acid other than valine (V) at the position corresponding to position 95 of SEQ ID NO:1; (vii) an amino acid other than serine (S) at the position corresponding to position 96 of SEQ ID NO:1; (viii) an amino acid other than valine (V) at the position corresponding to position 99 of SEQ ID NO:1; and (ix) an amino acid other than alanine (A) at the position corresponding to position 101 of SEQ ID NO:1; (g) (i) an amino acid other than lysine (K) at the position corresponding to position 37 of SEQ ID NO:1; (ii) an amino acid other than alanine (A) at the position corresponding to position 39 of SEQ ID NO:1; (iii) an amino acid other than asparagine (N) at the position corresponding to position 40 of SEQ ID NO:1; (iv) an amino acid other than alanine (A) at the position corresponding to position 60 of SEQ ID NO:1; (v) an amino acid other than isoleucine (I) at the position corresponding to position 65 of SEQ ID NO:1; (vi) an amino acid other than valine (V) at the position corresponding to position 95 of SEQ ID NO:1; (vii) an amino acid other than serine (S) at the position corresponding to position 96 of SEQ ID NO:1; (viii) an amino acid other than arginine (R) at the position corresponding to position 97 of SEQ ID NO:1; (ix) an amino acid other than proline (P) at the position corresponding to position 98 of SEQ ID NO:1; (x) an amino acid other than valine Attorney Docket No.45817-0124WO1 / MTX959.20 (V) at the position corresponding to position 99 of SEQ ID NO:1; (xi) an amino acid other than isoleucine (I) at the position corresponding to position 100 of SEQ ID NO:1; and (xii) an amino acid other than alanine (A) at the position corresponding to position 101 of SEQ ID NO:1; (h) (i) an amino acid other than leucine (L) at the position corresponding to position 35 of SEQ ID NO:1; (ii) an amino acid other than lysine (K) at the position corresponding to position 37 of SEQ ID NO:1; (iii) an amino acid other than alanine (A) at the position corresponding to position 39 of SEQ ID NO:1; (iv) an amino acid other than asparagine (N) at the position corresponding to position 40 of SEQ ID NO:1; (v) an amino acid other than alanine (A) at the position corresponding to position 42 of SEQ ID NO:1; (vi) an amino acid other than alanine (A) at the position corresponding to position 60 of SEQ ID NO:1; (vii) an amino acid other than glutamic acid (E) at the position corresponding to position 61 of SEQ ID NO:1; (viii) an amino acid other than isoleucine (I) at the position corresponding to position 65 of SEQ ID NO:1; (ix) an amino acid other than lysine (K) at the position corresponding to position 86 of SEQ ID NO:1; (x) an amino acid other than valine (V) at the position corresponding to position 95 of SEQ ID NO:1; (xi) an amino acid other than serine (S) at the position corresponding to position 96 of SEQ ID NO:1; (xii) an amino acid other than valine (V) at the position corresponding to position 99 of SEQ ID NO:1; (xiii) an amino acid other than isoleucine (I) at the position corresponding to position 100 of SEQ ID NO:1; and (xiv) an amino acid other than alanine (A) at the position corresponding to position 101 of SEQ ID NO:1; (i) (i) an amino acid other than asparagine (N) at the position corresponding to position 40 of SEQ ID NO:1; (ii) an amino acid other than alanine (A) at the position corresponding to position 42 of SEQ ID NO:1; (iii) an amino acid other than alanine (A) at the Attorney Docket No.45817-0124WO1 / MTX959.20 position corresponding to position 60 of SEQ ID NO:1; (iv) an amino acid other than isoleucine (I) at the position corresponding to position 65 of SEQ ID NO:1; (v) an amino acid other than lysine (K) at the position corresponding to position 86 of SEQ ID NO:1; (vi) an amino acid other than valine (V) at the position corresponding to position 95 of SEQ ID NO:1; (vii) an amino acid other than serine (S) at the position corresponding to position 96 of SEQ ID NO:1; (viii) an amino acid other than arginine (R) at the position corresponding to position 97 of SEQ ID NO:1; (ix) an amino acid other than isoleucine (I) at the position corresponding to position 100 of SEQ ID NO:1; (x) an amino acid other than alanine (A) at the position corresponding to position 101 of SEQ ID NO:1; and (xi) an amino acid other than glutamine (Q) at the position corresponding to position 114 of SEQ ID NO:1; (j) (i) an amino acid other than alanine (A) at the position corresponding to position 39 of SEQ ID NO:1; (ii) an amino acid other than asparagine (N) at the position corresponding to position 40 of SEQ ID NO:1; (iii) an amino acid other than alanine (A) at the position corresponding to position 60 of SEQ ID NO:1; (iv) an amino acid other than glutamic acid (E) at the position corresponding to position 61 of SEQ ID NO:1; (v) an amino acid other than isoleucine (I) at the position corresponding to position 65 of SEQ ID NO:1; (vi) an amino acid other than lysine (K) at the position corresponding to position 86 of SEQ ID NO:1; (vii) an amino acid other than proline (P) at the position corresponding to position 98 of SEQ ID NO:1; (viii) an amino acid other than isoleucine (I) at the position corresponding to position 100 of SEQ ID NO:1; and (ix) an amino acid other than serine (S) at the position corresponding to position 110 of SEQ ID NO:1; (k) (i) an amino acid other than alanine (A) at the position corresponding to position 39 of SEQ ID NO:1; (ii) an amino acid other than asparagine (N) at the position corresponding to position Attorney Docket No.45817-0124WO1 / MTX959.20 40 of SEQ ID NO:1; (iii) an amino acid other than glutamic acid (E) at the position corresponding to position 61 of SEQ ID NO:1; (iv) an amino acid other than isoleucine (I) at the position corresponding to position 65 of SEQ ID NO:1; (v) an amino acid other than lysine (K) at the position corresponding to position 86 of SEQ ID NO:1; (vi) an amino acid other than lysine (K) at the position corresponding to position 113 of SEQ ID NO:1; and (vii) an amino acid other than glutamine (Q) at the position corresponding to position 114 of SEQ ID NO:1; (l) (i) an amino acid other than alanine (A) at the position corresponding to position 39 of SEQ ID NO:1; (ii) an amino acid other than asparagine (N) at the position corresponding to position 40 of SEQ ID NO:1; (iii) an amino acid other than glutamic acid (E) at the position corresponding to position 61 of SEQ ID NO:1; (iv) an amino acid other than proline (P) at the position corresponding to position 62 of SEQ ID NO:1; (v) an amino acid other than isoleucine (I) at the position corresponding to position 65 of SEQ ID NO:1; (vi) an amino acid other than isoleucine (I) at the position corresponding to position 66 of SEQ ID NO:1; (vii) an amino acid other than lysine (K) at the position corresponding to position 86 of SEQ ID NO:1; (viii) an amino acid other than lysine (K) at the position corresponding to position 113 of SEQ ID NO:1; and (ix) an amino acid other than glutamine (Q) at the position corresponding to position 114 of SEQ ID NO:1; (m) (i) an amino acid other than alanine (A) at the position corresponding to position 39 of SEQ ID NO:1; (ii) an amino acid other than asparagine (N) at the position corresponding to position 40 of SEQ ID NO:1; (iii) an amino acid other than glutamic acid (E) at the position corresponding to position 61 of SEQ ID NO:1; (iv) an amino acid other than isoleucine (I) at the position corresponding to position 65 of SEQ ID NO:1; (v) an amino acid other than isoleucine (I) at the position corresponding to position Attorney Docket No.45817-0124WO1 / MTX959.20 66 of SEQ ID NO:1; (vi) an amino acid other than lysine (K) at the position corresponding to position 86 of SEQ ID NO:1; (vii) an amino acid other than lysine (K) at the position corresponding to position 113 of SEQ ID NO:1; and (viii) an amino acid other than glutamine (Q) at the position corresponding to position 114 of SEQ ID NO:1; (n) (i) an amino acid other than alanine (A) at the position corresponding to position 39 of SEQ ID NO:1; (ii) an amino acid other than asparagine (N) at the position corresponding to position 40 of SEQ ID NO:1; (iii) an amino acid other than glutamic acid (E) at the position corresponding to position 61 of SEQ ID NO:1; (iv) an amino acid other than isoleucine (I) at the position corresponding to position 65 of SEQ ID NO:1; (v) an amino acid other than isoleucine (I) at the position corresponding to position 66 of SEQ ID NO:1; and (vi) an amino acid other than lysine (K) at the position corresponding to position 86 of SEQ ID NO:1; (o) (i) an amino acid other than alanine (A) at the position corresponding to position 39 of SEQ ID NO:1; (ii) an amino acid other than asparagine (N) at the position corresponding to position 40 of SEQ ID NO:1; (iii) an amino acid other than proline (P) at the position corresponding to position 62 of SEQ ID NO:1; (iv) an amino acid other than isoleucine (I) at the position corresponding to position 65 of SEQ ID NO:1; (v) an amino acid other than isoleucine (I) at the position corresponding to position 66 of SEQ ID NO:1; (vi) an amino acid other than lysine (K) at the position corresponding to position 86 of SEQ ID NO:1; (vii) an amino acid other than proline (P) at the position corresponding to position 98 of SEQ ID NO:1; (viii) an amino acid other than lysine (K) at the position corresponding to position 113 of SEQ ID NO:1; and (viii) an amino acid other than glutamine (Q) at the position corresponding to position 114 of SEQ ID NO:1; Attorney Docket No.45817-0124WO1 / MTX959.20 (p) (i) an amino acid other than alanine (A) at the position corresponding to position 39 of SEQ ID NO:1; (ii) an amino acid other than asparagine (N) at the position corresponding to position 40 of SEQ ID NO:1; (iii) an amino acid other than isoleucine (I) at the position corresponding to position 65 of SEQ ID NO:1; (iv) an amino acid other than isoleucine (I) at the position corresponding to position 66 of SEQ ID NO:1; (v) an amino acid other than lysine (K) at the position corresponding to position 86 of SEQ ID NO:1; (vi) an amino acid other than lysine (K) at the position corresponding to position 113 of SEQ ID NO:1; and (vii) an amino acid other than glutamine (Q) at the position corresponding to position 114 of SEQ ID NO:1; (q) (i) an amino acid other than alanine (A) at the position corresponding to position 39 of SEQ ID NO:1; (ii) an amino acid other than asparagine (N) at the position corresponding to position 40 of SEQ ID NO:1; (iii) an amino acid other than aspartic acid (D) at the position corresponding to position 59 of SEQ ID NO:1; (iv) an amino acid other than proline (P) at the position corresponding to position 62 of SEQ ID NO:1; (v) an amino acid other than isoleucine (I) at the position corresponding to position 65 of SEQ ID NO:1; (vi) an amino acid other than isoleucine (I) at the position corresponding to position 66 of SEQ ID NO:1; (vii) an amino acid other than lysine (K) at the position corresponding to position 86 of SEQ ID NO:1; and (viii) an amino acid other than leucine (L) at the position corresponding to position 112 of SEQ ID NO:1; or (r) (i) an amino acid other than alanine (A) at the position corresponding to position 39 of SEQ ID NO:1; (ii) an amino acid other than asparagine (N) at the position corresponding to position 40 of SEQ ID NO:1; (iii) an amino acid other than glutamic acid (E) at the position corresponding to position 61 of SEQ ID NO:1; (iv) an amino acid other than proline (P) at the position corresponding to position 62 of SEQ ID NO:1; (v) an amino acid Attorney Docket No.45817-0124WO1 / MTX959.20 other than isoleucine (I) at the position corresponding to position 65 of SEQ ID NO:1; (vi) an amino acid other than isoleucine (I) at the position corresponding to position 66 of SEQ ID NO:1; (vii) an amino acid other than lysine (K) at the position corresponding to position 86 of SEQ ID NO:1; (viii) an amino acid other than lysine (K) at the position corresponding to position 113 of SEQ ID NO:1; and (ix) an amino acid other than glutamine (Q) at the position corresponding to position 114 of SEQ ID NO:1. 3. The polypeptide of claim 1, wherein the amino acid sequence comprises: (a) one or more substitutions selected from the group consisting of A39N, N40Y, E61S, I65K, K86S, and Q114H (numbered according to SEQ ID NO:1); (b) one or more substitutions selected from the group consisting of K37R, A39V, N40H, E61H, P62H, I65K, I66L, and K86S (numbered according to SEQ ID NO:1); (c) one or more substitutions selected from the group consisting of K37T, A39R, N40H, I65K, I66V, and K86S (numbered according to SEQ ID NO:1); (d) one or more substitutions selected from the group consisting of A39V, N40K, A42V, A60V, E61S, I65V, V95I, S96D, R97M, V99L, A101V, K113S, and Q114N (numbered according to SEQ ID NO:1); (e) one or more substitutions selected from the group consisting of A39T, N40K, E61V, I66N, P70L, P98G, V99L, I100V, and A101V (numbered according to SEQ ID NO:1); (f) one or more substitutions selected from the group consisting of L35I, K37T, A39V, A42V, I65V, V95L, S96E, V99M, and A101V (numbered according to SEQ ID NO:1); (g) one or more substitutions selected from the group consisting of K37R, A39V, N40K, A60M, I65V, V95I, S96D, R97G, P98A, Attorney Docket No.45817-0124WO1 / MTX959.20 V99M, I100A, and A101V (numbered according to SEQ ID NO:1); (h) one or more substitutions selected from the group consisting of L35I, K37T, A39T, N40K, A42V, A60T, E61S, I65V, K86Q, V95I, S96K, V99L, I100T, and A101V (numbered according to SEQ ID NO:1); (i) one or more substitutions selected from the group consisting of N40K, A42V, A60M, I65V, K86Q, V95L, S96D, R97V, I100A, A101V, and Q114H (numbered according to SEQ ID NO:1); (j) one or more substitutions selected from the group consisting of A39V, N40K, A60T, E61T, I65V, K86Q, P98G, I100F, and S110F (numbered according to SEQ ID NO:1); (k) one or more substitutions selected from the group consisting of A39N, N40Y, E61S, I65K, K86S, K113S, and Q114N (numbered according to SEQ ID NO:1); (l) one or more substitutions selected from the group consisting of A39V, N40H, E61H, P62H, I65K, I66L, K86S, K113S, and Q114N (numbered according to SEQ ID NO:1); (m) one or more substitutions selected from the group consisting of A39I, N40Y, E61K, I65Q, I66A, K86S, K113S, and Q114N (numbered according to SEQ ID NO:1); (n) one or more substitutions selected from the group consisting of A39N, N40Y, E61S, I65K, I66L, and K86S (numbered according to SEQ ID NO:1); (o) one or more substitutions selected from the group consisting of A39T, N40Y, P62H, I65K, I66L, K86S, P98S, K113S, and Q114N (numbered according to SEQ ID NO:1); (p) one or more substitutions selected from the group consisting of A39Y, N40Y, I65K, I66M, K86S, K113S, and Q114N (numbered according to SEQ ID NO:1); Attorney Docket No.45817-0124WO1 / MTX959.20 (q) one or more substitutions selected from the group consisting of A39T, N40H, D59N, P62H, I65K, I66L, K86S, and L112F (numbered according to SEQ ID NO:1); or (r) one or more substitutions selected from the group consisting of A39T, N40K, E61K, P62H, I65R, I66M, K86S, K113S, and Q114N (numbered according to SEQ ID NO:1). 4. The polypeptide of claim 1, wherein the amino acid sequence comprises: (a) the substitutions A39N, N40Y, E61S, I65K, K86S, and Q114H (numbered according to SEQ ID NO:1); (b) the substitutions K37R, A39V, N40H, E61H, P62H, I65K, I66L, and K86S (numbered according to SEQ ID NO:1); (c) the substitutions K37T, A39R, N40H, I65K, I66V, and K86S (numbered according to SEQ ID NO:1); (d) the substitutions A39V, N40K, A42V, A60V, E61S, I65V, V95I, S96D, R97M, V99L, A101V, K113S, and Q114N (numbered according to SEQ ID NO:1); (e) the substitutions A39T, N40K, E61V, I66N, P70L, P98G, V99L, I100V, and A101V (numbered according to SEQ ID NO:1); (f) the substitutions L35I, K37T, A39V, A42V, I65V, V95L, S96E, V99M, and A101V (numbered according to SEQ ID NO:1); (g) the substitutions K37R, A39V, N40K, A60M, I65V, V95I, S96D, R97G, P98A, V99M, I100A, and A101V (numbered according to SEQ ID NO:1); (h) the substitutions L35I, K37T, A39T, N40K, A42V, A60T, E61S, I65V, K86Q, V95I, S96K, V99L, I100T, and A101V (numbered according to SEQ ID NO:1); (i) the substitutions N40K, A42V, A60M, I65V, K86Q, V95L, S96D, R97V, I100A, A101V, and Q114H (numbered according to SEQ ID NO:1); (j) the substitutions A39V, N40K, A60T, E61T, I65V, K86Q, P98G, I100F, and S110F (numbered according to SEQ ID NO:1); Attorney Docket No.45817-0124WO1 / MTX959.20 (k) the substitutions A39N, N40Y, E61S, I65K, K86S, K113S, and Q114N (numbered according to SEQ ID NO:1); (l) the substitutions A39V, N40H, E61H, P62H, I65K, I66L, K86S, K113S, and Q114N (numbered according to SEQ ID NO:1); (m) the substitutions A39I, N40Y, E61K, I65Q, I66A, K86S, K113S, and Q114N (numbered according to SEQ ID NO:1); (n) the substitutions A39N, N40Y, E61S, I65K, I66L, and K86S (numbered according to SEQ ID NO:1); (o) the substitutions A39T, N40Y, P62H, I65K, I66L, K86S, P98S, K113S, and Q114N (numbered according to SEQ ID NO:1); (p) the substitutions A39Y, N40Y, I65K, I66M, K86S, K113S, and Q114N (numbered according to SEQ ID NO:1); (q) the substitutions A39T, N40H, D59N, P62H, I65K, I66L, K86S, and L112F (numbered according to SEQ ID NO:1); or (r) the substitutions A39T, N40K, E61K, P62H, I65R, I66M, K86S, K113S, and Q114N (numbered according to SEQ ID NO:1). 5. The polypeptide of any one of claims 1 to 4, wherein the polypeptide comprises the substitutions C30A, C73A, C93A, and C102A (numbered according to SEQ ID NO:1). 6. The polypeptide of any one of claims 1 to 5, wherein the polypeptide is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the amino acid sequence set forth in any one of SEQ ID NOs:320-373. 7. The polypeptide of claim 1, wherein the polypeptide comprises the amino acid sequence set forth in any one of SEQ ID NOs:320-373. 8. A messenger RNA (mRNA) comprising an open reading frame (ORF) encoding the polypeptide of any one of claims 1 to 7. Attorney Docket No.45817-0124WO1 / MTX959.20 9. The mRNA of claim 8, wherein the ORF is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence set forth in any one of SEQ ID NOs:300- 317. 10. The mRNA of claim 8, wherein the ORF comprises the nucleic acid sequence set forth in any one of SEQ ID NOs:300-317. 11. The mRNA of any one of claims 8 to 10, further comprising a 5’ untranslated region (UTR) comprising the nucleic acid sequence of SEQ ID NO:50. 12. The mRNA of any one of claims 8 to 11, further comprising a 3’ UTR comprising the nucleic acid sequence of SEQ ID NO:108. 13. The mRNA of any one of claims 8 to 12, wherein the mRNA comprises a 5′ terminal cap. 14. The mRNA of claim 13, wherein the 5' terminal cap comprises a m7GpppG2 ^OMe, m7G-ppp-Gm-A, m7G-ppp-Gm-AG, Cap0, Cap1, ARCA, inosine, N1-methyl-guanosine, 2′-fluoro-guanosine, 7-deaza-guanosine, 8- oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azidoguanosine, Cap2, Cap4, 5′ methylG cap, or an analog thereof. 15. The mRNA of any one of claims 8 to 14, wherein the mRNA comprises a poly-A region. 16. The mRNA of claim 15, wherein the poly-A region is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90 nucleotides in length, or at least about 100 nucleotides in length. Attorney Docket No.45817-0124WO1 / MTX959.20 17. The mRNA of claim 15, wherein the poly-A region is at least about 100 nucleotides in length. 18. The mRNA of any one of claims 8 to 17, wherein all of the uracils of the mRNA are N1-methylpseudouracils. 19. The mRNA of any one of claims 8 to 17, wherein all of the uracils in the mRNA are 5 methoxyuracils. 20. A pharmaceutical composition comprising the mRNA of any one of claims 8 to 19 and a pharmaceutically acceptable excipient. 21. A lipid nanoparticle comprising the mRNA of any one of claims 8 to 19. 22. A method of expressing a polypeptide in a human subject in need thereof, the method comprising administering to the human subject an effective amount of the mRNA of any one of claims 8 to 19, the pharmaceutical composition of claim 20, or the lipid nanoparticle of claim 21. 23. A method for regulating expression of a polypeptide, the method comprising contacting a cell with: (i) a first polynucleotide comprising (a) a Snu13-binding site, and (b) an open reading frame encoding a first polypeptide; and (ii) a second polynucleotide comprising a nucleotide sequence encoding a second polypeptide, wherein the second polypeptide comprises the polypeptide of any one of claims 1 to 7; wherein binding of the second polypeptide to the Snu13-binding site represses translation of the first polypeptide from the first polynucleotide. 24. A method for regulating expression of a polypeptide in a subject, the method comprising administering to the subject: Attorney Docket No.45817-0124WO1 / MTX959.20 (i) a first polynucleotide comprising (a) a Snu13-binding site, and (b) an open reading frame encoding a first polypeptide; and (ii) a second polynucleotide comprising a nucleotide sequence encoding a second polypeptide, wherein the second polypeptide comprises the polypeptide of any one of claims 1 to 7; wherein binding of the second polypeptide to the Snu13-binding site represses translation of the first polypeptide from the first polynucleotide. 25. The method of claim 23 or 24, wherein the Snu13-binding site comprises the nucleotide sequence set forth in SEQ ID NO:500. 26. The method of any one of claims 23 to 25, wherein the first polypeptide comprises a secreted protein, a membrane-bound protein, or an intracellular protein. 27. The method of claim 26, wherein the first polypeptide is a cytokine, an antibody, a vaccine, a receptor, an enzyme, a hormone, a transcription factor, a ligand, a membrane transporter, a structural protein, a nuclease, or a component, variant or fragment thereof. 28. The method of any one of claims 23 to 27, wherein the second polynucleotide is an mRNA. 29. The method of any one of claims 23 to 27, wherein the second polynucleotide comprises the mRNA of any one of claims 8 to 19. 30. The method of any one of claims 23 to 29, wherein the first polynucleotide is an mRNA. 31. The method of any one of claims 23 to 29, wherein the first polynucleotide is an mRNA in which all of the uracils of the mRNA are N1- methylpseudouracils. Attorney Docket No.45817-0124WO1 / MTX959.20 32. The method of any one of claims 28 to 31, wherein the method comprises contacting the cell with, or administering to the subject, the pharmaceutical composition of claim 20 or the lipid nanoparticle of claim 21. 33. A composition comprising: a first polynucleotide comprising (a) a Snu13-binding site, and (b) an open reading frame encoding a first polypeptide; and a second polynucleotide comprising a nucleotide sequence encoding a second polypeptide, wherein the second polypeptide comprises the polypeptide of any one of claims 1 to 7; wherein binding of the second polypeptide to the Snu13-binding site represses translation of the first polypeptide from the first polynucleotide. 34. The composition of claim 33, wherein the first polynucleotide is an mRNA. 35. The composition of claim 33, wherein the second polynucleotide is an mRNA. 36. The composition of claim 33, wherein the first polynucleotide and the second polynucleotide are mRNAs. 37. The composition of any one of claims 33 to 36, wherein the Snu13-binding site comprises the nucleotide sequence set forth in SEQ ID NO:500. 38. The composition of any one of claims 33 to 37, wherein the first polypeptide comprises a secreted protein, a membrane-bound protein, or an intracellular protein. 39. The composition of claim 38, wherein the first polypeptide is a cytokine, an antibody, a vaccine, a receptor, an enzyme, a hormone, a transcription factor, a ligand, a membrane transporter, a structural protein, a nuclease, or a component, variant or fragment thereof. Attorney Docket No.45817-0124WO1 / MTX959.20 40. The composition of any one of claims 33 to 39, wherein the first polynucleotide is an mRNA in which all of the uracils of the mRNA are N1- methylpseudouracils. 41. The composition of any one of claims 33 to 40, wherein the composition is a lipid nanoparticle. |
Attorney Docket No.45817-0124WO1 / MTX959.20 [00356] In yet other embodiments, a cap comprises the following structure: . embodiments, R is a methyl group (e.g., C1 alkyl). In some embodiments, R is an ethyl group (e.g., C 2 alkyl). [00359] In some embodiments, a cap comprises a sequence selected from the following sequences: GAA, GAC, GAG, GAU, GCA, GCC, GCG, GCU, GGA , GGC, GGG, GGU, GUA, GUC, GUG, and GUU. In some embodiments, a cap comprises GAA. In some embodiments, a cap comprises GAC. In some Attorney Docket No.45817-0124WO1 / MTX959.20 embodiments, a cap comprises GAG. In some embodiments, a cap comprises GAU. In some embodiments, a cap comprises GCA. In some embodiments, a cap comprises GCC. In some embodiments, a cap comprises GCG. In some embodiments, a cap comprises GCU. In some embodiments, a cap comprises GGA. In some embodiments, a cap comprises GGC. In some embodiments, a cap comprises GGG. In some embodiments, a cap comprises GGU. In some embodiments, a cap comprises GUA. In some embodiments, a cap comprises GUC. In some embodiments, a cap comprises GUG. In some embodiments, a cap comprises GUU. [00360] In some embodiments, a cap comprises a sequence selected from the following sequences: m 7 GpppApA, m 7 GpppApC, m 7 GpppApG, m 7 GpppApU, m 7 GpppCpA, m 7 GpppCpC, m 7 GpppCpG, m 7 GpppCpU, m 7 GpppGpA, m 7 GpppGpC, m 7 GpppGpG, m 7 GpppGpU, m 7 GpppUpA, m 7 GpppUpC, m 7 GpppUpG, and m 7 GpppUpU. [00361] In some embodiments, a cap comprises m 7 GpppApA. In some embodiments, a cap comprises m 7 GpppApC. In some embodiments, a cap comprises m 7 GpppApG. In some embodiments, a cap comprises m 7 GpppApU. In some embodiments, a cap comprises m 7 GpppCpA. In some embodiments, a cap comprises m 7 GpppCpC. In some embodiments, a cap comprises m 7 GpppCpG. In some embodiments, a cap comprises m 7 GpppCpU. In some embodiments, a cap comprises m 7 GpppGpA. In some embodiments, a cap comprises m 7 GpppGpC. In some embodiments, a cap comprises m 7 GpppGpG. In some embodiments, a cap comprises m 7 GpppGpU. In some embodiments, a cap comprises m 7 GpppUpA. In some embodiments, a cap comprises m 7 GpppUpC. In some embodiments, a cap comprises m 7 GpppUpG. In some embodiments, a cap comprises m 7 GpppUpU. [00362] A cap, in some embodiments, comprises a sequence selected from the following sequences: m 7 G 3 ^OMe pppApA, m 7 G 3 ^OMe pppApC, m 7 G 3 ^OMe pppApG, m 7 G 3 ^OMe pppApU, m 7 G 3 ^OMe pppCpA, m 7 G 3 ^OMe pppCpC, m 7 G 3 ^OMe pppCpG, m 7 G3 ^ OMepppCpU, m 7 G3 ^ OMepppGpA, m 7 G3 ^ OMepppGpC, m 7 G3 ^ OMepppGpG, m 7 G3 ^ OMepppGpU, m 7 G3 ^ OMepppUpA, m 7 G3 ^ OMepppUpC, m 7 G3 ^ OMepppUpG, and m 7 G 3 ^OMe pppUpU. Attorney Docket No.45817-0124WO1 / MTX959.20 [00363] In some embodiments, a cap comprises m 7 G3 ^OMepppApA. In some embodiments, a cap comprises m 7 G 3 ^OMe pppApC. In some embodiments, a cap comprises m 7 G3 ^ OMepppApG. In some embodiments, a cap comprises m 7 G3 ^ OMepppApU. In some embodiments, a cap comprises m 7 G3 ^ OMepppCpA. In some embodiments, a cap comprises m 7 G3 ^OMepppCpC. In some embodiments, a cap comprises m 7 G 3 ^OMe pppCpG. In some embodiments, a cap comprises m 7 G3 ^ OMepppCpU. In some embodiments, a cap comprises m 7 G3 ^ OMepppGpA. In some embodiments, a cap comprises m 7 G3 ^ OMepppGpC. In some embodiments, a cap comprises m 7 G 3 ^OMe pppGpG. In some embodiments, a cap comprises m 7 G 3 ^OMe pppGpU. In some embodiments, a cap comprises m 7 G 3 ^OMe pppUpA. In some embodiments, a cap comprises m 7 G3 ^ OMepppUpC. In some embodiments, a cap comprises m 7 G3 ^ OMepppUpG. In some embodiments, a cap comprises m 7 G 3 ^OMe pppUpU. [00364] A cap, in other embodiments, comprises a sequence selected from the following sequences: m 7 G3 ^ OMepppA2 ^ OMepA, m 7 G3 ^ OMepppA2 ^ OMepC, m 7 G 3 ^OMe pppA 2 ^OMe pG, m 7 G 3 ^OMe pppA 2 ^OMe pU, m 7 G 3 ^OMe pppC 2 ^OMe pA, m 7 G 3 ^OMe pppC 2 ^OMe pC, m 7 G 3 ^OMe pppC 2 ^OMe pG, m 7 G 3 ^OMe pppC 2 ^OMe pU, m 7 G3 ^ OMepppG2 ^ OMepA, m 7 G3 ^ OMepppG2 ^ OMepC, m 7 G3 ^ OMepppG2 ^ OMepG, m 7 G3 ^ OMepppG2 ^ OMepU, m 7 G3 ^ OMepppU2 ^ OMepA, m 7 G3 ^ OMepppU2 ^ OMepC, m 7 G 3 ^OMe pppU 2 ^OMe pG, and m 7 G 3 ^OMe pppU 2 ^OMe pU. [00365] In some embodiments, a cap comprises m 7 G 3 ^OMe pppA 2 ^OMe pA. In some embodiments, a cap comprises m 7 G3 ^ OMepppA2 ^ OMepC. In some embodiments, a cap comprises m 7 G3 ^ OMepppA2 ^ OMepG. In some embodiments, a cap comprises m 7 G 3 ^OMe pppA 2 ^OMe pU. In some embodiments, a cap comprises m 7 G 3 ^OMe pppC 2 ^OMe pA. In some embodiments, a cap comprises m 7 G 3 ^OMe pppC 2 ^OMe pC. In some embodiments, a cap comprises m 7 G3 ^ OMepppC2 ^ OMepG. In some embodiments, a cap comprises m 7 G3 ^ OMepppC2 ^ OMepU. In some embodiments, a cap comprises m 7 G 3 ^OMe pppG 2 ^OMe pA. In some embodiments, a cap comprises m 7 G 3 ^OMe pppG 2 ^OMe pC. In some embodiments, a cap comprises m 7 G3 ^ OMepppG2 ^ OMepG. In some embodiments, a cap comprises Attorney Docket No.45817-0124WO1 / MTX959.20 m 7 G3 ^OMepppG2 ^OMepU. In some embodiments, a cap comprises m 7 G 3 ^OMe pppU 2 ^OMe pA. In some embodiments, a cap comprises m 7 G3 ^ OMepppU2 ^ OMepC. In some embodiments, a cap comprises m 7 G3 ^ OMepppU2 ^ OMepG. In some embodiments, a cap comprises m 7 G3 ^OMepppU2 ^OMepU. [00366] A cap, in still other embodiments, comprises a sequence selected from the following sequences: m 7 GpppG2 ^ OMe, m 7 GpppA2 ^ OMepA, m 7 GpppA2 ^ OMepC, m 7 GpppA 2 ^OMe pG, m 7 GpppA 2 ^OMe pU, m 7 GpppC 2 ^OMe pA, m 7 GpppC 2 ^OMe pC, m 7 GpppC 2 ^OMe pG, m 7 GpppC 2 ^OMe pU, m 7 GpppG 2 ^OMe pA, m 7 GpppG 2 ^OMe pC, m 7 GpppG2 ^ OMepG, m 7 GpppG2 ^ OMepU, m 7 GpppU2 ^ OMepA, m 7 GpppU2 ^ OMepC, m 7 GpppU2 ^ OMepG, and m 7 GpppU2 ^ OMepU. [00367] In some embodiments, a cap comprises m 7 GpppA 2 ^OMe pA. In some embodiments, a cap comprises m 7 GpppA 2 ^OMe pC. In some embodiments, a cap comprises m 7 GpppA2 ^ OMepG. In some embodiments, a cap comprises m 7 GpppA2 ^ OMepU. In some embodiments, a cap comprises m 7 GpppC2 ^ OMepA. In some embodiments, a cap comprises m 7 GpppC 2 ^OMe pC. In some embodiments, a cap comprises m 7 GpppC 2 ^OMe pG. In some embodiments, a trinucleotide cap comprises m 7 GpppC2 ^ OMepU. In some embodiments, a cap comprises m 7 GpppG2 ^ OMepA. In some embodiments, a cap comprises m 7 GpppG2 ^ OMepC. In some embodiments, a cap comprises m 7 GpppG 2 ^OMe pG. In some embodiments, a cap comprises m 7 GpppG 2 ^OMe pU. In some embodiments, a cap comprises m 7 GpppU 2 ^OMe pA. In some embodiments, a cap comprises m 7 GpppU2 ^ OMepC. In some embodiments, a cap comprises m 7 GpppU2 ^ OMepG. In some embodiments, a cap comprises m 7 GpppU 2 ^OMe pU. [00368] In some embodiments, a cap comprises m 7 Gpppm 6 A 2’Ome pG. In some embodiments, a cap comprises m 7 Gpppe 6 A2’OmepG. [00369] In some embodiments, a cap comprises GAG. In some embodiments, a cap comprises GCG. In some embodiments, a cap comprises GUG. In some embodiments, a cap comprises GGG. Attorney Docket No.45817-0124WO1 / MTX959.20 [00370] In some embodiments, a cap comprises any one of the following structures: or . [00371] In some embodiments, the cap comprises m7 GpppN 1 N 2 N 3 , where N 1 , N 2 , and N3 are optional (i.e., can be absent or one or more can be present) and are independently a natural, a modified, or an unnatural nucleoside base. In some embodiments, m7 G is further methylated, e.g., at the 3’ position. In some embodiments, the m7 G comprises an O-methyl at the 3’ position. In some embodiments N1, N2, and N3 if present, optionally, are independently an adenine, a uracil, a guanidine, a thymine, or a cytosine. In some embodiments, one or more (or all) of N1, N2, and N3, if present, are methylated, e.g., at the 2’ position. In some Attorney Docket No.45817-0124WO1 / MTX959.20 embodiments, one or more (or all) of N1, N2, and N3, if present have an O-methyl at the 2’ position. [00372] In some embodiments, the cap comprises the following structure: unnatural nucleoside based; and R1, R2, R3, and R4 are independently OH or O- methyl. In some embodiments, R 3 is O-methyl and R 4 is OH. In some embodiments, R3 and R4 are O-methyl. In some embodiments, R4 is O-methyl. In some embodiments, R 1 is OH, R 2 is OH, R 3 is O-methyl, and R 4 is OH. In some embodiments, R1 is OH, R2 is OH, R3 is O-methyl, and R4 is O-methyl. In some embodiments, at least one of R 1 and R 2 is O-methyl, R 3 is O-methyl, and R 4 is OH. In some embodiments, at least one of R1 and R2 is O-methyl, R3 is O-methyl, and R4 is O-methyl. [00373] In some embodiments, B 1 , B 3 , and B 3 are natural nucleoside bases. In some embodiments, at least one of B1, B2, and B3 is a modified or unnatural base. In some embodiments, at least one of B 1 , B 2 , and B 3 is N6-methyladenine. In some embodiments, B1 is adenine, cytosine, thymine, or uracil. In some embodiments, B1 is adenine, B 2 is uracil, and B 3 is adenine. In some embodiments, R 1 and R 2 are OH, R3 and R4 are O-methyl, B1 is adenine, B2 is uracil, and B3 is adenine. [00374] In some embodiments the cap comprises a sequence selected from the following sequences: GAAA, GACA, GAGA, GAUA, GCAA, GCCA, GCGA, GCUA, GGAA, GGCA, GGGA, GGUA, GUCA, and GUUA. In some embodiments the cap comprises a sequence selected from the following sequences: GAAG, GACG, Attorney Docket No.45817-0124WO1 / MTX959.20 GAGG, GAUG, GCAG, GCCG, GCGG, GCUG, GGAG, GGCG, GGGG, GGUG, GUCG, GUGG, and GUUG. In some embodiments the cap comprises a sequence selected from the following sequences: GAAU, GACU, GAGU, GAUU, GCAU, GCCU, GCGU, GCUU, GGAU, GGCU, GGGU, GGUU, GUAU, GUCU, GUGU, and GUUU. In some embodiments the cap comprises a sequence selected from the following sequences: GAAC, GACC, GAGC, GAUC, GCAC, GCCC, GCGC, GCUC, GGAC, GGCC, GGGC, GGUC, GUAC, GUCC, GUGC, and GUUC. [00375] A cap, in some embodiments, comprises a sequence selected from the following sequences: m 7 G 3 ^OMe pppApApN, m 7 G 3 ^OMe pppApCpN, m 7 G 3 ^OMe pppApGpN, m 7 G 3 ^OMe pppApUpN, m 7 G 3 ^OMe pppCpApN, m 7 G3 ^ OMepppCpCpN, m 7 G3 ^ OMepppCpGpN, m 7 G3 ^ OMepppCpUpN, m 7 G3 ^ OMepppGpApN, m 7 G3 ^ OMepppGpCpN, m 7 G3 ^ OMepppGpGpN, m 7 G 3 ^OMe pppGpUpN, m 7 G 3 ^OMe pppUpApN, m 7 G 3 ^OMe pppUpCpN, m 7 G 3 ^OMe pppUpGpN, and m 7 G 3 ^OMe pppUpUpN, where N is a natural, a modified, or an unnatural nucleoside base. [00376] A cap, in other embodiments, comprises a sequence selected from the following sequences: m 7 G3 ^ OMepppA2 ^ OMepApN, m 7 G3 ^ OMepppA2 ^ OMepCpN, m 7 G 3 ^OMe pppA 2 ^OMe pGpN, m 7 G 3 ^OMe pppA 2 ^OMe pUpN, m 7 G 3 ^OMe pppC 2 ^OMe pApN, m 7 G 3 ^OMe pppC 2 ^OMe pCpN, m 7 G 3 ^OMe pppC 2 ^OMe pGpN, m 7 G 3 ^OMe pppC 2 ^OMe pUpN, m 7 G3 ^ OMepppG2 ^ OMepApN, m 7 G3 ^ OMepppG2 ^ OMepCpN, m 7 G3 ^ OMepppG2 ^ OMepGpN, m 7 G3 ^ OMepppG2 ^ OMepUpN, m 7 G3 ^ OMepppU2 ^ OMepApN, m 7 G3 ^ OMepppU2 ^ OMepCpN, m 7 G 3 ^OMe pppU 2 ^OMe pGpN, and m 7 G 3 ^OMe pppU 2 ^OMe pUpN, where N is a natural, a modified, or an unnatural nucleoside base. [00377] A cap, in still other embodiments, comprises a sequence selected from the following sequences: m 7 GpppA 2 ^OMe pApN, m 7 GpppA 2 ^OMe pCpN, m 7 GpppA2 ^ OMepGpN, m 7 GpppA2 ^ OMepUpN, m 7 GpppC2 ^ OMepApN, m 7 GpppC2 ^ OMepCpN, m 7 GpppC2 ^ OMepGpN, m 7 GpppC2 ^ OMepUpN, m 7 GpppG 2 ^OMe pApN, m 7 GpppG 2 ^OMe pCpN, m 7 GpppG 2 ^OMe pGpN, m 7 GpppG 2 ^OMe pUpN, m 7 GpppU 2 ^OMe pApN, m 7 GpppU 2 ^OMe pCpN, m 7 GpppU2 ^ OMepGpN, and m 7 GpppU2 ^ OMepUpN, where N is a natural, a modified, or an unnatural nucleoside base. Attorney Docket No.45817-0124WO1 / MTX959.20 [00378] A cap, in other embodiments, comprises a sequence selected from the following sequences: m 7 G3 ^ OMepppA2 ^ OMepA2 ^ OMepN, m 7 G3 ^ OMepppA2 ^ OMepC2 ^ OMepN, m 7 G3 ^ OMepppA2 ^ OMepG2 ^ OMepN, m 7 G3 ^ OMepppA2 ^ OMepU2 ^ OMepN, m 7 G 3 ^OMe pppC 2 ^OMe pA 2 ^OMe pN, m 7 G 3 ^OMe pppC 2 ^OMe pC 2 ^OMe pN, m 7 G 3 ^OMe pppC 2 ^OMe pG 2 ^OMe pN, m 7 G 3 ^OMe pppC 2 ^OMe pU 2 ^OMe pN, m 7 G3 ^ OMepppG2 ^ OMepA2 ^ OMepN, m 7 G3 ^ OMepppG2 ^ OMepC2 ^ OMepN, m 7 G3 ^ OMepppG2 ^ OMepG2 ^ OMepN, m 7 G3 ^ OMepppG2 ^ OMepU2 ^ OMepN, m 7 G 3 ^OMe pppU 2 ^OMe pA 2 ^OMe pN, m 7 G 3 ^OMe pppU 2 ^OMe pC 2 ^OMe pN, m 7 G 3 ^OMe pppU 2 ^OMe pG 2 ^OMe pN, and m 7 G 3 ^OMe pppU 2 ^OMe pU 2 ^OMe pN, where N is a natural, a modified, or an unnatural nucleoside base. [00379] A cap, in still other embodiments, comprises a sequence selected from the following sequences: m 7 GpppA2 ^ OMepA2 ^ OMepN, m 7 GpppA2 ^ OMepC2 ^ OMepN, m 7 GpppA2 ^ OMepG2 ^ OMepN, m 7 GpppA2 ^ OMepU2 ^ OMepN, m 7 GpppC2 ^ OMepA2 ^ OMepN, m 7 GpppC 2 ^OMe pC 2 ^OMe pN, m 7 GpppC 2 ^OMe pG 2 ^OMe pN, m 7 GpppC 2 ^OMe pU 2 ^OMe pN, m 7 GpppG 2 ^OMe pA 2 ^OMe pN, m 7 GpppG 2 ^OMe pC 2 ^OMe pN, m 7 GpppG 2 ^OMe pG 2 ^OMe pN, m 7 GpppG2 ^ OMepU2 ^ OMepN, m 7 GpppU2 ^ OMepA2 ^ OMepN, m 7 GpppU2 ^ OMepC2 ^ OMepN, m 7 GpppU2 ^ OMepG2 ^ OMepN, and m 7 GpppU2 ^ OMepU2 ^ OMepN, where N is a natural, a modified, or an unnatural nucleoside base. [00380] In some embodiments, a cap comprises GGAG. In some embodiments, a cap comprises the following structure: (X). Attorney Docket No.45817-0124WO1 / MTX959.20 13. Poly-A Tails [00381] In some embodiments, the polynucleotides of the present disclosure (e.g., a polynucleotide comprising a nucleotide sequence encoding a Snu13 polypeptide) further comprise a poly-A tail. In further embodiments, terminal groups on the poly-A tail can be incorporated for stabilization. In other embodiments, a poly-A tail comprises des-3′ hydroxyl tails. [00382] During RNA processing, a long chain of adenine nucleotides (poly-A tail) can be added to a polynucleotide such as an mRNA molecule in order to increase stability. Immediately after transcription, the 3′ end of the transcript can be cleaved to free a 3′ hydroxyl. Then poly-A polymerase adds a chain of adenine nucleotides to the RNA. The process, called polyadenylation, adds a poly-A tail that can be between, for example, approximately 80 to approximately 250 residues long, including approximately 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240 or 250 residues long. In one embodiment, the poly-A tail is 100 nucleotides in length (SEQ ID NO:195). [00383] PolyA tails can also be added after the construct is exported from the nucleus. [00384] According to the present invention, terminal groups on the poly A tail can be incorporated for stabilization. Polynucleotides of the present invention can include des-3′ hydroxyl tails. They can also include structural moieties or 2'-Omethyl modifications as taught by Junjie Li, et al. (Current Biology, Vol.15, 1501–1507, August 23, 2005, the contents of which are incorporated herein by reference in its entirety). [00385] The polynucleotides of the present invention can be designed to encode transcripts with alternative polyA tail structures including histone mRNA. According to Norbury, "Terminal uridylation has also been detected on human replication- dependent histone mRNAs. The turnover of these mRNAs is thought to be important for the prevention of potentially toxic histone accumulation following the completion or inhibition of chromosomal DNA replication. These mRNAs are distinguished by their lack of a 3ʹ poly(A) tail, the function of which is instead assumed by a stable Attorney Docket No.45817-0124WO1 / MTX959.20 stem–loop structure and its cognate stem–loop binding protein (SLBP); the latter carries out the same functions as those of PABP on polyadenylated mRNAs" (Norbury, "Cytoplasmic RNA: a case of the tail wagging the dog," Nature Reviews Molecular Cell Biology; AOP, published online 29 August 2013; doi:10.1038/nrm3645) the contents of which are incorporated herein by reference in its entirety. [00386] Unique poly-A tail lengths provide certain advantages to the polynucleotides of the present invention. Generally, the length of a poly-A tail, when present, is greater than 30 nucleotides in length. In another embodiment, the poly-A tail is greater than 35 nucleotides in length (e.g., at least or greater than about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides). [00387] In some embodiments, the polynucleotide or region thereof includes from about 30 to about 3,000 nucleotides (e.g., from 30 to 50, from 30 to 100, from 30 to 250, from 30 to 500, from 30 to 750, from 30 to 1,000, from 30 to 1,500, from 30 to 2,000, from 30 to 2,500, from 50 to 100, from 50 to 250, from 50 to 500, from 50 to 750, from 50 to 1,000, from 50 to 1,500, from 50 to 2,000, from 50 to 2,500, from 50 to 3,000, from 100 to 500, from 100 to 750, from 100 to 1,000, from 100 to 1,500, from 100 to 2,000, from 100 to 2,500, from 100 to 3,000, from 500 to 750, from 500 to 1,000, from 500 to 1,500, from 500 to 2,000, from 500 to 2,500, from 500 to 3,000, from 1,000 to 1,500, from 1,000 to 2,000, from 1,000 to 2,500, from 1,000 to 3,000, from 1,500 to 2,000, from 1,500 to 2,500, from 1,500 to 3,000, from 2,000 to 3,000, from 2,000 to 2,500, and from 2,500 to 3,000). [00388] In some embodiments, the poly-A tail is designed relative to the length of the overall polynucleotide or the length of a particular region of the polynucleotide. This design can be based on the length of a coding region, the length of a particular feature or region or based on the length of the ultimate product expressed from the polynucleotides. [00389] In this context, the poly-A tail can be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% greater in length than the polynucleotide or feature thereof. The poly-A tail can also be designed as a fraction of the polynucleotides to which it belongs. In this Attorney Docket No.45817-0124WO1 / MTX959.20 context, the poly-A tail can be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the total length of the construct, a construct region or the total length of the construct minus the poly-A tail. Further, engineered binding sites and conjugation of polynucleotides for Poly-A binding protein can enhance expression. [00390] Additionally, multiple distinct polynucleotides can be linked together via the PABP (Poly-A binding protein) through the 3′-end using modified nucleotides at the 3′-terminus of the poly-A tail. Transfection experiments can be conducted in relevant cell lines at and protein production can be assayed by ELISA at 12hr, 24hr, 48hr, 72hr and day 7 post-transfection. [00391] In some embodiments, the polynucleotides of the present invention are designed to include a polyA-G Quartet region. The G-quartet is a cyclic hydrogen bonded array of four guanine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In this embodiment, the G-quartet is incorporated at the end of the poly-A tail. The resultant polynucleotide is assayed for stability, protein production and other parameters including half-life at various time points. It has been discovered that the polyA-G quartet results in protein production from an mRNA equivalent to at least 75% of that seen using a poly-A tail of 120 nucleotides alone (SEQ ID NO:196). [00392] In some embodiments, the polyA tail comprises an alternative nucleoside, e.g., inverted thymidine. PolyA tails comprising an alternative nucleoside, e.g., inverted thymidine, may be generated as described herein. For instance, mRNA constructs may be modified by ligation to stabilize the poly(A) tail. Ligation may be performed using 0.5-1.5 mg/mL mRNA (5′ Cap1, 3′ A100), 50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 1 mM TCEP, 1000 units/mL T4 RNA Ligase 1, 1 mM ATP, 20% w/v polyethylene glycol 8000, and 5:1 molar ratio of modifying oligo to mRNA. Modifying oligo has a sequence of 5’-phosphate-AAAAAAAAAAAAAAAAAAAA- (inverted deoxythymidine (idT) (SEQ ID NO:209)) (see below). Ligation reactions are mixed and incubated at room temperature (~22°C) for, e.g., 4 hours. Stable tail mRNA are purified by, e.g., dT purification, reverse phase purification, hydroxyapatite purification, ultrafiltration into water, and sterile filtration. The resulting stable tail-containing mRNAs contain the following structure at the 3’end, Attorney Docket No.45817-0124WO1 / MTX959.20 starting with the polyA region: A100-UCUAGAAAAAAAAAAAAAAAAAAAA- inverted deoxythymidine (SEQ ID NO:211). [00393] Modifying oligo to stabilize tail (5’-phosphate- AAAAAAAAAAAAAAAAAAAA-(inverted deoxythymidine)(SEQ ID NO:209)): [00394] In some instances, the polyA tail comprises A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211). In some instances, the polyA tail consists of A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211). 14. Start codon region [00395] The invention also includes a polynucleotide that comprises both a start codon region and the polynucleotide described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a Snu13 polypeptide). In some embodiments, the polynucleotides of the present invention can have regions that are analogous to or function like a start codon region. [00396] In some embodiments, the translation of a polynucleotide can initiate on a codon that is not the start codon AUG. Translation of the polynucleotide can initiate on an alternative start codon such as, but not limited to, ACG, AGG, AAG, CTG/CUG, GTG/GUG, ATA/AUA, ATT/AUU, TTG/UUG (see Touriol et al. Biology of the Cell 95 (2003) 169-178 and Matsuda and Mauro PLoS ONE, 2010 5:11; the contents of each of which are herein incorporated by reference in its entirety). Attorney Docket No.45817-0124WO1 / MTX959.20 [00397] As a non-limiting example, the translation of a polynucleotide begins on the alternative start codon ACG. As another non-limiting example, polynucleotide translation begins on the alternative start codon CTG or CUG. As yet another non- limiting example, the translation of a polynucleotide begins on the alternative start codon GTG or GUG. [00398] Nucleotides flanking a codon that initiates translation such as, but not limited to, a start codon or an alternative start codon, are known to affect the translation efficiency, the length and/or the structure of the polynucleotide. (See, e.g., Matsuda and Mauro PLoS ONE, 20105:11; the contents of which are herein incorporated by reference in its entirety). Masking any of the nucleotides flanking a codon that initiates translation can be used to alter the position of translation initiation, translation efficiency, length and/or structure of a polynucleotide. [00399] In some embodiments, a masking agent can be used near the start codon or alternative start codon in order to mask or hide the codon to reduce the probability of translation initiation at the masked start codon or alternative start codon. Non-limiting examples of masking agents include antisense locked nucleic acids (LNA) polynucleotides and exon-junction complexes (EJCs) (See, e.g., Matsuda and Mauro describing masking agents LNA polynucleotides and EJCs (PLoS ONE, 20105:11); the contents of which are herein incorporated by reference in its entirety). [00400] In another embodiment, a masking agent can be used to mask a start codon of a polynucleotide in order to increase the likelihood that translation will initiate on an alternative start codon. In some embodiments, a masking agent can be used to mask a first start codon or alternative start codon in order to increase the chance that translation will initiate on a start codon or alternative start codon downstream to the masked start codon or alternative start codon. [00401] In some embodiments, a start codon or alternative start codon can be located within a perfect complement for a miRNA binding site. The perfect complement of a miRNA binding site can help control the translation, length and/or structure of the polynucleotide similar to a masking agent. As a non-limiting example, the start codon or alternative start codon can be located in the middle of a perfect complement for a miRNA binding site. The start codon or alternative start codon can be located after the first nucleotide, second nucleotide, third nucleotide, fourth Attorney Docket No.45817-0124WO1 / MTX959.20 nucleotide, fifth nucleotide, sixth nucleotide, seventh nucleotide, eighth nucleotide, ninth nucleotide, tenth nucleotide, eleventh nucleotide, twelfth nucleotide, thirteenth nucleotide, fourteenth nucleotide, fifteenth nucleotide, sixteenth nucleotide, seventeenth nucleotide, eighteenth nucleotide, nineteenth nucleotide, twentieth nucleotide or twenty-first nucleotide. [00402] In another embodiment, the start codon of a polynucleotide can be removed from the polynucleotide sequence in order to have the translation of the polynucleotide begin on a codon that is not the start codon. Translation of the polynucleotide can begin on the codon following the removed start codon or on a downstream start codon or an alternative start codon. In a non-limiting example, the start codon ATG or AUG is removed as the first 3 nucleotides of the polynucleotide sequence in order to have translation initiate on a downstream start codon or alternative start codon. The polynucleotide sequence where the start codon was removed can further comprise at least one masking agent for the downstream start codon and/or alternative start codons in order to control or attempt to control the initiation of translation, the length of the polynucleotide and/or the structure of the polynucleotide. 15. Stop Codon Region [00403] The invention also includes a polynucleotide that comprises both a stop codon region and the polynucleotide described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a Snu13 polypeptide). In some embodiments, the polynucleotides of the present invention can include at least two stop codons before the 3′ untranslated region (UTR). The stop codon can be selected from TGA, TAA and TAG in the case of DNA, or from UGA, UAA and UAG in the case of RNA. In some embodiments, the polynucleotides of the present invention include the stop codon TGA in the case or DNA, or the stop codon UGA in the case of RNA, and one additional stop codon. In a further embodiment the addition stop codon can be TAA or UAA. In another embodiment, the polynucleotides of the present invention include three consecutive stop codons, four stop codons, or more. Attorney Docket No.45817-0124WO1 / MTX959.20 16. Combination of mRNA elements [00404] Any of the polynucleotides disclosed herein can comprise one, two, three, or all of the following elements: (a) a 5’-UTR, e.g., as described herein; (b) a coding region comprising a stop element (e.g., as described herein); (c) a 3’-UTR (e.g., as described herein) and; optionally (d) a 3’ stabilizing region, e.g., as described herein. Also disclosed herein are LNP compositions comprising the same. [00405] In an embodiment, a polynucleotide of the disclosure comprises (a) a 5’ UTR described in Table 4 or a variant or fragment thereof and (b) a coding region comprising a stop element provided herein. In an embodiment, the polynucleotide further comprises a cap structure, e.g., as described herein, or a poly A tail, e.g., as described herein. In an embodiment, the polynucleotide further comprises a 3’ stabilizing region, e.g., as described herein. [00406] In an embodiment, a polynucleotide of the disclosure comprises (a) a 5’ UTR described in Table 4 or a variant or fragment thereof and (c) a 3’ UTR described in Table 5 or Table 7 or a variant or fragment thereof. In an embodiment, the polynucleotide further comprises a cap structure, e.g., as described herein, or a poly A tail, e.g., as described herein. In an embodiment, the polynucleotide further comprises a 3’ stabilizing region, e.g., as described herein. [00407] In an embodiment, a polynucleotide of the disclosure comprises (c) a 3’ UTR described in Table 5 or Table 7 or a variant or fragment thereof and (b) a coding region comprising a stop element provided herein. In an embodiment, the polynucleotide comprises a sequence provided in Table 7. In an embodiment, the polynucleotide further comprises a cap structure, e.g., as described herein, or a poly A tail, e.g., as described herein. In an embodiment, the polynucleotide further comprises a 3’ stabilizing region, e.g., as described herein. [00408] In an embodiment, a polynucleotide of the disclosure comprises (a) a 5’ UTR described in Table 4 or a variant or fragment thereof; (b) a coding region comprising a stop element provided herein; and (c) a 3’ UTR described in Table 5 or Table 7 or a variant or fragment thereof. In an embodiment, the polynucleotide further comprises a cap structure, e.g., as described herein, or a poly A tail, e.g., as Attorney Docket No.45817-0124WO1 / MTX959.20 described herein. In an embodiment, the polynucleotide further comprises a 3’ stabilizing region, e.g., as described herein. [00409] Table 7: Exemplary 3’ UTR and stop element sequences SEQ ID Sequence NO information Sequence U C U U C U U C U U C U U C U U C U U C U U C U U C U U G C C Attorney Docket No.45817-0124WO1 / MTX959.20 CCCUCCAUAAAGUAGGAAACACUACAGUGGUC UUUGAAUAAAGUCUGAGUGGGCGGC ’ C C C U G C C C U G C U C C C G C C C U G U C U 17. Identification and Ratio Determination (IDR) Sequences [00410] An Identification and Ratio Determination (IDR) sequence is a sequence of a biological molecule (e.g., nucleic acid or protein) that, when combined with the sequence of a target biological molecule, serves to identify the target biological molecule. Typically, an IDR sequence is a heterologous sequence that is incorporated within or appended to a sequence of a target biological molecule and can be used as a reference to identify the target molecule. Thus, in some embodiments, a nucleic acid (e.g., mRNA) comprises (i) a target sequence of interest (e.g., a coding sequence Attorney Docket No.45817-0124WO1 / MTX959.20 encoding a therapeutic and/or antigenic peptide or protein); and (ii) a unique IDR sequence. [00411] An RNA species (e.g., RNA having a given coding sequence) may comprise an IDR sequence that differs from the IDR sequence of other RNA species (e.g., RNA(s) having different coding sequence(s)). Each IDR sequence thus identifies a particular RNA species, and so the abundance of IDR sequences may be measured to determine the abundance of each RNA species in a composition. Use of distinct IDR sequences to identify RNA species allows for analysis of multivalent RNA compositions (e.g., containing multiple RNA species) containing RNA species with similar coding sequences and/or lengths, which could otherwise be difficult to distinguish using PCR- or chromatography-based analysis of full-length RNAs. [00412] Each RNA species in a multivalent RNA composition may comprise an IDR sequence that is not a sequence isomer of an IDR sequence of another RNA species in a multivalent RNA composition (e.g., the IDR sequence does not have the same number of adenosine nucleotides, the same number of cytosine nucleotides, the same number of guanine nucleotides, and the same number of uracil nucleotides, as another IDR sequence in the composition, even if those sequences have different sequences). Having identical nucleotide compositions causes sequence isomers to have the same mass, presenting a challenge to distinguishing sequence isomers using mass-based identification methods (e.g., mass spectrometry). [00413] Each RNA species in a multivalent RNA composition may comprise an IDR sequence having a mass that differs from the mass of IDR sequences of each other RNA species in a multivalent RNA composition. For example, the mass of each IDR sequence may differ from the mass of other IDR sequences by at least 9 Da, at least 25 Da, at least 25 Da, or at least 50 Da. Use of IDR sequences with distinct masses allows RNA fragments comprising different IDR sequences to be distinguished using mass-based analysis methods (e.g., mass spectrometry), which do not require reverse transcription, amplification, or sequencing of RNAs. [00414] Each RNA species in an RNA composition may comprises an IDR sequence with a different length. For example, each IDR sequence may have a length independently selected from 0 to 25 nucleotides. The length of a nucleic acid influences the rate at which the nucleic acid traverses a chromatography column, and Attorney Docket No.45817-0124WO1 / MTX959.20 so the use of IDR sequences of different lengths on different RNA species allows RNA fragments having different IDR sequences to be distinguished using chromatography-based methods (e.g., LC-UV). [00415] IDR sequences may be chosen such that no IDR sequence comprises a start codon, ‘AUG’. Lack of a start codon in an IDR sequence prevents undesired translation of nucleotide sequences within and/or downstream from the IDR sequence. [00416] IDR sequences may be chosen such that no IDR sequence comprises a recognition site for a restriction enzyme. In one example, no IDR sequence comprises a recognition site for XbaI, ‘UCUAG’. Lack of a recognition site for a restriction enzyme (e.g., XbaI recognition site ‘UCUAG’) allows the restriction enzyme to be used in generating and modifying a DNA template for in vitro transcription, without affecting the IDR sequence or sequence of the transcribed RNA. 18. Polynucleotide Comprising an mRNA Encoding a Snu13 Polypeptide [00417] In certain embodiments, a polynucleotide of the present disclosure, e.g., an mRNA, comprises from 5′ to 3′ end: (i) a 5′ cap; (ii) a 5′ UTR; (iii) an ORF encoding a polypeptide comprising any one of SEQ ID NOs:320- 373; (iv) at least one stop codon; (v) a 3′ UTR; and (vi) a poly-A tail. [00418] In certain embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a Snu13 polypeptide, comprises from 5′ to 3′ end: (i) a 5′ cap such as provided above; (ii) a 5′ UTR, such as provided above; (iii) an ORF encoding a polypeptide comprising a Snu13 polypeptide (e.g., any one of SEQ ID NOs:320-373), wherein the ORF comprises a sequence that has at least 65%, at least 70%, at least 75%, at least 80%, at least 85, at least 90%, at least Attorney Docket No.45817-0124WO1 / MTX959.20 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence of any one of SEQ ID NOs: 300-317; (iv) at least one stop codon; (v) a 3′ UTR, such as the sequences provided above; and (vi) a poly-A tail provided above. [00419] In certain embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a Snu13 polypeptide, comprises from 5′ to 3′ end: (i) a 5′ cap such as provided above; (ii) a 5′ UTR such as provided above; (iii) an ORF comprising the sequence of any one of SEQ ID NOs:300-317; (iv) at least one stop codon; (v) a 3′ UTR such as provided above; and (vi) a poly-A tail provided above. [00420] In certain embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a Snu13 polypeptide, comprises from 5′ to 3′ end: (i) a 5′ cap such as provided above; (ii) a 5′ UTR comprising the sequence set forth in SEQ ID NO:50; (iii) an ORF encoding a Snu13 polypeptide (e.g., any one of SEQ ID NOs:320-373), wherein the ORF has at least 65%, at least 70%, at least 75%, at least 80%, at least 85, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence of any one of SEQ ID NOs: 300-317; (iv) at least one stop codon; (v) a 3′ UTR comprising the sequence set forth in SEQ ID NO:108; and (vi) a poly-A tail provided above. [00421] In certain embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a Snu13 polypeptide, comprises from 5′ to 3′ end: (i) a 5′ cap such as provided above; (ii) a 5′ UTR comprising the sequence set forth in SEQ ID NO:50; Attorney Docket No.45817-0124WO1 / MTX959.20 (iii) an ORF encoding a Snu13 polypeptide (e.g., any one of SEQ ID NOs:320-373), wherein the ORF has at least 65%, at least 70%, at least 75%, at least 80%, at least 85, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence of any one of SEQ ID NOs: 300-317; (iv) at least one stop codon; (v) a 3′ UTR comprising the sequence set forth in SEQ ID NO:139; and (vi) a poly-A tail provided above. [00422] In some embodiments, the polynucleotide further comprises a miRNA binding site, e.g., a miRNA binding site that binds to miRNA-142. In some embodiments, the 3′ UTR comprises the miRNA binding site. [00423] In some embodiments, a polynucleotide of the present disclosure comprises a nucleotide sequence encoding a polypeptide sequence at least 65%, at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% , at least 97%, at least 98%, at least 99%, or 100% identical to the protein sequence of a variant Snu13 polypeptide described herein (e.g., any one of SEQ ID NOs:320-373, wherein the encoded polypeptide retains the substitutions present any one of SEQ ID NOs:320- 373, respectively, relative to wild type Snu13). [00424] In some embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a polypeptide, comprises (1) a 5′ cap such as provided above, for example, m7Gp- ppGm-A, (2) a 5′ UTR, (3) a nucleotide sequence ORF comprising the sequence of any one of SEQ ID NOs: 300-317, (3) a stop codon, (4) a 3′UTR, and (5) a poly-A tail provided above, for example, a poly-A tail of SEQ ID NO:195 or A100-UCUAG- A20-inverted deoxy-thymidine (SEQ ID NO:211). [00425] Exemplary Snu13 nucleotide constructs are described below: SEQ ID NO: 374 consists from 5′ to 3′ end: 5′ UTR of SEQ ID NO: 50, Snu13 nucleotide ORF of SEQ ID NO: 300, and 3′ UTR of SEQ ID NO: 108. SEQ ID NO: 375 consists from 5′ to 3′ end: 5′ UTR of SEQ ID NO: 50, Snu13 nucleotide ORF of SEQ ID NO: 301, and 3′ UTR of SEQ ID NO: 108. Attorney Docket No.45817-0124WO1 / MTX959.20 SEQ ID NO: 376 consists from 5′ to 3′ end: 5′ UTR of SEQ ID NO: 50, Snu13 nucleotide ORF of SEQ ID NO: 302, and 3′ UTR of SEQ ID NO: 108. SEQ ID NO: 377 consists from 5′ to 3′ end: 5′ UTR of SEQ ID NO: 50, Snu13 nucleotide ORF of SEQ ID NO: 303, and 3′ UTR of SEQ ID NO: 108. SEQ ID NO: 378 consists from 5′ to 3′ end: 5′ UTR of SEQ ID NO: 50, Snu13 nucleotide ORF of SEQ ID NO: 304, and 3′ UTR of SEQ ID NO: 108. SEQ ID NO: 379 consists from 5′ to 3′ end: 5′ UTR of SEQ ID NO: 50, Snu13 nucleotide ORF of SEQ ID NO: 305, and 3′ UTR of SEQ ID NO: 108. SEQ ID NO: 380 consists from 5′ to 3′ end: 5′ UTR of SEQ ID NO: 50, Snu13 nucleotide ORF of SEQ ID NO: 306, and 3′ UTR of SEQ ID NO: 108. SEQ ID NO: 381 consists from 5′ to 3′ end: 5′ UTR of SEQ ID NO: 50, Snu13 nucleotide ORF of SEQ ID NO: 307, and 3′ UTR of SEQ ID NO: 108. SEQ ID NO: 382 consists from 5′ to 3′ end: 5′ UTR of SEQ ID NO: 50, Snu13 nucleotide ORF of SEQ ID NO: 308, and 3′ UTR of SEQ ID NO: 108. SEQ ID NO: 383 consists from 5′ to 3′ end: 5′ UTR of SEQ ID NO: 50, Snu13 nucleotide ORF of SEQ ID NO: 309, and 3′ UTR of SEQ ID NO: 108. SEQ ID NO: 384 consists from 5′ to 3′ end: 5′ UTR of SEQ ID NO: 50, Snu13 nucleotide ORF of SEQ ID NO: 310, and 3′ UTR of SEQ ID NO: 108. SEQ ID NO: 385 consists from 5′ to 3′ end: 5′ UTR of SEQ ID NO: 50, Snu13 nucleotide ORF of SEQ ID NO: 311, and 3′ UTR of SEQ ID NO: 108. SEQ ID NO: 386 consists from 5′ to 3′ end: 5′ UTR of SEQ ID NO: 50, Snu13 nucleotide ORF of SEQ ID NO: 312, and 3′ UTR of SEQ ID NO: 108. SEQ ID NO: 387 consists from 5′ to 3′ end: 5′ UTR of SEQ ID NO: 50, Snu13 nucleotide ORF of SEQ ID NO: 313, and 3′ UTR of SEQ ID NO: 108. SEQ ID NO: 388 consists from 5′ to 3′ end: 5′ UTR of SEQ ID NO: 50, Snu13 nucleotide ORF of SEQ ID NO: 314, and 3′ UTR of SEQ ID NO: 108. SEQ ID NO: 389 consists from 5′ to 3′ end: 5′ UTR of SEQ ID NO: 50, Snu13 nucleotide ORF of SEQ ID NO: 315, and 3′ UTR of SEQ ID NO: 108. SEQ ID NO: 390 consists from 5′ to 3′ end: 5′ UTR of SEQ ID NO: 50, Snu13 nucleotide ORF of SEQ ID NO: 316, and 3′ UTR of SEQ ID NO: 108. SEQ ID NO: 391 consists from 5′ to 3′ end: 5′ UTR of SEQ ID NO: 50, Snu13 nucleotide ORF of SEQ ID NO: 317, and 3′ UTR of SEQ ID NO: 108. Attorney Docket No.45817-0124WO1 / MTX959.20 [00426] Additional exemplary Snu13 nucleotide constructs include SEQ ID NOs:374-391, except wherein the construct has 3′ UTR of SEQ ID NO: 139 instead of SEQ ID NO:108. [00427] In certain embodiments, all uracils therein are replaced by N1 methylpseudouracil. [00428] In certain embodiments, all uracils therein are replaced by 5- methoxyuracil. [00429] In some embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a Snu13 polypeptide, comprises (1) a 5′ cap such as provided above, for example, m 7 Gp-ppGm-A, (2) a nucleotide sequence of any one of SEQ ID NOs: 374-391, and (3) a poly-A tail provided above, for example, a poly A tail of ~100 residues, e.g., SEQ ID NO:195 or A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211). In certain embodiments, all uracils therein are replaced by N1- methylpseudouracil. In certain embodiments, all uracils therein are replaced by 5- methoxyuracil. [00430] Table 8 – Modified mRNA constructs including ORFs encoding Snu13 (constructs comprise an m 7 Gp-ppGm-A 5′ terminal cap and a 3′ terminal PolyA region) Snu13 mRNA 5′UTR Snu13 ORF 3′ UTR construct SEQ ID Name SEQ ID SEQ ID Attorney Docket No.45817-0124WO1 / MTX959.20 Snu13 mRNA 5′UTR Snu13 ORF 3′ UTR construct SEQ ID Name SEQ ID SEQ ID 19. Methods of Making Polynucleotides [00431] The present disclosure also provides methods for making a polynucleotide of the invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a Snu13 polypeptide) or a complement thereof. [00432] In some aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and encoding a Snu13 polypeptide, can be constructed using in vitro transcription (IVT). In other aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and encoding a Snu13 polypeptide, can be constructed by chemical synthesis using an oligonucleotide synthesizer. [00433] In other aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and encoding a Snu13 polypeptide is made by using a host cell. In certain aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and Attorney Docket No.45817-0124WO1 / MTX959.20 encoding a Snu13 polypeptide is made by one or more combination of the IVT, chemical synthesis, host cell expression, or any other methods known in the art. [00434] Naturally occurring nucleosides, non-naturally occurring nucleosides, or combinations thereof, can totally or partially naturally replace occurring nucleosides present in the candidate nucleotide sequence and can be incorporated into a sequence- optimized nucleotide sequence (e.g., a RNA, e.g., an mRNA) encoding a Snu13 polypeptide. The resultant polynucleotides, e.g., mRNAs, can then be examined for their ability to produce protein and/or produce a therapeutic outcome. a. In Vitro Transcription / Enzymatic Synthesis [00435] The present disclosure also provides methods for making a polynucleotide disclosed herein or a complement thereof. In some aspects, a polynucleotide (e.g., an mRNA) disclosed herein can be constructed using in vitro transcription. [00436] In other aspects, a polynucleotide (e.g., an mRNA) disclosed herein can be constructed by chemical synthesis using an oligonucleotide synthesizer. In other aspects, a polynucleotide (e.g., an mRNA) disclosed herein is made by using a host cell. In certain aspects, a polynucleotide (e.g., an mRNA) disclosed herein is made by one or more combination of the IVT, chemical synthesis, host cell expression, or any other methods known in the art. [00437] Naturally occurring nucleosides, non-naturally occurring nucleosides, or combinations thereof, can totally or partially naturally replace occurring nucleosides present in the candidate nucleotide sequence and can be incorporated into a sequence- optimized nucleotide sequence (e.g., an mRNA) encoding a Snu13 polypeptide. The resultant mRNAs can then be examined for their ability to produce Snu13 and/or produce a therapeutic outcome. [00438] While RNA can be made synthetically using methods well known in the art, in one embodiment an RNA transcript (e.g., mRNA transcript) is synthesized by contacting a DNA template with a RNA polymerase (e.g., a T7 RNA polymerase or a T7 RNA polymerase variant) under conditions that result in the production of RNA transcript. [00439] In some aspects, the present disclosure provides methods of performing an IVT (in vitro transcription) reaction, comprising contacting a DNA template with the Attorney Docket No.45817-0124WO1 / MTX959.20 RNA polymerase (e.g., a T7 RNA polymerase, such as a T7 RNA polymerase variant) in the presence of nucleoside triphosphates and buffer under conditions that result in the production of RNA transcripts. [00440] Other aspects of the present disclosure provide capping methods, e.g., co- transcriptional capping methods or other methods known in the art. In one embodiment, a capping method comprises reacting a polynucleotide template with a T7 RNA polymerase variant, nucleoside triphosphates, and a cap analog under in vitro transcription reaction conditions to produce RNA transcript. [00441] IVT conditions typically require a purified linear DNA template containing a promoter, nucleoside triphosphates, a buffer system that includes dithiothreitol (DTT) and magnesium ions, and a RNA polymerase. The exact conditions used in the transcription reaction depend on the amount of RNA needed for a specific application. Typical IVT reactions are performed by incubating a DNA template with a RNA polymerase and nucleoside triphosphates, including GTP, ATP, CTP, and UTP (or nucleotide analogs) in a transcription buffer. A RNA transcript having a 5 ^ terminal guanosine triphosphate is produced from this reaction. [00442] A deoxyribonucleic acid (DNA) is simply a nucleic acid template for RNA polymerase. A DNA template may include a polynucleotide encoding a Snu13 polypeptide. A DNA template, in some embodiments, includes a RNA polymerase promoter (e.g., a T7 RNA polymerase promoter) located 5' from and operably linked to polynucleotide encoding a Snu13 polypeptide. A DNA template may also include a nucleotide sequence encoding a polyadenylation (polyA) tail located at the 3' end of the gene of interest. [00443] Polypeptides of interest include, but are not limited to, biologics, antibodies, antigens (vaccines), and therapeutic proteins. The term “protein” encompasses peptides. [00444] A RNA transcript, in some embodiments, is the product of an IVT reaction and, as will be understood by one of ordinary skill in the art, the DNA template for making an RNA molecule is known based on base complementarity. A RNA transcript, in some embodiments, is a messenger RNA (mRNA) that includes a nucleotide sequence encoding a polypeptide of interest linked to a polyA tail. In some Attorney Docket No.45817-0124WO1 / MTX959.20 embodiments, the mRNA is modified mRNA (mmRNA), which includes at least one modified nucleotide. [00445] A nucleotide includes a nitrogenous base, a five-carbon sugar (ribose or deoxyribose), and at least one phosphate group. Nucleotides include nucleoside monophosphates, nucleoside diphosphates, and nucleoside triphosphates. A nucleoside monophosphate (NMP) includes a nucleobase linked to a ribose and a single phosphate; a nucleoside diphosphate (NDP) includes a nucleobase linked to a ribose and two phosphates; and a nucleoside triphosphate (NTP) includes a nucleobase linked to a ribose and three phosphates. Nucleotide analogs are compounds that have the general structure of a nucleotide or are structurally similar to a nucleotide. Nucleotide analogs, for example, include an analog of the nucleobase, an analog of the sugar and/or an analog of the phosphate group(s) of a nucleotide. [00446] A nucleoside includes a nitrogenous base and a 5-carbon sugar. Thus, a nucleoside plus a phosphate group yields a nucleotide. Nucleoside analogs are compounds that have the general structure of a nucleoside or are structurally similar to a nucleoside. Nucleoside analogs, for example, include an analog of the nucleobase and/or an analog of the sugar of a nucleoside. [00447] It should be understood that the term “nucleotide” includes naturally- occurring nucleotides, synthetic nucleotides and modified nucleotides, unless indicated otherwise. Examples of naturally-occurring nucleotides used for the production of RNA, e.g., in an IVT reaction, as provided herein include adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytidine triphosphate (CTP), uridine triphosphate (UTP), and 5-methyluridine triphosphate (m 5 UTP). In some embodiments, adenosine diphosphate (ADP), guanosine diphosphate (GDP), cytidine diphosphate (CDP), and/or uridine diphosphate (UDP) are used. [00448] Examples of nucleotide analogs include, but are not limited to, antiviral nucleotide analogs, phosphate analogs (soluble or immobilized, hydrolyzable or non- hydrolyzable), dinucleotide, trinucleotide, tetranucleotide, e.g., a cap analog, or a precursor/substrate for enzymatic capping (vaccinia or ligase), a nucleotide labeled with a functional group to facilitate ligation/conjugation of cap or 5 ^ moiety (IRES), a nucleotide labeled with a 5 ^ PO4 to facilitate ligation of cap or 5 ^ moiety, or a nucleotide labeled with a functional group/protecting group that can be chemically or Attorney Docket No.45817-0124WO1 / MTX959.20 enzymatically cleaved. Examples of antiviral nucleotide/nucleoside analogs include, but are not limited, to Ganciclovir, Entecavir, Telbivudine, Vidarabine and Cidofovir. [00449] Modified nucleotides may include modified nucleobases. For example, a RNA transcript (e.g., mRNA transcript) of the present disclosure may include a modified nucleobase selected from pseudouridine (ψ), 1-methylpseudouridine (m1ψ), 1-ethylpseudouridine, 2-thiouridine, 4’-thiouridine, 2-thio-1-methyl-1-deaza- pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine , 2-thio- dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2- thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio- pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5- methoxyuridine (mo5U) and 2’-O-methyl uridine. In some embodiments, a RNA transcript (e.g., mRNA transcript) includes a combination of at least two (e.g., 2, 3, 4 or more) of the foregoing modified nucleobases. [00450] The nucleoside triphosphates (NTPs) as provided herein may comprise unmodified or modified ATP, modified or unmodified UTP, modified or unmodified GTP, and/or modified or unmodified CTP. In some embodiments, NTPs of an IVT reaction comprise unmodified ATP. In some embodiments, NTPs of an IVT reaction comprise modified ATP. In some embodiments, NTPs of an IVT reaction comprise unmodified UTP. In some embodiments, NTPs of an IVT reaction comprise modified UTP. In some embodiments, NTPs of an IVT reaction comprise unmodified GTP. In some embodiments, NTPs of an IVT reaction comprise modified GTP. In some embodiments, NTPs of an IVT reaction comprise unmodified CTP. In some embodiments, NTPs of an IVT reaction comprise modified CTP. [00451] The concentration of nucleoside triphosphates and cap analog present in an IVT reaction may vary. In some embodiments, NTPs and cap analog are present in the reaction at equimolar concentrations. In some embodiments, the molar ratio of cap analog (e.g., trinucleotide cap) to nucleoside triphosphates in the reaction is greater than 1:1. For example, the molar ratio of cap analog to nucleoside triphosphates in the reaction may be 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 15:1, 20:1, 25:1, 50:1, or 100:1. In some embodiments, the molar ratio of cap analog (e.g., trinucleotide cap) to nucleoside triphosphates in the reaction is less than 1:1. For example, the molar ratio Attorney Docket No.45817-0124WO1 / MTX959.20 of cap analog (e.g., trinucleotide cap) to nucleoside triphosphates in the reaction may be 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:50, or 1:100. [00452] The composition of NTPs in an IVT reaction may also vary. For example, ATP may be used in excess of GTP, CTP and UTP. As a non-limiting example, an IVT reaction may include 7.5 millimolar GTP, 7.5 millimolar CTP, 7.5 millimolar UTP, and 3.75 millimolar ATP. The same IVT reaction may include 3.75 millimolar cap analog (e.g., trinucleotide cap). In some embodiments, the molar ratio of G:C:U:A:cap is 1:1:1:0.5:0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 1:1:0.5:1:0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 1:0.5:1:1:0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 0.5:1:1:1:0.5. [00453] In some embodiments, a RNA transcript (e.g., mRNA transcript) includes a modified nucleobase selected from pseudouridine (ψ), 1-methylpseudouridine (m 1 ψ), 5-methoxyuridine (mo 5 U), 5-methylcytidine (m 5 C), α-thio-guanosine and α- In some embodiments, a RNA transcript (e.g., mRNA transcript) includes a combination of at least two (e.g., 2, 3, 4 or more) of the foregoing modified nucleobases. [00454] In some embodiments, a RNA transcript (e.g., mRNA transcript) includes pseudouridine (ψ). In some embodiments, a RNA transcript (e.g., mRNA transcript) includes 1-methylpseudouridine (m 1 ψ). In some embodiments, a RNA transcript (e.g., mRNA transcript) includes 5-methoxyuridine (mo 5 U). In some embodiments, a RNA transcript (e.g., mRNA transcript) includes 5-methylcytidine (m 5 C). In some embodiments, a RNA transcript (e.g., mRNA transcript) includes α-thio-guanosine. In some embodiments, a RNA transcript (e.g., mRNA transcript) includes α-thio- adenosine. [00455] In some embodiments, the polynucleotide (e.g., RNA polynucleotide, such as mRNA polynucleotide) is uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. For example, a polynucleotide can be uniformly modified with 1-methylpseudouridine (m 1 ψ), meaning that all uridine residues in the mRNA sequence are replaced methylpseudouridine (m 1 ψ). Similarly, a polynucleotide can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as any of those set forth above. Alternatively, the Attorney Docket No.45817-0124WO1 / MTX959.20 polynucleotide (e.g., RNA polynucleotide, such as mRNA polynucleotide) may not be uniformly modified (e.g., partially modified, part of the sequence is modified). Each possibility represents a separate embodiment of the present invention. [00456] In some embodiments, the buffer system contains tris. The concentration of tris used in an IVT reaction, for example, may be at least 10 mM, at least 20 mM, at least 30 mM, at least 40 mM, at least 50 mM, at least 60 mM, at least 70 mM, at least 80 mM, at least 90 mM, at least 100 mM or at least 110 mM phosphate. In some embodiments, the concentration of phosphate is 20-60 mM or 10-100 mM. [00457] In some embodiments, the buffer system contains dithiothreitol (DTT). The concentration of DTT used in an IVT reaction, for example, may be at least 1 mM, at least 5 mM, or at least 50 mM. In some embodiments, the concentration of DTT used in an IVT reaction is 1-50 mM or 5-50 mM. In some embodiments, the concentration of DTT used in an IVT reaction is 5 mM. [00458] In some embodiments, the buffer system contains magnesium. In some embodiments, the molar ratio of NTP to magnesium ions (Mg 2+ ; e.g., MgCl 2 ) present in an IVT reaction is 1:1 to 1:5. For example, the molar ratio of NTP to magnesium ions may be 1:1, 1:2, 1:3, 1:4 or 1:5. [00459] In some embodiments, the molar ratio of NTP plus cap analog (e.g., trinucleotide cap, such as GAG) to magnesium ions (Mg 2+ ; e.g., MgCl 2 ) present in an IVT reaction is 1:1 to 1:5. For example, the molar ratio of NTP+trinucleotide cap (e.g., GAG) to magnesium ions may be 1:1, 1:2, 1:3, 1:4 or 1:5. [00460] In some embodiments, the buffer system contains Tris-HCl, spermidine (e.g., at a concentration of 1-30 mM), TRITON ® X-100 (polyethylene glycol p- (1,1,3,3-tetramethylbutyl)-phenyl ether) and/or polyethylene glycol (PEG). [00461] The addition of nucleoside triphosphates (NTPs) to the 3 ^ end of a growing RNA strand is catalyzed by a polymerase, such as T7 RNA polymerase, for example, any one or more of the T7 RNA polymerase variants (e.g., G47A) of the present disclosure. In some embodiments, the RNA polymerase (e.g., T7 RNA polymerase variant) is present in a reaction (e.g., an IVT reaction) at a concentration of 0.01 mg/ml to 1 mg/ml. For example, the RNA polymerase may be present in a reaction at a concentration of 0.01 mg/mL, 0.05 mg/ml, 0.1 mg/ml, 0.5 mg/ml or 1.0 mg/ml. Attorney Docket No.45817-0124WO1 / MTX959.20 [00462] In some embodiments, the polynucleotide of the present disclosure is an IVT polynucleotide. Traditionally, the basic components of an mRNA molecule include at least a coding region, a 5′UTR, a 3′UTR, a 5′ cap and a poly-A tail. The IVT polynucleotides of the present disclosure can function as mRNA but are distinguished from wild-type mRNA in their functional and/or structural design features which serve, e.g., to overcome existing problems of effective polypeptide production using nucleic-acid based therapeutics. [00463] The primary construct of an IVT polynucleotide comprises a first region of linked nucleotides that is flanked by a first flanking region and a second flaking region. This first region can include, but is not limited to, the encoded Snu13 polypeptide. The first flanking region can include a sequence of linked nucleosides which function as a 5’ untranslated region (UTR) such as the 5’ UTR of SEQ ID NO:58. The IVT encoding a Snu13 polypeptide can comprise at its 5 terminus a signal sequence region encoding one or more signal sequences. The flanking region can comprise a region of linked nucleotides comprising one or more complete or incomplete 5′ UTRs sequences. The flanking region can also comprise a 5′ terminal cap. The second flanking region can comprise a region of linked nucleotides comprising one or more complete or incomplete 3′ UTRs which can encode the native 3’ UTR of a Snu13 polypeptide, or a non-native 3’ UTR such as, but not limited to, a heterologous 3’ UTR or a synthetic 3’ UTR. The flanking region can also comprise a 3′ tailing sequence. The 3’ tailing sequence can be, but is not limited to, a polyA tail, a polyA-G quartet and/or a stem loop sequence. [00464] Additional and exemplary features of IVT polynucleotide architecture and methods of making a polynucleotide are disclosed in International PCT application WO 2017/201325, filed on 18 May 2017, the entire contents of which are hereby incorporated by reference. b. Chemical synthesis [00465] Standard methods can be applied to synthesize an isolated polynucleotide sequence encoding an isolated polypeptide of interest, such as a polynucleotide of the invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a Snu13 polypeptide). For example, a single DNA or RNA oligomer containing a codon- Attorney Docket No.45817-0124WO1 / MTX959.20 optimized nucleotide sequence coding for the particular isolated polypeptide can be synthesized. In other aspects, several small oligonucleotides coding for portions of the desired polypeptide can be synthesized and then ligated. In some aspects, the individual oligonucleotides typically contain 5′ or 3′ overhangs for complementary assembly. [00466] A polynucleotide disclosed herein (e.g., a RNA, e.g., an mRNA) can be chemically synthesized using chemical synthesis methods and potential nucleobase substitutions known in the art. See, for example, International Publication Nos. WO2014093924, WO2013052523; WO2013039857, WO2012135805, WO2013151671; U.S. Publ. No. US20130115272; or U.S. Pat. Nos. US8999380 or US8710200, all of which are herein incorporated by reference in their entireties. c. Quantification of Expressed Polynucleotides Encoding Snu13 [00467] In some embodiments, the polynucleotides of the present invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a Snu13 polypeptide), their expression products, as well as degradation products and metabolites can be quantified according to methods known in the art. [00468] In some embodiments, the polynucleotides of the present invention can be quantified in exosomes or when derived from one or more bodily fluid. As used herein "bodily fluids" include peripheral blood, serum, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper's fluid or pre-ejaculatory fluid, sweat, fecal matter, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, bronchopulmonary aspirates, blastocyl cavity fluid, and umbilical cord blood. Alternatively, exosomes can be retrieved from an organ selected from the group consisting of lung, heart, pancreas, stomach, intestine, bladder, kidney, ovary, testis, skin, colon, breast, prostate, brain, esophagus, liver, and placenta. [00469] In the exosome quantification method, a sample of not more than 2mL is obtained from the subject and the exosomes isolated by size exclusion Attorney Docket No.45817-0124WO1 / MTX959.20 chromatography, density gradient centrifugation, differential centrifugation, nanomembrane ultrafiltration, immunoabsorbent capture, affinity purification, microfluidic separation, or combinations thereof. In the analysis, the level or concentration of a polynucleotide can be an expression level, presence, absence, truncation or alteration of the administered construct. It is advantageous to correlate the level with one or more clinical phenotypes or with an assay for a human disease biomarker. [00470] The assay can be performed using construct specific probes, cytometry, qRT-PCR, real-time PCR, PCR, flow cytometry, electrophoresis, mass spectrometry, or combinations thereof while the exosomes can be isolated using immunohistochemical methods such as enzyme linked immunosorbent assay (ELISA) methods. Exosomes can also be isolated by size exclusion chromatography, density gradient centrifugation, differential centrifugation, nanomembrane ultrafiltration, immunoabsorbent capture, affinity purification, microfluidic separation, or combinations thereof. [00471] These methods afford the investigator the ability to monitor, in real time, the level of polynucleotides remaining or delivered. This is possible because the polynucleotides of the present invention differ from the endogenous forms due to the structural or chemical modifications. [00472] In some embodiments, the polynucleotide can be quantified using methods such as, but not limited to, ultraviolet visible spectroscopy (UV/Vis). A non-limiting example of a UV/Vis spectrometer is a NANODROP® spectrometer (ThermoFisher, Waltham, MA). The quantified polynucleotide can be analyzed in order to determine if the polynucleotide can be of proper size, check that no degradation of the polynucleotide has occurred. Degradation of the polynucleotide can be checked by methods such as, but not limited to, agarose gel electrophoresis, HPLC based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), liquid chromatography-mass spectrometry (LCMS), capillary electrophoresis (CE) and capillary gel electrophoresis (CGE). Attorney Docket No.45817-0124WO1 / MTX959.20 20. Pharmaceutical Compositions and Formulations [00473] The present invention provides pharmaceutical compositions and formulations that comprise any of the polynucleotides described above. In some embodiments, the composition or formulation further comprises a delivery agent. [00474] In some embodiments, the composition or formulation can contain a polynucleotide comprising a sequence optimized nucleic acid sequence disclosed herein which encodes a Snu13 polypeptide. In some embodiments, the composition or formulation can contain a polynucleotide comprising a sequence optimized nucleic acid sequence disclosed herein which encodes a Snu13 polypeptide and a polynucleotide comprising a sequence optimized nucleic acid sequence comprising a Snu13-binding site (e.g., a sequence set forth in any one of SEQ ID NOs:500-521, e.g., SEQ ID NO:500) and an ORF encoding a second polypeptide. In some embodiments, the composition or formulation can contain a polynucleotide (e.g., a RNA, e.g., an mRNA) comprising a polynucleotide (e.g., an ORF) having significant sequence identity to a sequence optimized nucleic acid sequence disclosed herein which encodes a Snu13polypeptide. In some embodiments, the polynucleotide further comprises a miRNA binding site, e.g., a miRNA binding site that binds miR-126, miR-142, miR-144, miR-146, miR-150, miR-155, miR-16, miR-21, miR-223, miR- 24, miR-27 and miR-26a. [00475] Pharmaceutical compositions or formulation can optionally comprise one or more additional active substances, e.g., therapeutically and/or prophylactically active substances. Pharmaceutical compositions or formulation of the present invention can be sterile and/or pyrogen-free. General considerations in the formulation and/or manufacture of pharmaceutical agents can be found, for example, in Remington: The Science and Practice of Pharmacy 21 st ed., Lippincott Williams & Wilkins, 2005 (incorporated herein by reference in its entirety). In some embodiments, compositions are administered to humans, human patients or subjects. For the purposes of the present disclosure, the phrase "active ingredient" generally refers to polynucleotides to be delivered as described herein. [00476] Formulations and pharmaceutical compositions described herein can be prepared by any method known or hereafter developed in the art of pharmacology. In Attorney Docket No.45817-0124WO1 / MTX959.20 general, such preparatory methods include the step of associating the active ingredient with an excipient and/or one or more other accessory ingredients, and then, if necessary and/or desirable, dividing, shaping and/or packaging the product into a desired single- or multi-dose unit. [00477] A pharmaceutical composition or formulation in accordance with the present disclosure can be prepared, packaged, and/or sold in bulk, as a single unit dose, and/or as a plurality of single unit doses. As used herein, a "unit dose" refers to a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient that would be administered to a subject and/or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage. [00478] Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and/or any additional ingredients in a pharmaceutical composition in accordance with the present disclosure can vary, depending upon the identity, size, and/or condition of the subject being treated and further depending upon the route by which the composition is to be administered. [00479] In some embodiments, the compositions and formulations described herein can contain at least one polynucleotide of the invention. As a non-limiting example, the composition or formulation can contain 1, 2, 3, 4 or 5 polynucleotides of the invention. In some embodiments, the compositions or formulations described herein can comprise more than one type of polynucleotide. In some embodiments, the composition or formulation can comprise a polynucleotide in linear and circular form. In another embodiment, the composition or formulation can comprise a circular polynucleotide and an in vitro transcribed (IVT) polynucleotide. In yet another embodiment, the composition or formulation can comprise an IVT polynucleotide, a chimeric polynucleotide and a circular polynucleotide. [00480] Although the descriptions of pharmaceutical compositions and formulations provided herein are principally directed to pharmaceutical compositions and formulations that are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other animal, e.g., to non-human animals, e.g. non-human mammals. Attorney Docket No.45817-0124WO1 / MTX959.20 [00481] The present invention provides pharmaceutical formulations that comprise one or more polynucleotides described herein (e.g., one or more polynucleotides comprising nucleotide sequences encoding a Snu13 polypeptide). In some instances, the present invention provides pharmaceutical formulations that comprise a polynucleotide described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a Snu13 polypeptide). The polynucleotides described herein can be formulated using one or more excipients to: (1) increase stability; (2) increase cell transfection; (3) permit the sustained or delayed release (e.g., from a depot formulation of the polynucleotide); (4) alter the biodistribution (e.g., target the polynucleotide to specific tissues or cell types); (5) increase the translation of encoded protein in vivo; and/or (6) alter the release profile of encoded protein in vivo. In some embodiments, the pharmaceutical formulation further comprises a delivery agent comprising, e.g., a compound having the Formula (I), e.g., Compound II or Compound B; or a compound having the Formula (III), (IV), (V), or (VI), e.g., Compound I or VI, or any combination thereof. In some embodiments, the delivery agent comprises an ionizable amino lipid (e.g., Compound II, VI, or B), a helper lipid (e.g., DSPC), a sterol (e.g., Cholesterol), and a PEG lipid (e.g., Compound I or PEG- DMG), e.g., with a mole ratio in the range of about (i) 40-50 mol% ionizable amino lipid (e.g., Compound II, VI, or B), optionally 45-50 mol% ionizable amino lipid, for example, 45-46 mol%, 46-47 mol%, 47-48 mol%, 48-49 mol%, or 49-50 mol% for example about 45 mol%, 45.5 mol%, 46 mol%, 46.5 mol%, 47 mol%, 47.5 mol%, 48 mol%, 48.5 mol%, 49 mol%, or 49.5 mol%; (ii) 30-45 mol% sterol (e.g., cholesterol), optionally 35-42 mol% sterol, for example, 30-31 mol%, 31-32 mol%, 32-33 mol%, 33-34 mol%, 35-35 mol%, 35-36 mol%, 36-37 mol%, 37-38 mol%, 38-39 mol%, or 39-40 mol%, or 40-42 mol% sterol; (iii) 5-15 mol% helper lipid (e.g., DSPC), optionally 10-15 mol% helper lipid, for example, 5-6 mol%, 6-7 mol%, 7-8 mol%, 8- 9 mol%, 9-10 mol%, 10-11 mol%, 11-12 mol%, 12-13 mol%, 13-14 mol%, or 14-15 mol% helper lipid; and (iv) 1-5% PEG lipid (e.g., Compound I or PEG-DMG), optionally 1-5 mol% PEG lipid, for example 1.5 to 2.5 mol%, 1-2 mol%, 2-3 mol%, 3-4 mol%, or 4-5 mol% PEG lipid. In some embodiments, the delivery agent comprises Compound B, Cholesterol, DSPC, and Compound I. Attorney Docket No.45817-0124WO1 / MTX959.20 [00482] A pharmaceutically acceptable excipient, as used herein, includes, but are not limited to, any and all solvents, dispersion media, or other liquid vehicles, dispersion or suspension aids, diluents, granulating and/or dispersing agents, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, binders, lubricants or oil, coloring, sweetening or flavoring agents, stabilizers, antioxidants, antimicrobial or antifungal agents, osmolality adjusting agents, pH adjusting agents, buffers, chelants, cyoprotectants, and/or bulking agents, as suited to the particular dosage form desired. Various excipients for Formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (see Remington: The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro (Lippincott, Williams & Wilkins, Baltimore, MD, 2006; incorporated herein by reference in its entirety). [00483] Exemplary diluents include, but are not limited to, calcium or sodium carbonate, calcium phosphate, calcium hydrogen phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, etc., and/or combinations thereof. [00484] Exemplary surface active agents and/or emulsifiers include, but are not limited to, natural emulsifiers (e.g., acacia, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), sorbitan fatty acid esters (e.g., polyoxyethylene sorbitan monooleate [TWEEN®80], sorbitan monopalmitate [SPAN®40], glyceryl monooleate, polyoxyethylene esters, polyethylene glycol fatty acid esters (e.g., CREMOPHOR®), polyoxyethylene ethers (e.g., polyoxyethylene lauryl ether [BRIJ®30]), PLUORINC®F 68, POLOXAMER®188, etc. and/or combinations thereof. [00485] Exemplary binding agents include, but are not limited to, starch, gelatin, sugars (e.g., sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol), amino acids (e.g., glycine), natural and synthetic gums (e.g., acacia, sodium alginate), ethylcellulose, hydroxyethylcellulose, hydroxypropyl methylcellulose, etc., and combinations thereof. [00486] Oxidation is a potential degradation pathway for mRNA, especially for liquid mRNA formulations. In order to prevent oxidation, antioxidants can be added Attorney Docket No.45817-0124WO1 / MTX959.20 to the formulations. Exemplary antioxidants include, but are not limited to, alpha tocopherol, ascorbic acid, ascorbyl palmitate, benzyl alcohol, butylated hydroxyanisole, m-cresol, methionine, butylated hydroxytoluene, monothioglycerol, sodium or potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, etc., and combinations thereof. [00487] Exemplary chelating agents include, but are not limited to, ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, disodium edetate, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, trisodium edetate, etc., and combinations thereof. [00488] Exemplary antimicrobial or antifungal agents include, but are not limited to, benzalkonium chloride, benzethonium chloride, methyl paraben, ethyl paraben, propyl paraben, butyl paraben, benzoic acid, hydroxybenzoic acid, potassium or sodium benzoate, potassium or sodium sorbate, sodium propionate, sorbic acid, etc., and combinations thereof. [00489] Exemplary preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, ascorbic acid, butylated hydroxyanisol, ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), etc., and combinations thereof. [00490] In some embodiments, the pH of polynucleotide solutions is maintained between pH 5 and pH 8 to improve stability. Exemplary buffers to control pH can include, but are not limited to sodium phosphate, sodium citrate, sodium succinate, histidine (or histidine-HCl), sodium malate, sodium carbonate, etc., and/or combinations thereof. [00491] Exemplary lubricating agents include, but are not limited to, magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, hydrogenated vegetable oils, polyethylene glycol, sodium benzoate, sodium or magnesium lauryl sulfate, etc., and combinations thereof. [00492] The pharmaceutical composition or formulation described here can contain a cryoprotectant to stabilize a polynucleotide described herein during freezing. Exemplary cryoprotectants include, but are not limited to mannitol, sucrose, trehalose, lactose, glycerol, dextrose, etc., and combinations thereof. Attorney Docket No.45817-0124WO1 / MTX959.20 [00493] The pharmaceutical composition or formulation described here can contain a bulking agent in lyophilized polynucleotide formulations to yield a "pharmaceutically elegant" cake, stabilize the lyophilized polynucleotides during long term (e.g., 36 month) storage. Exemplary bulking agents of the present invention can include, but are not limited to sucrose, trehalose, mannitol, glycine, lactose, raffinose, and combinations thereof. [00494] In some embodiments, the pharmaceutical composition or formulation further comprises a delivery agent. The delivery agent of the present disclosure can include, without limitation, liposomes, lipid nanoparticles, lipidoids, polymers, lipoplexes, microvesicles, exosomes, peptides, proteins, cells transfected with polynucleotides, hyaluronidase, nanoparticle mimics, nanotubes, conjugates, and combinations thereof. 21. Delivery Agents a. Lipid Compound [00495] The present disclosure provides pharmaceutical compositions with advantageous properties. The lipid compositions described herein may be advantageously used in lipid nanoparticle compositions for the delivery of therapeutic and/or prophylactic agents, e.g., mRNAs, to mammalian cells or organs. For example, the lipids described herein have little or no immunogenicity. For example, the lipid compounds disclosed herein have a lower immunogenicity as compared to a reference lipid (e.g., MC3, KC2, or DLinDMA). For example, a formulation comprising a lipid disclosed herein and a therapeutic or prophylactic agent, e.g., mRNA, has an increased therapeutic index as compared to a corresponding formulation which comprises a reference lipid (e.g., MC3, KC2, or DLinDMA) and the same therapeutic or prophylactic agent. [00496] In certain embodiments, the present application provides pharmaceutical compositions comprising: (a) a polynucleotide comprising a nucleotide sequence encoding a Snu13 polypeptide; and (b) a delivery agent. Attorney Docket No.45817-0124WO1 / MTX959.20 [00497] In certain embodiments, the present application provides pharmaceutical compositions comprising: (a) a first polynucleotide comprising a first nucleotide sequence encoding a Snu13 polypeptide, and a second polynucleotide comprising a Snu13-binding site (e.g., a sequence set forth in any one of SEQ ID NOs:500-521, e.g., SEQ ID NO:500) and an ORF encoding a second polypeptide (e.g., a target polypeptide); and (b) a delivery agent. [00498] In certain embodiments, the present application provides: (a) a first pharmaceutical compositions comprising: (i) a first polynucleotide comprising a first nucleotide sequence encoding a Snu13 polypeptide, and (ii) a delivery agent; and (b) a second pharmaceutical composition comprising: (a second polynucleotide comprising a Snu13-binding site (e.g., a sequence set forth in any one of SEQ ID NOs:500-521, e.g., SEQ ID NO:500) and an ORF encoding a second polypeptide (e.g., a target polypeptide); and (i) a delivery agent. Lipid Nanoparticle Formulations [00499] In some embodiments, nucleic acids of the invention (e.g., a Snu13 mRNA) are formulated in a lipid nanoparticle (LNP). Lipid nanoparticles typically comprise ionizable cationic lipid, non-cationic lipid, sterol and PEG lipid components along with the nucleic acid cargo of interest. The lipid nanoparticles of the invention can be generated using components, compositions, and methods as are generally known in the art, see for example PCT/US2016/052352; PCT/US2016/068300; PCT/US2017/037551; PCT/US2015/027400; PCT/US2016/047406; PCT/US2016000129; PCT/US2016/014280; PCT/US2016/014280; PCT/US2017/038426; PCT/US2014/027077; PCT/US2014/055394; PCT/US2016/52117; PCT/US2012/069610; PCT/US2017/027492; PCT/US2016/059575 and PCT/US2016/069491 all of which are incorporated by reference herein in their entirety. Attorney Docket No.45817-0124WO1 / MTX959.20 [00500] Nucleic acids of the present disclosure (e.g., a Snu13 mRNA) are typically formulated in lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises at least one ionizable cationic lipid, at least one non-cationic lipid, at least one sterol, and/or at least one polyethylene glycol (PEG)-modified lipid. [00501] In some embodiments, the lipid nanoparticle comprises a molar ratio of 20-60% ionizable cationic lipid. For example, the lipid nanoparticle may comprise a molar ratio of 40-50 mol%, optionally 45-50 mol%, for example, 45-46 mol%, 46-47 mol%, 47-48 mol%, 48-49 mol%, or 49-50 mol%, for example about 45 mol%, 45.5 mol%, 46 mol%, 46.5 mol%, 47 mol%, 47.5 mol%, 48 mol%, 48.5 mol%, 49 mol%, or 49.5 mol% ionizable cationic lipid. [00502] In some embodiments, the lipid nanoparticle comprises a molar ratio of 5- 25% non-cationic lipid. For example, the lipid nanoparticle may comprise a molar ratio of 5-15 mol%, optionally 10-12 mol%, for example, 5-6 mol%, 6-7 mol%, 7-8 mol%, 8-9 mol%, 9-10 mol%, 10-11 mol%, 11-12 mol%, 12-13 mol%, 13-14 mol%, or 14-15 mol% non-cationic lipid. [00503] In some embodiments, the lipid nanoparticle comprises a molar ratio of 25-55% sterol. For example, the lipid nanoparticle may comprise a molar ratio of 30- 45 mol%, optionally 35-40 mol%, for example, 30-31 mol%, 31-32 mol%, 32-33 mol%, 33-34 mol%, 35-35 mol%, 35-36 mol%, 36-37 mol%, 38-38 mol%, 38-39 mol%, or 39-40 mol% sterol. [00504] In some embodiments, the lipid nanoparticle comprises a molar ratio of 0.5-15% PEG-modified lipid. For example, the lipid nanoparticle may comprise a molar ratio of 1-5%, optionally 1-3 mol%, for example 1.5 to 2.5 mol%, 1-2 mol%, 2- 3 mol%, 3-4 mol%, or 4-5 mol% PEG-modified lipid. [00505] In some embodiments, the lipid nanoparticle comprises a molar ratio of 20-60% ionizable cationic lipid, 5-25% non-cationic lipid, 25-55% sterol, and 0.5- 15% PEG-modified lipid. [00506] In some embodiments, the lipid nanoparticle comprises a molar ratio of 40-50% ionizable cationic lipid, 5-15% non-cationic lipid, 30-45% sterol, and 1-5% PEG-modified lipid. Attorney Docket No.45817-0124WO1 / MTX959.20 [00507] In some embodiments, the lipid nanoparticle comprises a molar ratio of 45-50% ionizable cationic lipid, 10-12% non-cationic lipid, 35-40% sterol, and 1-3% PEG-modified lipid. [00508] In some embodiments, the lipid nanoparticle comprises a molar ratio of 45-50% ionizable cationic lipid, 10-12% non-cationic lipid, 35-40% sterol, and 1.5- 2.5% PEG-modified lipid. Ionizable amino lipids [00509] In some aspects, the disclosure relates to a compound of Formula (I): or its N-oxide, or a salt or isomer thereof, R’ branched denotes a point of attachment; wherein selected from the group consisting of H, C2-12 alkyl, and C2-12 alkenyl; R 2 and R 3 are each independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl; R 4 is selected from the group consisting of -(CH2)nOH, wherein n is selected from the group consisting of 1, 2, 3, 4, and 5, , wherein denotes a point of attachment; wherein each R is independently selected from the group consisting of C 1-6 alkyl, C 2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; Attorney Docket No.45817-0124WO1 / MTX959.20 each R 5 is independently selected from the group consisting of C1-3 alkyl, C 2-3 alkenyl, and H; each R 6 is independently selected from the group consisting of C1-3 alkyl, C 2-3 alkenyl, and H; M and M’ are each independently selected from the group consisting of - C(O)O- and -OC(O)-; R’ is a C1-12 alkyl or C2-12 alkenyl; l is selected from the group consisting of 1, 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13. [00510] In some embodiments of the compounds of Formula (I), R’ a is R’ branched ; denotes a point of attachment; R aα , R aβ , R aγ , C1-14 alkyl; R 4 is -(CH2)nOH; n is 2; and m is 7. [00511] In some embodiments of the compounds of Formula (I), R’ a is R’ branched ; denotes a point of attachment; R aα , R aβ , R aγ , C 1-14 alkyl; R 4 is -(CH 2 ) n OH; n is 2; and m is 7. [00512] In some embodiments of the compounds of Formula (I), R’ a is R’ branched ; denotes a point of attachment; R aα is C2-12 R 3 are each C1-14 alkyl; R 4 is Attorney Docket No.45817-0124WO1 / MTX959.20 6 alkyl); n2 is 2; R 5 is H; each R 6 is H; M and M’ are l is 5; and m is 7. of the compounds of Formula (I), R’ a is R’ branched ; a point of attachment; R aα , R aβ , and each C 1-14 alkyl; R 4 is - (CH2) n are each -C(O)O-; R’ is a C1- 12 alkyl; l is 5; and m is 7. [00514] In some embodiments, the compound of Formula (I) is selected from: . Attorney Docket No.45817-0124WO1 / MTX959.20 [00516] In some embodiments, the compound of Formula (I) is: . [00517] In is: . [00518] In is: (Compound B). [00519] In some aspects, the disclosure relates to a compound of Formula (Ia): its N-oxide, or a salt or isomer thereof, R’ branched denotes a point of attachment; wherein selected from the group consisting of H, C2-12 alkyl, and C2-12 alkenyl; R 2 and R 3 are each independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl; Attorney Docket No.45817-0124WO1 / MTX959.20 R 4 is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 1, 2, 3, 4, and 5, , wherein denotes a point R 10 is N each R is independently selected from the group consisting of 6 C 2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R 5 is independently selected from the group consisting of C 1-3 alkyl, C2-3 alkenyl, and H; each R 6 is independently selected from the group consisting of C 1-3 alkyl, C2-3 alkenyl, and H; M and M’ are each independently selected from the group consisting of - C(O)O- and -OC(O)-; R’ is a C1-12 alkyl or C2-12 alkenyl; l is selected from the group consisting of 1, 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13. In some aspects, the disclosure relates to a compound of Formula (Ib): or its N-oxide, or a salt or isomer thereof, R’ branched denotes a point of attachment; wherein selected from the group consisting of H, C 2-12 alkyl, and C 2-12 alkenyl; R 2 and R 3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; Attorney Docket No.45817-0124WO1 / MTX959.20 R 4 is -(CH2)nOH, wherein n is selected from the group consisting of 1, 2, 3, 4, and 5; each R 5 is independently selected from the group consisting of C1-3 alkyl, C 2-3 alkenyl, and H; each R 6 is independently selected from the group consisting of C1-3 alkyl, C 2-3 alkenyl, and H; M and M’ are each independently selected from the group consisting of - C(O)O- and -OC(O)-; R’ is a C1-12 alkyl or C2-12 alkenyl; l is selected from the group consisting of 1, 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13. [00520] In some embodiments of Formula (I) or (Ib), R’ a is R’ branched ; R’ branched is denotes a point of attachment; R aβ , R aγ , and R aδ are each H; alkyl; R 4 is -(CH ) OH; n is 2; each R 5 i 6 14 2 n s H; each R is H; M and M’ are each -C(O)O-; R’ is a C 1-12 alkyl; l is 5; and m is 7. [00521] In some embodiments of Formula (I) or (Ib), R’ a is R’ branched ; R’ branched is denotes a point of attachment; R aβ , R aγ , and R aδ are each H; alkyl; R 4 is -(CH 2 ) n OH; n is 2; each R 5 is H; each R 6 is H; M and M’ are each -C(O)O-; R’ is a C1-12 alkyl; l is 3; and m is 7. [00522] In some embodiments of Formula (I) or (Ib), R’ a is R’ branched ; R’ branched is a point of attachment; R aβ and R aδ are each H; R aγ is C1-14 alkyl; R 4 is -(CH2)nOH; n is 2; each R 5 is H; each R 6 is H; M and M’ are each -C(O)O-; R’ is a C1-12 alkyl; l is 5; and m is 7. [00523] In some aspects, the disclosure relates to a compound of Formula (Ic): Attorney Docket No.45817-0124WO1 / MTX959.20 its N-oxide, or a salt or isomer thereof, R’ branched denotes a point of attachment; wherein selected from the group consisting of H, C 2-12 alkyl, and C 2-12 alkenyl; R 2 and R 3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; , a point of attachment; wherein R is independently selected from the group consisting of C 1-6 alkyl, C 2-3 alkenyl, and H; n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R 5 is independently selected from the group consisting of C 1-3 alkyl, C2-3 alkenyl, and H; each R 6 is independently selected from the group consisting of C 1-3 alkyl, C2-3 alkenyl, and H; M and M’ are each independently selected from the group consisting of - C(O)O- and -OC(O)-; R’ is a C1-12 alkyl or C2-12 alkenyl; l is selected from the group consisting of 1, 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13. Attorney Docket No.45817-0124WO1 / MTX959.20 [00524] In some embodiments, R’ a is R’ branched ; ; denotes a point of attachment; R aβ , R aγ , and R aδ are alkyl; R 2 and R 3 are each C 1-14 alkyl; R 4 denotes a point of attachment; R 10 is NH(C1-6 alkyl); R 6 is H; M and M’ are each -C(O)O-; R’ is a C 1-12 alkyl; l is 5; and m is 7. [00525] In some embodiments, the compound of Formula (Ic) is: (Compound A). [00526] of Formula (II): a Attorney Docket No.45817-0124WO1 / MTX959.20 R aγ and R aδ are each independently selected from the group consisting of H, C 1-12 alkyl, and C 2-12 alkenyl, wherein at least one of R aγ and R aδ is selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; R bγ and R bδ are each independently selected from the group consisting of H, C1-12 alkyl, and C2-12 alkenyl, wherein at least one of R bγ and R bδ is selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl; R 2 and R 3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R 4 is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 1, 2, 3, 4, and 5, , wherein denotes a point R 10 is N(R)2; each R is independently selected from the group consisting of C 1-6 alkyl, C 2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C 1-12 alkyl or C 2-12 alkenyl; Y a is a C3-6 carbocycle; R*” a is selected from the group consisting of C 1-15 alkyl and C 2-15 alkenyl; and s is 2 or 3; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; l is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9. [00527] In some aspects, the disclosure relates to a compound of Formula (II-a): its N-oxide, or a salt or isomer thereof, Attorney Docket No.45817-0124WO1 / MTX959.20 ; R aγ and R aδ are each independently selected from the group consisting of H, C1-12 alkyl, and C2-12 alkenyl, wherein at least one of R aγ and R aδ is selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl; R bγ and R bδ are each independently selected from the group consisting of H, C 1-12 alkyl, and C 2-12 alkenyl, wherein at least one of R bγ and R bδ is selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; R 2 and R 3 are each independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl; R 4 is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 1, 2, 3, 4, and 5, , wherein denotes a point each R is independently selected from the group C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C1-12 alkyl or C2-12 alkenyl; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; l is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9. [00528] In some aspects, the disclosure relates to a compound of Formula (II-b):
Attorney Docket No.45817-0124WO1 / MTX959.20 ; R aγ and each independently selected from the group consisting of C 1-12 alkyl and C2-12 R 2 and R 3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R 4 is selected from the group consisting of -(CH 2 ) n OH wherein n is selected from the group consisting of 1, 2, 3, 4, and 5, , wherein denotes a point each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C1-12 alkyl or C2-12 alkenyl; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; l is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9. [00529] In some aspects, the disclosure relates to a compound of Formula (II-c): its N-oxide, or a salt or isomer thereof, ; denotes a point of attachment; Attorney Docket No.45817-0124WO1 / MTX959.20 wherein R aγ is selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; R 2 and R 3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R 4 is selected from the group consisting of -(CH 2 ) n OH wherein n is selected from the group consisting of 1, 2, 3, 4, and 5, , wherein denotes a point R 10 is N each R is independently selected from the group consisting of C 1-6 alkyl, C 2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; R’ is a C 1-12 alkyl or C 2-12 alkenyl; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; l is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9. [00530] In some aspects, the disclosure relates to a compound of Formula (II-d): ; wherein R aγ and R bγ are each independently selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; Attorney Docket No.45817-0124WO1 / MTX959.20 R 4 is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 1, 2, 3, 4, and 5, , wherein denotes a point R 10 is N each R is independently selected from the group consisting of 6 C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C1-12 alkyl or C2-12 alkenyl; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; l is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9. [00531] In some aspects, the disclosure relates to a compound of Formula (II-e): its N-oxide, or a salt or isomer thereof, ; selected from the group consisting of C1-12 alkyl and C2-12 R 2 and R 3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R 4 is -(CH2)nOH wherein n is selected from the group consisting of 1, 2, 3, 4, and 5; R’ is a C1-12 alkyl or C2-12 alkenyl; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; l is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9. Attorney Docket No.45817-0124WO1 / MTX959.20 [00532] In some embodiments of the compound of Formula (II), (II-a), (II-b), (II- c), (II-d), or (II-e), m and l are each independently selected from 4, 5, and 6. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), m and l are each 5. [00533] In some embodiments of the compound of Formula (II), (II-a), (II-b), (II- c), (II-d), or (II-e), each R’ independently is a C 1-12 alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), each R’ independently is a C2-5 alkyl. [00534] In some embodiments of the compound of Formula (II), (II-a), (II-b), (II- c), (II-d), or (II-e), R’ b is: and R 2 and R 3 are each independently a C1-14 alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’ b is: and R 2 and R 3 are each independently a C 6-10 alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II- are each a C8 alkyl. of the compound of Formula (II), (II-a), (II-b), (II- c), (II-d), or (II-e), R’ branched , R aγ is a C1-12 alkyl and R 2 and R 3 are each of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’ branched is: R 3 are each Formula (II), is: Attorney Docket No.45817-0124WO1 / MTX959.20 [00536] In some embodiments of the compound of Formula (II), (II-a), (II-b), (II- is: b), (II- , , or , m are and each R’ independently is a C 1-12 alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), m and l are each 5 and each R’ independently is a C 2-5 alkyl. [00538] In some embodiments of the compound of Formula (II), (II-a), (II-b), (II- c), (II-d), or (II-e), R’ branched l are each independently alkyl, and R aγ and R bγ are each a C 1-12 alkyl. In some embodiments of the compound , R’ b is: , m and l are each 5, each R’ independently is a C2-5 alkyl, and R aγ and R bγ are each a C 2-6 alkyl. [00539] In some embodiments of the compound of Formula (II), (II-a), (II-b), (II- c), (II-d), or (II-e), R’ branched are each independently selected and R 2 and R 3 are each independently a C 6-10 alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’ branched is: Attorney Docket No.45817-0124WO1 / MTX959.20 l are each 5, R’ is a C 2-5 alkyl, R aγ is a of Formula (II), (II-a), (II-b), (II- , wherein R 10 is NH(C 1-6 alkyl) and n2 is Formula (II), (II-a), (II-b), (II-c), (II-d), , wherein R 10 is NH(CH3) and n2 is 2. the compound of Formula (II), (II-a), (II-b), (II- l alkyl, R aγ and R bγ are each a C 1-12 alkyl, and R 4 , wherein R 10 is NH(C1-6 alkyl), and n2 is 2. In some of Formula (II), is: , m and l are each 5, each R’ independently is a C2-5 alkyl, R aγ and 6 alkyl, and R 4 , wherein R 10 is NH(CH 3 ) and embodiments of the compound of Formula (II), (II-a), (II-b), (II- c), (II-d), or (II-e), R’ branched are Attorney Docket No.45817-0124WO1 / MTX959.20 each independently selected from 4, 5, and 6, R’ is a C1-12 alkyl, R 2 and R 3 are each independently a C6-10 alkyl, R aγ is a C1-12 alkyl, and R 4 , wherein R 10 is NH(C 1-6 alkyl) and n2 is 2. In some of are each a C 8 alkyl, and R 4 , wherein R 10 is NH(CH 3 ) and n2 is 2. [00543] In some embodiments of the compound of Formula (II), (II-a), (II-b), (II- c), (II-d), or (II-e), R 4 is -(CH2)nOH and n is 2, 3, or 4. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R 4 is -(CH 2 ) n OH and n is 2. [00544] In some embodiments of the compound of Formula (II), (II-a), (II-b), (II- l alkyl, R aγ and R bγ are each a C1-12 alkyl, R 4 is -(CH2)nOH, and n is 2, 3, or 4. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’ n is 2. [00545] In some aspects, the disclosure relates to a compound of Formula (II-f): Attorney Docket No.45817-0124WO1 / MTX959.20 alkyl; each independently a C1-14 alkyl; is -(CH 2 ) n OH wherein n is selected from the group consisting of 1, 2, 3, 4, and 5; R’ is a C 1-12 alkyl; m is selected from 4, 5, and 6; and l is selected from 4, 5, and 6. [00546] In some embodiments of the compound of Formula (II-f), m and l are each 5, and n is 2, 3, or 4. [00547] In some embodiments of the compound of Formula (II-f) R’ is a C2-5 alkyl, R aγ is a C 2-6 alkyl, and R 2 and R 3 are each a C 6-10 alkyl. [00548] In some embodiments of the compound of Formula (II-f), m and l are each 5, n is 2, 3, or 4, R’ is a C 2-5 alkyl, R aγ is a C 2-6 alkyl, and R 2 and R 3 are each a C 6-10 alkyl. [00549] In some aspects, the disclosure relates to a compound of Formula (II-g):
Attorney Docket No.45817-0124WO1 / MTX959.20 R 4 is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 3, 4, and 5, , wherein denotes a point of (C 1-6 alkyl), and n2 is selected from the group consisting of 1, 2, and 3. [00550] In some aspects, the disclosure relates to a compound of Formula (II-h): a 5 R 4 is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 3, 4, and 5, , wherein denotes a point of , and n2 is selected from consisting of 1, 2, and 3. [00551] In some embodiments of the compound of Formula (II-g) or (II-h), R 4 is , wherein n2 is 2. [00552] In some embodiments of the compound of Formula (II-g) or (II-h), R 4 is - (CH 2 ) 2 OH. [00553] In some aspects, the disclosure relates to a compound having the Formula (III): Attorney Docket No.45817-0124WO1 / MTX959.20 , or a salt or R 1 , consisting of C5-20 alkyl, C5-20 alkenyl, -R”MR’, -R*YR”, -YR”, and -R*OR”; each M is independently selected from the group consisting of -C(O)O-, -OC(O)-, -OC(O)O-, -C(O)N(R’)-, -N(R’)C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR’)O-, -S(O)2-, an aryl group, and a heteroaryl group; X 1 , X 2 , and X 3 are independently selected from the group consisting of a bond, -CH 2 -, -(CH2)2-, -CHR-, -CHY-, -C(O)-, -C(O)O-, -OC(O)-, -C(O)-CH2-, -CH2-C(O)-, -C(O)O-CH 2 -, -OC(O)-CH 2 -, -CH 2 -C(O)O-, -CH 2 -OC(O)-, -CH(OH)-, -C(S)-, and -CH(SH)-; each Y is independently a C 3-6 carbocycle; each R* is independently selected from the group consisting of C1-12 alkyl and C 2-12 alkenyl; each R is independently selected from the group consisting of C1-3 alkyl and a C 3-6 carbocycle; each R’ is independently selected from the group consisting of C1-12 alkyl, C2- 12 alkenyl, and H; and each R” is independently selected from the group consisting of C3-12 alkyl and C 3-12 alkenyl, and wherein: i) at least one of X 1 , X 2 , and X 3 is not -CH2-; and/or ii) at least one of R 1 , R 2 , R 3 , R 4 , and R 5 is -R”MR’. [00554] In some embodiments, R1, R2, R3, R4, and R5 are each C5-20 alkyl; X 1 is -CH2-; and X 2 and X 3 are each -C(O)-. [00555] In some embodiments, the compound of Formula (III) is: Attorney Docket No.45817-0124WO1 / MTX959.20 a [00556] The lipid composition of the lipid nanoparticle composition disclosed herein can comprise one or more phospholipids, for example, one or more saturated or (poly)unsaturated phospholipids or a combination thereof. In general, phospholipids comprise a phospholipid moiety and one or more fatty acid moieties. [00557] A phospholipid moiety can be selected, for example, from the non-limiting group consisting of phosphatidyl choline, phosphatidyl ethanolamine, phosphatidyl glycerol, phosphatidyl serine, phosphatidic acid, 2-lysophosphatidyl choline, and a sphingomyelin. [00558] A fatty acid moiety can be selected, for example, from the non-limiting group consisting of lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanoic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid. [00559] Particular phospholipids can facilitate fusion to a membrane. For example, a cationic phospholipid can interact with one or more negatively charged phospholipids of a membrane (e.g., a cellular or intracellular membrane). Fusion of a phospholipid to a membrane can allow one or more elements (e.g., a therapeutic agent) of a lipid-containing composition (e.g., LNPs) to pass through the membrane permitting, e.g., delivery of the one or more elements to a target tissue. [00560] Non-natural phospholipid species including natural species with modifications and substitutions including branching, oxidation, cyclization, and alkynes are also contemplated. For example, a phospholipid can be functionalized with or cross-linked to one or more alkynes (e.g., an alkenyl group in which one or more double bonds is replaced with a triple bond). Under appropriate reaction conditions, an alkyne group can undergo a copper-catalyzed cycloaddition upon exposure to an azide. Such reactions can be useful in functionalizing a lipid bilayer of Attorney Docket No.45817-0124WO1 / MTX959.20 a nanoparticle composition to facilitate membrane permeation or cellular recognition or in conjugating a nanoparticle composition to a useful component such as a targeting or imaging moiety (e.g., a dye). [00561] Phospholipids include, but are not limited to, glycerophospholipids such as phosphatidylcholines, phosphatidylethanolamines, phosphatidylserines, phosphatidylinositols, phosphatidy glycerols, and phosphatidic acids. Phospholipids also include phosphosphingolipid, such as sphingomyelin. [00562] In some embodiments, a phospholipid of the invention comprises 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-gly cero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3- phosphocholine (DOPC), l,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2- diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero- 3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2 cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2- dilinolenoyl-sn-glycero-3-phosphocholine,1,2-diarachidonoyl- sn-glycero-3- phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2- diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn- glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero- 3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof. [00563] In certain embodiments, a phospholipid useful or potentially useful in the present invention is an analog or variant of DSPC. In certain embodiments, a phospholipid useful or potentially useful in the present invention is a compound of Formula (IV): Attorney Docket No.45817-0124WO1 / MTX959.20 or a salt thereof, wherein: each R 1 is independently optionally substituted alkyl; or optionally two R 1 are joined together with the intervening atoms to form optionally substituted monocyclic carbocyclyl or optionally substituted monocyclic heterocyclyl; or optionally three R 1 are joined together with the intervening atoms to form optionally substituted bicyclic carbocyclyl or optionally substitute bicyclic heterocyclyl; n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; A is of the ; each instance of L 2 substituted C1-6 alkylene, wherein one methylene unit of the optionally substituted C 1-6 alkylene is optionally replaced with O, N(R N ), S, C(O), C(O)N(R N ), NR N C(O), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), NR N C(O)O, or NR N C(O)N(R N ); each instance of R 2 is independently optionally substituted C 1-30 alkyl, optionally substituted C1-30 alkenyl, or optionally substituted C1-30 alkynyl; optionally wherein one or more methylene units of R 2 are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R N ), O, S, C(O), - C(O)N(R N ), NR N C(O), NR N C(O)N(R N ), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), - , - - or a nitrogen protecting group; Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; and p is 1 or 2; provided that the compound is not of the Formula: Attorney Docket No.45817-0124WO1 / MTX959.20 , wherein each alkyl, unsubstituted alkenyl, or [00564] In some embodiments, the phospholipids may be one or more of the phospholipids described in U.S. Application No.62/520,530. i) Phospholipid Head Modifications [00565] In certain embodiments, a phospholipid useful or potentially useful in the present invention comprises a modified phospholipid head (e.g., a modified choline group). In certain embodiments, a phospholipid with a modified head is DSPC, or analog thereof, with a modified quaternary amine. For example, in embodiments of Formula (IV), at least one of R 1 is not methyl. In certain embodiments, at least one of R 1 is not hydrogen or methyl. In certain embodiments, the compound of Formula (IV) is of one of the following Formulae: , each t is independently 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; each u is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and each v is independently 1, 2, or 3. In certain embodiments, a compound of Formula (IV) is of Formula (IV-a): Attorney Docket No.45817-0124WO1 / MTX959.20 or a salt thereof. [00566] In certain embodiments, a phospholipid useful or potentially useful in the present invention comprises a cyclic moiety in place of the glyceride moiety. In certain embodiments, a phospholipid useful in the present invention is DSPC, or analog thereof, with a cyclic moiety in place of the glyceride moiety. In certain embodiments, the compound of Formula (IV) is of Formula (IV-b): , or a salt thereof. (ii) Phospholipid Tail Modifications [00567] In certain embodiments, a phospholipid useful or potentially useful in the present invention comprises a modified tail. In certain embodiments, a phospholipid useful or potentially useful in the present invention is DSPC, or analog thereof, with a modified tail. As described herein, a “modified tail” may be a tail with shorter or longer aliphatic chains, aliphatic chains with branching introduced, aliphatic chains with substituents introduced, aliphatic chains wherein one or more methylenes are replaced by cyclic or heteroatom groups, or any combination thereof. For example, in certain embodiments, the compound of (IV) is of Formula (IV-a), or a salt thereof, wherein at least one instance of R 2 is each instance of R 2 is optionally substituted C1- 30 alkyl, wherein one or more methylene units of R 2 are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R N ), O, S, - C(O), C(O)N(R N ), NR N C(O), NR N C(O)N(R N ), C(O)O, OC(O), OC(O)O, - , Attorney Docket No.45817-0124WO1 / MTX959.20 [00568] In certain embodiments, the compound of Formula (IV) is of Formula (IV- c): c), or a salt thereof, wherein: each x is each instance is G is independently selected from the group consisting of optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R N ), O, S, - C(O), C(O)N(R N ), NR N C(O), NR N C(O)N(R N ), C(O)O, OC(O), OC(O)O, - , separate embodiment of the present invention. [00569] In certain embodiments, a phospholipid useful or potentially useful in the present invention comprises a modified phosphocholine moiety, wherein the alkyl chain linking the quaternary amine to the phosphoryl group is not ethylene (e.g., n is not 2). Therefore, in certain embodiments, a phospholipid useful or potentially useful in the present invention is a compound of Formula (IV), wherein n is 1, 3, 4, 5, 6, 7, 8, 9, or 10. For example, in certain embodiments, a compound of Formula (IV) is of one of the following Formulae: , or a salt Attorney Docket No.45817-0124WO1 / MTX959.20 Alternative Lipids [00570] In certain embodiments, a phospholipid useful or potentially useful in the present invention comprises a modified phosphocholine moiety, wherein the alkyl chain linking the quaternary amine to the phosphoryl group is not ethylene (e.g., n is not 2). Therefore, in certain embodiments, a phospholipid useful. [00571] In certain embodiments, an alternative lipid is used in place of a phospholipid of the present disclosure. [00572] In certain embodiments, an alternative lipid of the invention is oleic acid. [00573] In certain embodiments, the alternative lipid is one of the following: , , , Attorney Docket No.45817-0124WO1 / MTX959.20 [00574] The lipid composition of a pharmaceutical composition disclosed herein can comprise one or more structural lipids. As used herein, the term "structural lipid" refers to sterols and also to lipids containing sterol moieties. [00575] Incorporation of structural lipids in the lipid nanoparticle may help mitigate aggregation of other lipids in the particle. Structural lipids can be selected from the group including but not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, hopanoids, phytosterols, steroids, and mixtures thereof. In some embodiments, the structural lipid is a sterol. As defined herein, "sterols" are a subgroup of steroids consisting of steroid alcohols. In certain embodiments, the structural lipid is a steroid. In certain embodiments, the structural lipid is cholesterol. In certain embodiments, the structural lipid is an analog of cholesterol. In certain embodiments, the structural lipid is alpha-tocopherol. [00576] In some embodiments, the structural lipids may be one or more of the structural lipids described in U.S. Application No.62/520,530. Polyethylene Glycol (PEG)-Lipids [00577] The lipid composition of a pharmaceutical composition disclosed herein can comprise one or more a polyethylene glycol (PEG) lipid. [00578] As used herein, the term “PEG-lipid” refers to polyethylene glycol (PEG)- modified lipids. Non-limiting examples of PEG-lipids include PEG-modified Attorney Docket No.45817-0124WO1 / MTX959.20 phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines and PEG-modified 1,2- diacyloxypropan-3-amines. Such lipids are also referred to as PEGylated lipids. For example, a PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid. [00579] In some embodiments, the PEG-lipid includes, but not limited to 1,2- dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG-DMG), 1,2-distearoyl-sn- glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)] (PEG-DSPE), PEG- disteryl glycerol (PEG-DSG), PEG-dipalmetoleyl, PEG-dioleyl, PEG-distearyl, PEG- diacylglycamide (PEG-DAG), PEG-dipalmitoyl phosphatidylethanolamine (PEG- DPPE), or PEG-l,2-dimyristyloxlpropyl-3-amine (PEG-c-DMA). [00580] In one embodiment, the PEG-lipid is selected from the group consisting of a PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide, a PEG-modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and mixtures thereof. [00581] In some embodiments, the lipid moiety of the PEG-lipids includes those having lengths of from about C 14 to about C 22 , preferably from about C 14 to about C 16 . In some embodiments, a PEG moiety, for example an mPEG-NH2, has a size of about 1000, 2000, 5000, 10,000, 15,000 or 20,000 daltons. In one embodiment, the PEG- lipid is PEG2k-DMG. [00582] In one embodiment, the lipid nanoparticles described herein can comprise a PEG lipid which is a non-diffusible PEG. Non-limiting examples of non-diffusible PEGs include PEG-DSG and PEG-DSPE. [00583] PEG-lipids are known in the art, such as those described in U.S. Patent No. 8158601 and International Publ. No. WO 2015/130584 A2, which are incorporated herein by reference in their entirety. [00584] In general, some of the other lipid components (e.g., PEG lipids) of various Formulae, described herein may be synthesized as described International Patent Application No. PCT/US2016/000129, filed December 10, 2016, entitled “Compositions and Methods for Delivery of Therapeutic Agents,” which is incorporated by reference in its entirety. Attorney Docket No.45817-0124WO1 / MTX959.20 [00585] The lipid component of a lipid nanoparticle composition may include one or more molecules comprising polyethylene glycol, such as PEG or PEG-modified lipids. Such species may be alternately referred to as PEGylated lipids. A PEG lipid is a lipid modified with polyethylene glycol. A PEG lipid may be selected from the non-limiting group including PEG-modified phosphatidylethanolamines, PEG- modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof. For example, a PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid. [00586] In some embodiments the PEG-modified lipids are a modified form of PEG DMG. PEG-DMG has the following structure: [00587] In can be PEGylated lipids described in International Publication No. WO2012099755, the contents of which is herein incorporated by reference in its entirety. Any of these exemplary PEG lipids described herein may be modified to comprise a hydroxyl group on the PEG chain. In certain embodiments, the PEG lipid is a PEG-OH lipid. As generally defined herein, a “PEG-OH lipid” (also referred to herein as “hydroxy- PEGylated lipid”) is a PEGylated lipid having one or more hydroxyl (–OH) groups on the lipid. In certain embodiments, the PEG-OH lipid includes one or more hydroxyl groups on the PEG chain. In certain embodiments, a PEG-OH or hydroxy-PEGylated lipid comprises an –OH group at the terminus of the PEG chain. Each possibility represents a separate embodiment of the present invention. [00588] In certain embodiments, a PEG lipid useful in the present invention is a compound of Formula (V). Provided herein are compounds of Formula (V): , or salts thereof, wherein: R 3 is –OR O ; R O is hydrogen, optionally substituted alkyl, or an oxygen protecting group; Attorney Docket No.45817-0124WO1 / MTX959.20 r is an integer between 1 and 100, inclusive; L 1 is optionally substituted C 1-10 alkylene, wherein at least one methylene of the optionally substituted C1-10 alkylene is independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, O, N(R N ), S, C(O), - C(O)N(R N ), NR N C(O), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), NR N C(O)O, or - NR N C N m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; A is of the ; each instance of L 2 substituted C1-6 alkylene, wherein one methylene unit of the optionally substituted C1-6 alkylene is optionally replaced with O, N(R N ), S, C(O), C(O)N(R N ), NR N C(O), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), NR N C(O)O, or NR N C(O)N(R N ); each instance of R 2 is independently optionally substituted C 1-30 alkyl, optionally substituted C1-30 alkenyl, or optionally substituted C1-30 alkynyl; optionally wherein one or more methylene units of R 2 are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R N ), O, S, - C(O), C(O)N(R N ), NR N C(O), NR N C(O)N(R N ), C(O)O, OC(O), OC(O)O, - , - or a nitrogen protecting group; Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; and Attorney Docket No.45817-0124WO1 / MTX959.20 p is 1 or 2. [00589] In certain embodiments, the compound of Formula (V) is a PEG-OH lipid (i.e., R 3 is –OR O , and R O is hydrogen). In certain embodiments, the compound of Formula (V) is of Formula (V-OH): (V-OH), or a salt thereof. [00590] In certain PEGylated fatty acid. In certain embodiments, a PEG lipid useful in the present invention is a compound of Formula (VI). Provided herein are compounds of Formula (VI): , or a salts thereof, wherein: 3 O R is–OR ; R O is hydrogen, optionally substituted alkyl or an oxygen protecting group; r is an integer between 1 and 100, inclusive; R 5 is optionally substituted C 10-40 alkyl, optionally substituted C 10-40 alkenyl, or optionally substituted C10-40 alkynyl; and optionally one or more methylene groups of R 5 are replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R N ), O, S, C(O), C(O)N(R N ), NR N C(O), NR N C(O)N(R N ), C(O)O, OC(O), - , - , - or a nitrogen protecting group. [00591] In certain embodiments, the compound of Formula (VI) is of Formula (VI- OH): Attorney Docket No.45817-0124WO1 / MTX959.20 (VI-OH), or a salt thereof. In some [00592] In yet other embodiments the compound of Formula (VI) is: . or a [00593] In one embodiment, the compound of Formula (VI) is some aspects, compositions disclosed herein does not comprise a PEG-lipid. [00595] In some embodiments, the PEG-lipids may be one or more of the PEG lipids described in U.S. Application No.62/520,530. [00596] In some embodiments, a PEG lipid of the invention comprises a PEG- modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG- modified ceramide, a PEG-modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and mixtures thereof. In some embodiments, the PEG-modified lipid is PEG-DMG, PEG-c-DOMG (also referred to as PEG-DOMG), PEG-DSG and/or PEG-DPG. [00597] In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of any of Formula I, II or III, a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising PEG-DMG. [00598] In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of any of Formula I, II or III, a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising a compound having Formula VI. [00599] In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of Formula I, II or III, a phospholipid comprising a compound having Formula IV, a structural lipid, and the PEG lipid comprising a compound having Formula V or VI. Attorney Docket No.45817-0124WO1 / MTX959.20 [00600] In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of Formula I, II or III, a phospholipid comprising a compound having Formula IV, a structural lipid, and the PEG lipid comprising a compound having Formula V or VI. [00601] In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of Formula I, II or III, a phospholipid having Formula IV, a structural lipid, and a PEG lipid comprising a compound having Formula VI. [00602] In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of , [00603] In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of , [00604] In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of , lipid comprising cholesterol, and a PEG lipid comprising a compound having Formula VI. [00605] In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of Attorney Docket No.45817-0124WO1 / MTX959.20 and a a [00606] In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of a phospholipid comprising DOPE, a structural lipid comprising cholesterol, and a PEG lipid comprising a compound having Formula VI. [00607] In some embodiments, a LNP of the invention comprises an N:P ratio of from about 2:1 to about 30:1. [00608] In some embodiments, a LNP of the invention comprises an N:P ratio of about 6:1. [00609] In some embodiments, a LNP of the invention comprises an N:P ratio of about 3:1. [00610] In some embodiments, a LNP of the invention comprises a wt/wt ratio of the ionizable cationic lipid component to the RNA of from about 10:1 to about 100:1. [00611] In some embodiments, a LNP of the invention comprises a wt/wt ratio of the ionizable cationic lipid component to the RNA of about 20:1. [00612] In some embodiments, a LNP of the invention comprises a wt/wt ratio of the ionizable cationic lipid component to the RNA of about 10:1. [00613] In some embodiments, a LNP of the invention has a mean diameter from about 50nm to about 150nm. [00614] In some embodiments, a LNP of the invention has a mean diameter from about 70nm to about 120nm. Attorney Docket No.45817-0124WO1 / MTX959.20 [00615] As used herein, the term "alkyl", "alkyl group", or "alkylene" means a linear or branched, saturated hydrocarbon including one or more carbon atoms (e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms), which is optionally substituted. The notation "C1-14 alkyl" means an optionally substituted linear or branched, saturated hydrocarbon including 1-14 carbon atoms. Unless otherwise specified, an alkyl group described herein refers to both unsubstituted and substituted alkyl groups. [00616] As used herein, the term "alkenyl", "alkenyl group", or "alkenylene" means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one double bond, which is optionally substituted. The notation "C 2-14 alkenyl" means an optionally substituted linear or branched hydrocarbon including 2-14 carbon atoms and at least one carbon-carbon double bond. An alkenyl group may include one, two, three, four, or more carbon-carbon double bonds. For example, C18 alkenyl may include one or more double bonds. A C 18 alkenyl group including two double bonds may be a linoleyl group. Unless otherwise specified, an alkenyl group described herein refers to both unsubstituted and substituted alkenyl groups. [00617] As used herein, the term "alkynyl", "alkynyl group", or "alkynylene" means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one carbon-carbon triple bond, which is optionally substituted. The notation "C 2-14 alkynyl" means an optionally substituted linear or branched hydrocarbon including 2-14 carbon atoms and at least one carbon-carbon triple bond. An alkynyl group may include one, two, three, four, or more carbon-carbon triple bonds. For example, C18 alkynyl may include one or more carbon-carbon triple bonds. Unless otherwise specified, an alkynyl group described herein refers to both unsubstituted and substituted alkynyl groups. [00618] As used herein, the term "carbocycle" or "carbocyclic group" means an optionally substituted mono- or multi-cyclic system including one or more rings of Attorney Docket No.45817-0124WO1 / MTX959.20 carbon atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or twenty membered rings. The notation "C3-6 carbocycle" means a carbocycle including a single ring having 3-6 carbon atoms. Carbocycles may include one or more carbon- carbon double or triple bonds and may be non-aromatic or aromatic (e.g., cycloalkyl or aryl groups). Examples of carbocycles include cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, and 1,2 dihydronaphthyl groups. The term "cycloalkyl" as used herein means a non-aromatic carbocycle and may or may not include any double or triple bond. Unless otherwise specified, carbocycles described herein refers to both unsubstituted and substituted carbocycle groups, i.e., optionally substituted carbocycles. [00619] As used herein, the term "heterocycle" or "heterocyclic group" means an optionally substituted mono- or multi-cyclic system including one or more rings, where at least one ring includes at least one heteroatom. Heteroatoms may be, for example, nitrogen, oxygen, or sulfur atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen membered rings. Heterocycles may include one or more double or triple bonds and may be non- aromatic or aromatic (e.g., heterocycloalkyl or heteroaryl groups). Examples of heterocycles include imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl, and isoquinolyl groups. The term "heterocycloalkyl" as used herein means a non-aromatic heterocycle and may or may not include any double or triple bond. Unless otherwise specified, heterocycles described herein refers to both unsubstituted and substituted heterocycle groups, i.e., optionally substituted heterocycles. [00620] As used herein, the term "heteroalkyl", "heteroalkenyl", or "heteroalkynyl", refers respectively to an alkyl, alkenyl, alkynyl group, as defined herein, which further comprises one or more (e.g., 1, 2, 3, or 4) heteroatoms (e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus) wherein the one or more heteroatoms is inserted between adjacent carbon atoms within the parent carbon chain and/or one or more heteroatoms is inserted between a carbon atom and the parent Attorney Docket No.45817-0124WO1 / MTX959.20 molecule, i.e., between the point of attachment. Unless otherwise specified, heteroalkyls, heteroalkenyls, or heteroalkynyls described herein refers to both unsubstituted and substituted heteroalkyls, heteroalkenyls, or heteroalkynyls, i.e., optionally substituted heteroalkyls, heteroalkenyls, or heteroalkynyls. [00621] As used herein, a "biodegradable group" is a group that may facilitate faster metabolism of a lipid in a mammalian entity. A biodegradable group may be selected from the group consisting of, but is not limited to, -C(O)O-, -OC(O)-, - C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O)2-, an aryl group, and a heteroaryl group. As used herein, an "aryl group" is an optionally substituted carbocyclic group including one or more aromatic rings. Examples of aryl groups include phenyl and naphthyl groups. As used herein, a "heteroaryl group" is an optionally substituted heterocyclic group including one or more aromatic rings. Examples of heteroaryl groups include pyrrolyl, furyl, thiophenyl, imidazolyl, oxazolyl, and thiazolyl. Both aryl and heteroaryl groups may be optionally substituted. For example, M and M' can be selected from the non- limiting group consisting of optionally substituted phenyl, oxazole, and thiazole. In the Formulas herein, M and M' can be independently selected from the list of biodegradable groups above. Unless otherwise specified, aryl or heteroaryl groups described herein refers to both unsubstituted and substituted groups, i.e., optionally substituted aryl or heteroaryl groups. [00622] Alkyl, alkenyl, and cyclyl (e.g., carbocyclyl and heterocyclyl) groups may be optionally substituted unless otherwise specified. Optional substituents may be selected from the group consisting of, but are not limited to, a halogen atom (e.g., a chloride, bromide, fluoride, or iodide group), a carboxylic acid (e.g., C(O)OH), an alcohol (e.g., a hydroxyl, OH), an ester (e.g., C(O)OR OC(O)R), an aldehyde (e.g., C(O)H), a carbonyl (e.g., C(O)R, alternatively represented by C=O), an acyl halide (e.g., C(O)X, in which X is a halide selected from bromide, fluoride, chloride, and iodide), a carbonate (e.g., OC(O)OR), an alkoxy (e.g., OR), an acetal (e.g., C(OR)2R"", in which each OR are alkoxy groups that can be the same or different and R"" is an alkyl or alkenyl group), a phosphate (e.g., P(O) 4 3- ), a thiol (e.g., SH), a sulfoxide (e.g., S(O)R), a sulfinic acid (e.g., S(O)OH), a sulfonic acid (e.g., S(O) 2 OH), a thial (e.g., C(S)H), a sulfate (e.g., S(O) 4 2- ), a sulfonyl (e.g., S(O) 2 ), an Attorney Docket No.45817-0124WO1 / MTX959.20 amide (e.g., C(O)NR2, or N(R)C(O)R), an azido (e.g., N3), a nitro (e.g., NO2), a cyano (e.g., CN), an isocyano (e.g., NC), an acyloxy (e.g., OC(O)R), an amino (e.g., NR2, NRH, or NH2), a carbamoyl (e.g., OC(O)NR2, OC(O)NRH, or OC(O)NH2), a sulfonamide (e.g., S(O) 2 NR 2 , S(O) 2 NRH, S(O) 2 NH 2 , N(R)S(O) 2 R, N(H)S(O)2R, N(R)S(O)2H, or N(H)S(O)2H), an alkyl group, an alkenyl group, and a cyclyl (e.g., carbocyclyl or heterocyclyl) group. In any of the preceding, R is an alkyl or alkenyl group, as defined herein. In some embodiments, the substituent groups themselves may be further substituted with, for example, one, two, three, four, five, or six substituents as defined herein. For example, a C1-6 alkyl group may be further substituted with one, two, three, four, five, or six substituents as described herein. [00623] Compounds of the disclosure that contain nitrogens can be converted to N- oxides by treatment with an oxidizing agent (e.g., 3-chloroperoxybenzoic acid (mCPBA) and/or hydrogen peroxides) to afford other compounds of the disclosure. Thus, all shown and claimed nitrogen-containing compounds are considered, when allowed by valency and structure, to include both the compound as shown and its N- oxide derivative (which can be designated as N ^O or N+-O-). Furthermore, in other instances, the nitrogens in the compounds of the disclosure can be converted to N- hydroxy or N-alkoxy compounds. For example, N-hydroxy compounds can be prepared by oxidation of the parent amine by an oxidizing agent such as m CPBA. All shown and claimed nitrogen-containing compounds are also considered, when allowed by valency and structure, to cover both the compound as shown and its N- hydroxy (i.e., N-OH) and N-alkoxy (i.e., N-OR, wherein R is substituted or unsubstituted C 1 -C 6 alkyl, C 1 -C 6 alkenyl, C 1 -C 6 alkynyl, 3-14-membered carbocycle or 3-14-membered heterocycle) derivatives. (vi) Other Lipid Composition Components [00624] The lipid composition of a pharmaceutical composition disclosed herein can include one or more components in addition to those described above. For example, the lipid composition can include one or more permeability enhancer molecules, carbohydrates, polymers, surface altering agents (e.g., surfactants), or other components. For example, a permeability enhancer molecule can be a molecule described by U.S. Patent Application Publication No.2005/0222064. Carbohydrates Attorney Docket No.45817-0124WO1 / MTX959.20 can include simple sugars (e.g., glucose) and polysaccharides (e.g., glycogen and derivatives and analogs thereof). [00625] A polymer can be included in and/or used to encapsulate or partially encapsulate a pharmaceutical composition disclosed herein (e.g., a pharmaceutical composition in lipid nanoparticle form). A polymer can be biodegradable and/or biocompatible. A polymer can be selected from, but is not limited to, polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, polystyrenes, polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyleneimines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates. [00626] The ratio between the lipid composition and the polynucleotide range can be from about 10:1 to about 60:1 (wt/wt). [00627] In some embodiments, the ratio between the lipid composition and the polynucleotide can be about 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 21:1, 22:1, 23:1, 24:1, 25:1, 26:1, 27:1, 28:1, 29:1, 30:1, 31:1, 32:1, 33:1, 34:1, 35:1, 36:1, 37:1, 38:1, 39:1, 40:1, 41:1, 42:1, 43:1, 44:1, 45:1, 46:1, 47:1, 48:1, 49:1, 50:1, 51:1, 52:1, 53:1, 54:1, 55:1, 56:1, 57:1, 58:1, 59:1 or 60:1 (wt/wt). In some embodiments, the wt/wt ratio of the lipid composition to the polynucleotide encoding a therapeutic agent is about 20:1 or about 15:1. [00628] In some embodiments, the pharmaceutical composition disclosed herein can contain more than one polypeptides. For example, a pharmaceutical composition disclosed herein can contain two or more polynucleotides (e.g., RNA, e.g., mRNA). [00629] In one embodiment, the lipid nanoparticles described herein can comprise polynucleotides (e.g., mRNA) in a lipid:polynucleotide weight ratio of 5:1, 10:1, 15:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, 55:1, 60:1 or 70:1, or a range or any of these ratios such as, but not limited to, 5:1 to about 10:1, from about 5:1 to about 15:1, from about 5:1 to about 20:1, from about 5:1 to about 25:1, from about 5:1 to about 30:1, from about 5:1 to about 35:1, from about 5:1 to about 40:1, from about 5:1 to about 45:1, from about 5:1 to about 50:1, from about 5:1 to about 55:1, from about 5:1 to about 60:1, from about 5:1 to about 70:1, from about 10:1 to about 15:1, from about 10:1 to about 20:1, from about 10:1 to about 25:1, from about 10:1 to about 30:1, from about 10:1 to about 35:1, from about 10:1 to about 40:1, from about 10:1 to Attorney Docket No.45817-0124WO1 / MTX959.20 about 45:1, from about 10:1 to about 50:1, from about 10:1 to about 55:1, from about 10:1 to about 60:1, from about 10:1 to about 70:1, from about 15:1 to about 20:1, from about 15:1 to about 25:1,from about 15:1 to about 30:1, from about 15:1 to about 35:1, from about 15:1 to about 40:1, from about 15:1 to about 45:1, from about 15:1 to about 50:1, from about 15:1 to about 55:1, from about 15:1 to about 60:1 or from about 15:1 to about 70:1. [00630] In one embodiment, the lipid nanoparticles described herein can comprise the polynucleotide in a concentration from approximately 0.1 mg/ml to 2 mg/ml such as, but not limited to, 0.1 mg/ml, 0.2 mg/ml, 0.3 mg/ml, 0.4 mg/ml, 0.5 mg/ml, 0.6 mg/ml, 0.7 mg/ml, 0.8 mg/ml, 0.9 mg/ml, 1.0 mg/ml, 1.1 mg/ml, 1.2 mg/ml, 1.3 mg/ml, 1.4 mg/ml, 1.5 mg/ml, 1.6 mg/ml, 1.7 mg/ml, 1.8 mg/ml, 1.9 mg/ml, 2.0 mg/ml or greater than 2.0 mg/ml. (vii) Nanoparticle Compositions [00631] In some embodiments, the pharmaceutical compositions disclosed herein are formulated as lipid nanoparticles (LNP). Accordingly, the present disclosure also provides nanoparticle compositions comprising (i) a lipid composition comprising a delivery agent such as compound as described herein, and (ii) a polynucleotide encoding a Snu13 polypeptide. The present disclosure also provides nanoparticle compositions comprising (i) a lipid composition comprising a delivery agent such as compound as described herein, and (ii) a first polynucleotide encoding a Snu13 polypeptide and a second polynucleotide encoding a second polypeptide (e.g., a target polypeptide) and comprising a Snu13-binding site (e.g., a sequence set forth in any one of SEQ ID NOs:500-521, e.g., SEQ ID NO:500). In such nanoparticle composition, the lipid composition disclosed herein can encapsulate the polynucleotide(s) (e.g., the polynucleotide encoding the Snu13 polypeptide; or the polynucleotide encoding the Snu13 polypeptide and the second polynucleotide encoding the second (target) polypeptide). [00632] Nanoparticle compositions are typically sized on the order of micrometers or smaller and can include a lipid bilayer. Nanoparticle compositions encompass lipid nanoparticles (LNPs), liposomes (e.g., lipid vesicles), and lipoplexes. For example, a Attorney Docket No.45817-0124WO1 / MTX959.20 nanoparticle composition can be a liposome having a lipid bilayer with a diameter of 500 nm or less. [00633] Nanoparticle compositions include, for example, lipid nanoparticles (LNPs), liposomes, and lipoplexes. In some embodiments, nanoparticle compositions are vesicles including one or more lipid bilayers. In certain embodiments, a nanoparticle composition includes two or more concentric bilayers separated by aqueous compartments. Lipid bilayers can be functionalized and/or crosslinked to one another. Lipid bilayers can include one or more ligands, proteins, or channels. [00634] In one embodiment, a lipid nanoparticle comprises an ionizable amino lipid, a structural lipid, a phospholipid, and mRNA. In some embodiments, the LNP comprises an ionizable amino lipid, a PEG-modified lipid, a sterol and a structural lipid. In some embodiments, the LNP has a molar ratio of about 40-50% ionizable amino lipid; about 5-15% structural lipid; about 30-45% sterol; and about 1-5% PEG- modified lipid. [00635] In some embodiments, the LNP has a polydispersity value of less than 0.4. In some embodiments, the LNP has a net neutral charge at a neutral pH. In some embodiments, the LNP has a mean diameter of 50-150 nm. In some embodiments, the LNP has a mean diameter of 80-100 nm. [00636] As generally defined herein, the term “lipid” refers to a small molecule that has hydrophobic or amphiphilic properties. Lipids may be naturally occurring or synthetic. Examples of classes of lipids include, but are not limited to, fats, waxes, sterol-containing metabolites, vitamins, fatty acids, glycerolipids, glycerophospholipids, sphingolipids, saccharolipids, and polyketides, and prenol lipids. In some instances, the amphiphilic properties of some lipids leads them to form liposomes, vesicles, or membranes in aqueous media. [00637] In some embodiments, a lipid nanoparticle (LNP) may comprise an ionizable amino lipid. As used herein, the term “ionizable amino lipid” has its ordinary meaning in the art and may refer to a lipid comprising one or more charged moieties. In some embodiments, an ionizable amino lipid may be positively charged or negatively charged. An ionizable amino lipid may be positively charged, in which case it can be referred to as “cationic lipid”. In certain embodiments, an ionizable amino lipid molecule may comprise an amine group, and can be referred to as an Attorney Docket No.45817-0124WO1 / MTX959.20 ionizable amino lipid. As used herein, a “charged moiety” is a chemical moiety that carries a formal electronic charge, e.g., monovalent (+1, or -1), divalent (+2, or -2), trivalent (+3, or -3), etc. The charged moiety may be anionic (i.e., negatively charged) or cationic (i.e., positively charged). Examples of positively-charged moieties include amine groups (e.g., primary, secondary, and/or tertiary amines), ammonium groups, pyridinium group, guanidine groups, and imidizolium groups. In a particular embodiment, the charged moieties comprise amine groups. Examples of negatively- charged groups or precursors thereof, include carboxylate groups, sulfonate groups, sulfate groups, phosphonate groups, phosphate groups, hydroxyl groups, and the like. The charge of the charged moiety may vary, in some cases, with the environmental conditions, for example, changes in pH may alter the charge of the moiety, and/or cause the moiety to become charged or uncharged. In general, the charge density of the molecule may be selected as desired. [00638] It should be understood that the terms “charged” or “charged moiety” does not refer to a “partial negative charge" or “partial positive charge" on a molecule. The terms “partial negative charge" and “partial positive charge" are given its ordinary meaning in the art. A “partial negative charge" may result when a functional group comprises a bond that becomes polarized such that electron density is pulled toward one atom of the bond, creating a partial negative charge on the atom. Those of ordinary skill in the art will, in general, recognize bonds that can become polarized in this way. [00639] The ionizable amino lipid is sometimes referred to in the art as an “ionizable cationic lipid”. In one embodiment, the ionizable amino lipid may have a positively charged hydrophilic head and a hydrophobic tail that are connected via a linker structure. [00640] In addition to these, an ionizable amino lipid may also be a lipid including a cyclic amine group. [00641] In one embodiment, the ionizable amino lipid may be selected from, but not limited to, an ionizable amino lipid described in International Publication Nos. WO2013086354 and WO2013116126; the contents of each of which are herein incorporated by reference in their entirety. Attorney Docket No.45817-0124WO1 / MTX959.20 [00642] In yet another embodiment, the ionizable amino lipid may be selected from, but not limited to, Formula CLI-CLXXXXII of US Patent No.7,404,969; each of which is herein incorporated by reference in their entirety. [00643] In one embodiment, the lipid may be a cleavable lipid such as those described in International Publication No. WO2012170889, herein incorporated by reference in its entirety. In one embodiment, the lipid may be synthesized by methods known in the art and/or as described in International Publication Nos. WO2013086354; the contents of each of which are herein incorporated by reference in their entirety. [00644] Nanoparticle compositions can be characterized by a variety of methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of a nanoparticle composition. Dynamic light scattering or potentiometry (e.g., potentiometric titrations) can be used to measure zeta potentials. Dynamic light scattering can also be utilized to determine particle sizes. Instruments such as the Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) can also be used to measure multiple characteristics of a nanoparticle composition, such as particle size, polydispersity index, and zeta potential. [00645] The size of the nanoparticles can help counter biological reactions such as, but not limited to, inflammation, or can increase the biological effect of the polynucleotide. [00646] As used herein, “size” or “mean size” in the context of nanoparticle compositions refers to the mean diameter of a nanoparticle composition. [00647] In one embodiment, the polynucleotide encoding a Snu13 polypeptide is formulated in lipid nanoparticles having a diameter from about 10 to about 100 nm such as, but not limited to, about 10 to about 20 nm, about 10 to about 30 nm, about 10 to about 40 nm, about 10 to about 50 nm, about 10 to about 60 nm, about 10 to about 70 nm, about 10 to about 80 nm, about 10 to about 90 nm, about 20 to about 30 nm, about 20 to about 40 nm, about 20 to about 50 nm, about 20 to about 60 nm, about 20 to about 70 nm, about 20 to about 80 nm, about 20 to about 90 nm, about 20 to about 100 nm, about 30 to about 40 nm, about 30 to about 50 nm, about 30 to about 60 nm, about 30 to about 70 nm, about 30 to about 80 nm, about 30 to about 90 nm, Attorney Docket No.45817-0124WO1 / MTX959.20 about 30 to about 100 nm, about 40 to about 50 nm, about 40 to about 60 nm, about 40 to about 70 nm, about 40 to about 80 nm, about 40 to about 90 nm, about 40 to about 100 nm, about 50 to about 60 nm, about 50 to about 70 nm, about 50 to about 80 nm, about 50 to about 90 nm, about 50 to about 100 nm, about 60 to about 70 nm, about 60 to about 80 nm, about 60 to about 90 nm, about 60 to about 100 nm, about 70 to about 80 nm, about 70 to about 90 nm, about 70 to about 100 nm, about 80 to about 90 nm, about 80 to about 100 nm and/or about 90 to about 100 nm. [00648] In one embodiment, the nanoparticles have a diameter from about 10 to 500 nm. In one embodiment, the nanoparticle has a diameter greater than 100 nm, greater than 150 nm, greater than 200 nm, greater than 250 nm, greater than 300 nm, greater than 350 nm, greater than 400 nm, greater than 450 nm, greater than 500 nm, greater than 550 nm, greater than 600 nm, greater than 650 nm, greater than 700 nm, greater than 750 nm, greater than 800 nm, greater than 850 nm, greater than 900 nm, greater than 950 nm or greater than 1000 nm. [00649] In some embodiments, the largest dimension of a nanoparticle composition is 1 µm or shorter (e.g., 1 µm, 900 nm, 800 nm, 700 nm, 600 nm, 500 nm, 400 nm, 300 nm, 200 nm, 175 nm, 150 nm, 125 nm, 100 nm, 75 nm, 50 nm, or shorter). [00650] A nanoparticle composition can be relatively homogenous. A polydispersity index can be used to indicate the homogeneity of a nanoparticle composition, e.g., the particle size distribution of the nanoparticle composition. A small (e.g., less than 0.3) polydispersity index generally indicates a narrow particle size distribution. A nanoparticle composition can have a polydispersity index from about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of a nanoparticle composition disclosed herein can be from about 0.10 to about 0.20. [00651] The zeta potential of a nanoparticle composition can be used to indicate the electrokinetic potential of the composition. For example, the zeta potential can describe the surface charge of a nanoparticle composition. Nanoparticle compositions with relatively low charges, positive or negative, are generally desirable, as more highly charged species can interact undesirably with cells, tissues, and other elements in the body. In some embodiments, the zeta potential of a nanoparticle composition Attorney Docket No.45817-0124WO1 / MTX959.20 disclosed herein can be from about -10 mV to about +20 mV, from about -10 mV to about +15 mV, from about 10 mV to about +10 mV, from about -10 mV to about +5 mV, from about -10 mV to about 0 mV, from about -10 mV to about -5 mV, from about -5 mV to about +20 mV, from about -5 mV to about +15 mV, from about -5 mV to about +10 mV, from about -5 mV to about +5 mV, from about -5 mV to about 0 mV, from about 0 mV to about +20 mV, from about 0 mV to about +15 mV, from about 0 mV to about +10 mV, from about 0 mV to about +5 mV, from about +5 mV to about +20 mV, from about +5 mV to about +15 mV, or from about +5 mV to about +10 mV. [00652] In some embodiments, the zeta potential of the lipid nanoparticles can be from about 0 mV to about 100 mV, from about 0 mV to about 90 mV, from about 0 mV to about 80 mV, from about 0 mV to about 70 mV, from about 0 mV to about 60 mV, from about 0 mV to about 50 mV, from about 0 mV to about 40 mV, from about 0 mV to about 30 mV, from about 0 mV to about 20 mV, from about 0 mV to about 10 mV, from about 10 mV to about 100 mV, from about 10 mV to about 90 mV, from about 10 mV to about 80 mV, from about 10 mV to about 70 mV, from about 10 mV to about 60 mV, from about 10 mV to about 50 mV, from about 10 mV to about 40 mV, from about 10 mV to about 30 mV, from about 10 mV to about 20 mV, from about 20 mV to about 100 mV, from about 20 mV to about 90 mV, from about 20 mV to about 80 mV, from about 20 mV to about 70 mV, from about 20 mV to about 60 mV, from about 20 mV to about 50 mV, from about 20 mV to about 40 mV, from about 20 mV to about 30 mV, from about 30 mV to about 100 mV, from about 30 mV to about 90 mV, from about 30 mV to about 80 mV, from about 30 mV to about 70 mV, from about 30 mV to about 60 mV, from about 30 mV to about 50 mV, from about 30 mV to about 40 mV, from about 40 mV to about 100 mV, from about 40 mV to about 90 mV, from about 40 mV to about 80 mV, from about 40 mV to about 70 mV, from about 40 mV to about 60 mV, and from about 40 mV to about 50 mV. In some embodiments, the zeta potential of the lipid nanoparticles can be from about 10 mV to about 50 mV, from about 15 mV to about 45 mV, from about 20 mV to about 40 mV, and from about 25 mV to about 35 mV. In some embodiments, the zeta potential of the lipid nanoparticles can be about 10 mV, about 20 mV, about 30 mV, Attorney Docket No.45817-0124WO1 / MTX959.20 about 40 mV, about 50 mV, about 60 mV, about 70 mV, about 80 mV, about 90 mV, and about 100 mV. [00653] The term “encapsulation efficiency” of a polynucleotide describes the amount of the polynucleotide that is encapsulated by or otherwise associated with a nanoparticle composition after preparation, relative to the initial amount provided. As used herein, “encapsulation” can refer to complete, substantial, or partial enclosure, confinement, surrounding, or encasement. [00654] Encapsulation efficiency is desirably high (e.g., close to 100%). The encapsulation efficiency can be measured, for example, by comparing the amount of the polynucleotide in a solution containing the nanoparticle composition before and after breaking up the nanoparticle composition with one or more organic solvents or detergents. [00655] Fluorescence can be used to measure the amount of free polynucleotide in a solution. For the nanoparticle compositions described herein, the encapsulation efficiency of a polynucleotide can be at least 50%, for example 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency can be at least 90%. [00656] The amount of a polynucleotide present in a pharmaceutical composition disclosed herein can depend on multiple factors such as the size of the polynucleotide, desired target and/or application, or other properties of the nanoparticle composition as well as on the properties of the polynucleotide. [00657] For example, the amount of an mRNA useful in a nanoparticle composition can depend on the size (expressed as length, or molecular mass), sequence, and other characteristics of the mRNA. The relative amounts of a polynucleotide in a nanoparticle composition can also vary. [00658] The relative amounts of the lipid composition and the polynucleotide present in a lipid nanoparticle composition of the present disclosure can be optimized according to considerations of efficacy and tolerability. For compositions including an mRNA as a polynucleotide, the N:P ratio can serve as a useful metric. [00659] As the N:P ratio of a nanoparticle composition controls both expression and tolerability, nanoparticle compositions with low N:P ratios and strong expression Attorney Docket No.45817-0124WO1 / MTX959.20 are desirable. N:P ratios vary according to the ratio of lipids to RNA in a nanoparticle composition. [00660] In general, a lower N:P ratio is preferred. The one or more RNA, lipids, and amounts thereof can be selected to provide an N:P ratio from about 2:1 to about 30:1, such as 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1, or 30:1. In certain embodiments, the N:P ratio can be from about 2:1 to about 8:1. In other embodiments, the N:P ratio is from about 5:1 to about 8:1. In certain embodiments, the N:P ratio is between 5:1 and 6:1. In one specific aspect, the N:P ratio is about is about 5.67:1. [00661] In addition to providing nanoparticle compositions, the present disclosure also provides methods of producing lipid nanoparticles comprising encapsulating a polynucleotide. Such method comprises using any of the pharmaceutical compositions disclosed herein and producing lipid nanoparticles in accordance with methods of production of lipid nanoparticles known in the art. See, e.g., Wang et al. (2015) “Delivery of oligonucleotides with lipid nanoparticles” Adv. Drug Deliv. Rev.87:68- 80; Silva et al. (2015) “Delivery Systems for Biopharmaceuticals. Part I: Nanoparticles and Microparticles” Curr. Pharm. Technol.16: 940-954; Naseri et al. (2015) “Solid Lipid Nanoparticles and Nanostructured Lipid Carriers: Structure, Preparation and Application” Adv. Pharm. Bull.5:305-13; Silva et al. (2015) “Lipid nanoparticles for the delivery of biopharmaceuticals” Curr. Pharm. Biotechnol. 16:291-302, and references cited therein. mRNA-Lipid Adducts [00662] It has been determined that certain ionizable lipids are susceptible to the formation of lipid-polynucleotide adducts. In particular, ionizable lipids that comprise a tertiary amine group may decompose into one or both of a secondary amine and a reactive aldehyde species capable of interacting with polynucleotides (such as mRNA) to form an ionizable lipid-polynucleotide adduct impurity that can be detected by reverse phase ion pair chromatography (RP-IP HPLC). For example, oxidation of the tertiary amine may lead to N-oxide formation that can undergo acid/base-catalyzed hydrolysis at the amine to generate aldehydes and secondary Attorney Docket No.45817-0124WO1 / MTX959.20 amines which may form adducts with mRNA. Thus, in some aspects, the ionizable lipid-polynucleotide adduct impurity is an aldehyde-mRNA adduct impurity. [00663] It also has been determined that such adducts may disrupt mRNA translation and impact the activity of lipid nanoparticle (LNP) formulated mRNA products. Thus, it can be advantageous to prepare and use LNP compositions with a reduced content of ionizable lipid-polynucleotide adduct impurity, such as wherein less than about 20%, less than about 10%, less than about 5%, or less than about 1%, of the mRNA is in the form of ionizable lipid-polynucleotide adduct impurity, as may be measured by RP-IP HPLC. Thus, in accordance with some aspects, an LNP composition is provided wherein less than about 10%, less than about 5%, or less than about 1%, of the mRNA is in the form of ionizable lipid-polynucleotide adduct impurity, including less than 10%, less than 5%, or less than 1%, as may be measured by RP-IP HPLC. [00664] In some aspects, an amount of lipid aldehydes in the composition is less than about 50 ppm, including less than 50 ppm. Additionally or alternatively, in some aspects an amount of N-oxide compounds in the composition is less than about 50 ppm, including less than 50 ppm. Additionally or alternatively, in some aspects an amount of transition metals, such as Fe, in the composition is less than about 50 ppm, including less than 50 ppm. Additionally or alternatively, in some aspects an amount of alkyl halide compounds in the composition is less than about 50 ppm, including less than 50 ppm. Additionally or alternatively, in some aspects an amount of anhydride compounds in the composition is less than about 50 ppm, including less than 50 ppm. Additionally or alternatively, in some aspects an amount of ketone compounds in the composition is less than about 50 ppm, including less than 50 ppm. Additionally or alternatively, in some aspects an amount of conjugated diene compounds in the composition is less than about 50 ppm, including less than 50 ppm. [00665] In some aspects, the composition is stable against the formation of ionizable lipid-polynucleotide adduct impurity. In some aspects, an amount of ionizable lipid-polynucleotide adduct impurity in the composition increases at an average rate of less than about 2% per day when stored at a temperature of about 25 °C or below, including at an average rate of less than 2% per day. In some aspects, an amount of ionizable lipid-polynucleotide adduct impurity in the composition increases Attorney Docket No.45817-0124WO1 / MTX959.20 at an average rate of less than about 0.5% per day when stored at a temperature of about 5 °C or below, including at an average rate of less than 0.5% per day. In some aspects, an amount of ionizable lipid-polynucleotide adduct impurity in the composition increases at an average rate of less than about 0.5% per day when stored at a refrigerated temperature, optionally wherein the refrigerated temperature is about 5 °C. [00666] Lipid vehicle (e.g., LNP) compositions with a reduced content of ionizable lipid-polynucleotide adduct impurity can be prepared by methods that inhibit formation of one or both of N-oxides and aldehydes. Such methods may comprise treating a composition comprising an ionizable lipid comprising a tertiary amine group to inhibit formation of one or both of N-oxides and aldehydes, such as by treating the composition with a reducing agent; treating the composition with a chelating agent; adjusting the pH of the composition; adjusting the temperature of the composition; and adjusting the buffer in the composition. Such methods may comprise, prior to combining the ionizable lipid with a polynucleotide, one or more of treating the ionizable lipid with a scavenging agent; treating the ionizable lipid with a reductive treatment agent; treating the ionizable lipid with a reducing agent; treating the ionizable lipid with a chelating agent; treating the polynucleotide with a reducing agent; and treating the polynucleotide with a chelating agent. [00667] In accordance with any of the foregoing, the scavenging agent, reductive treatment agent, and/or reducing agent may be an agent that reacts with aldehyde, ketone, anhydride and/or diene compounds. A scavenging agent may comprise one or more selected from (O-(2,3,4,5,6-Pentafluorobenzyl)hydroxylamine hydrochloride) (PFBHA), methoxyamine (e.g., methoxyamine hydrochloride), benzyloxyamine (e.g., benzyloxyamine hydrochloride), ethoxyamine (e.g., ethoxyamine hydrochloride), 4- [2-(aminooxy)ethyl]morpholine dihydrochloride, butoxyamine (e.g., tert-butoxyamine hydrochloride), 4-Dimethylaminopyridine (DMAP), 1,4-diazabicyclo[2.2.2]octane (DABCO), Triethylamine (TEA), Piperidine 4-carboxylate (BPPC), and combinations thereof. A reductive treatment agent may comprise a boron compound (e.g., sodium borohydride and/or bis(pinacolato)diboron). A reductive treatment agent may comprise a boron compound, such as one or both of sodium borohydride and bis(pinacolato)diboron). A chelating agent may comprise immobilized iminodiacetic Attorney Docket No.45817-0124WO1 / MTX959.20 acid. A reducing agent may comprise an immobilized reducing agent, such as immobilized diphenylphosphine on silica (Si-DPP), immobilized thiol on agarose (Ag-Thiol), immobilized cysteine on silica (Si-Cysteine), immobilized thiol on silica (Si-Thiol), or a combination thereof. A reducing agent may comprise a free reducing agent, such as potassium metabisulfite, sodium thioglycolate, tris(2- carboxyethyl)phosphine (TCEP), sodium thiosulfate, N-acetyl cysteine, glutathione, dithiothreitol (DTT), cystamine, dithioerythritol (DTE), dichlorodiphenyltrichloroethane (DDT), homocysteine, lipoic acid, or a combination thereof. [00668] In accordance with any of the foregoing, the pH may be, or adjusted to be, a pH of from about 7 to about 9. [00669] In accordance with any of the foregoing, a buffer may be selected from sodium phosphate, sodium citrate, sodium succinate, histidine, histidine-HCl, sodium malate, sodium carbonate, and TRIS (tris(hydroxymethyl)aminomethane). In accordance with any of the foregoing, a buffer may be TRIS and may be, or adjusted to be, from about 20 mM to about 150 mM TRIS. [00670] In accordance with any of the foregoing, the temperature of the composition may be, or adjusted to be, 25 ⁰C or less. [00671] The composition may also comprise a free reducing agent or antioxidant. 22. Other Delivery Agents a. Liposomes, Lipoplexes, and Lipid Nanoparticles [00672] In some embodiments, the compositions or formulations of the present disclosure comprise a delivery agent, e.g., a liposome, a lipolexes, a lipid nanoparticle, or any combination thereof. The polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a Snu13 polypeptide) can be formulated using one or more liposomes, lipoplexes, or lipid nanoparticles. Liposomes, lipoplexes, or lipid nanoparticles can be used to improve the efficacy of the polynucleotides directed protein production as these formulations can increase cell transfection by the polynucleotide; and/or increase the translation of encoded protein. Attorney Docket No.45817-0124WO1 / MTX959.20 The liposomes, lipoplexes, or lipid nanoparticles can also be used to increase the stability of the polynucleotides. [00673] Liposomes are artificially-prepared vesicles that can primarily be composed of a lipid bilayer and can be used as a delivery vehicle for the administration of pharmaceutical formulations. Liposomes can be of different sizes. A multilamellar vesicle (MLV) can be hundreds of nanometers in diameter, and can contain a series of concentric bilayers separated by narrow aqueous compartments. A small unicellular vesicle (SUV) can be smaller than 50 nm in diameter, and a large unilamellar vesicle (LUV) can be between 50 and 500 nm in diameter. Liposome design can include, but is not limited to, opsonins or ligands to improve the attachment of liposomes to unhealthy tissue or to activate events such as, but not limited to, endocytosis. Liposomes can contain a low or a high pH value in order to improve the delivery of the pharmaceutical formulations. [00674] The formation of liposomes can depend on the pharmaceutical formulation entrapped and the liposomal ingredients, the nature of the medium in which the lipid vesicles are dispersed, the effective concentration of the entrapped substance and its potential toxicity, any additional processes involved during the application and/or delivery of the vesicles, the optimal size, polydispersity and the shelf-life of the vesicles for the intended application, and the batch-to-batch reproducibility and scale up production of safe and efficient liposomal products, etc. [00675] As a non-limiting example, liposomes such as synthetic membrane vesicles can be prepared by the methods, apparatus and devices described in U.S. Pub. Nos. US20130177638, US20130177637, US20130177636, US20130177635, US20130177634, US20130177633, US20130183375, US20130183373, and US20130183372. In some embodiments, the polynucleotides described herein can be encapsulated by the liposome and/or it can be contained in an aqueous core that can then be encapsulated by the liposome as described in, e.g., Intl. Pub. Nos. WO2012031046, WO2012031043, WO2012030901, WO2012006378, and WO2013086526; and U.S. Pub. Nos. US20130189351, US20130195969 and US20130202684. Each of the references in herein incorporated by reference in its entirety. Attorney Docket No.45817-0124WO1 / MTX959.20 [00676] In some embodiments, the polynucleotides described herein can be formulated in a cationic oil-in-water emulsion where the emulsion particle comprises an oil core and a cationic lipid that can interact with the polynucleotide anchoring the molecule to the emulsion particle. In some embodiments, the polynucleotides described herein can be formulated in a water-in-oil emulsion comprising a continuous hydrophobic phase in which the hydrophilic phase is dispersed. Exemplary emulsions can be made by the methods described in Intl. Pub. Nos. WO2012006380 and WO201087791, each of which is herein incorporated by reference in its entirety. [00677] In some embodiments, the polynucleotides described herein can be formulated in a lipid-polycation complex. The formation of the lipid-polycation complex can be accomplished by methods as described in, e.g., U.S. Pub. No. US20120178702. As a non-limiting example, the polycation can include a cationic peptide or a polypeptide such as, but not limited to, polylysine, polyornithine and/or polyarginine and the cationic peptides described in Intl. Pub. No. WO2012013326 or U.S. Pub. No. US20130142818. Each of the references is herein incorporated by reference in its entirety. [00678] In some embodiments, the polynucleotides described herein can be formulated in a lipid nanoparticle (LNP) such as those described in Intl. Pub. Nos. WO2013123523, WO2012170930, WO2011127255 and WO2008103276; and U.S. Pub. No. US20130171646, each of which is herein incorporated by reference in its entirety. [00679] Lipid nanoparticle formulations typically comprise one or more lipids. In some embodiments, the lipid is an ionizable amino lipid, sometimes referred to in the art as an “ionizable cationic lipid”. In some embodiments, lipid nanoparticle formulations further comprise other components, including a phospholipid, a structural lipid, and a molecule capable of reducing particle aggregation, for example a PEG or PEG-modified lipid. [00680] Exemplary ionizable amino lipids include, but not limited to, any Compounds II, VI, A, and B disclosed herein, DLin-MC3-DMA (MC3), DLin-DMA, DLenDMA, DLin-D-DMA, DLin-K-DMA, DLin-M-C2-DMA, DLin-K-DMA, DLin- KC2-DMA, DLin-KC3-DMA, DLin-KC4-DMA, DLin-C2K-DMA, DLin-MP-DMA, Attorney Docket No.45817-0124WO1 / MTX959.20 DODMA, 98N12-5, C12-200, DLin-C-DAP, DLin-DAC, DLinDAP, DLinAP, DLin- EG-DMA, DLin-2-DMAP, KL10, KL22, KL25, Octyl-CLinDMA, Octyl-CLinDMA (2R), Octyl-CLinDMA (2S), and any combination thereof. Other exemplary ionizable amino lipids include, (13Z,16Z)-N,N-dimethyl-3-nonyldocosa-13,16-dien- 1-amine (L608), (20Z,23Z)-N,N-dimethylnonacosa-20,23-dien-10-amine, (17Z,20Z)- N,N-dimemylhexacosa-17,20-dien-9-amine, (16Z,19Z)-N5N-dimethylpentacosa- 16,19-dien-8-amine, (13Z,16Z)-N,N-dimethyldocosa-13,16-dien-5-amine, (12Z,15Z)- N,N-dimethylhenicosa-12,15-dien-4-amine, (14Z,17Z)-N,N-dimethyltricosa-14,17- dien-6-amine, (15Z,18Z)-N,N-dimethyltetracosa-15,18-dien-7-amine, (18Z,21Z)- N,N-dimethylheptacosa-18,21-dien-10-amine, (15Z,18Z)-N,N-dimethyltetracosa- 15,18-dien-5-amine, (14Z,17Z)-N,N-dimethyltricosa-14,17-dien-4-amine, (19Z,22Z)- N,N-dimeihyloctacosa-19,22-dien-9-amine, (18Z,21Z)-N,N-dimethylheptacosa- 18,21-dien-8-amine, (17Z,20Z)-N,N-dimethylhexacosa-17,20-dien-7-amine, (16Z,19Z)-N,N-dimethylpentacosa-16,19-dien-6-amine, (22Z,25Z)-N,N- dimethylhentriaconta-22,25-dien-10-amine, (21Z,24Z)-N,N-dimethyltriaconta-21,24- dien-9-amine, (18Z)-N,N-dimetylheptacos-18-en-10-amine, (17Z)-N,N- dimethylhexacos-17-en-9-amine, (19Z,22Z)-N,N-dimethyloctacosa-19,22-dien-7- amine, Ν,Ν-dimethylheptacosan-10-amine, (20Z,23Z)-N-ethyl-N-methylnonacosa- 20,23-dien-10-amine, 1-[(11Z,14Z)-l-nonylicosa-11,14-dien-l-yl]pyrrolidine, (20Z)- N,N-dimethylheptacos-20-en-10-amine, (15Z)-N,N-dimethyl eptacos-15-en-10- amine, (14Z)-N,N-dimethylnonacos-14-en-10-amine, (17Z)-N,N-dimethylnonacos- 17-en-10-amine, (24Z)-N,N-dimethyltritriacont-24-en-10-amine, (20Z)-N,N- dimethylnonacos-20-en-10-amine, (22Z)-N,N-dimethylhentriacont-22-en-10-amine, (16Z)-N,N-dimethylpentacos-16-en-8-amine, (12Z,15Z)-N,N-dimethyl-2- nonylhenicosa-12,15-dien-1-amine, N,N-dimethyl-l-[(lS,2R)-2-octylcyclopropyl] eptadecan-8-amine, l-[(1S,2R)-2-hexylcyclopropyl]-N,N-dimethylnonadecan-10- amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]nonadecan-10-amin e, N,N- dimethyl-21-[(1S,2R)-2-octylcyclopropyl]henicosan-10-amine, N,N-dimethyl-l- [(lS,2S)-2-{[(1R,2R)-2-pentylcycIopropyl]methyl}cyclopropyl] nonadecan-10-amine, N,N-dimethyl-l-[(1S,2R)-2-octylcyclopropyl]hexadecan-8-amine , N,N-dimethyl- [(lR,2S)-2-undecyIcyclopropyl]tetradecan-5-amine, N,N-dimethyl-3-{7-[(lS,2R)-2- octylcyclopropyl]heptyl}dodecan-1-amine, 1-[(1R,2S)-2-heptylcyclopropyl]-N,N- Attorney Docket No.45817-0124WO1 / MTX959.20 dimethyloctadecan-9-amine, 1-[(1S,2R)-2-decylcyclopropyl]-N,N- dimethylpentadecan-6-amine, N,N-dimethyl-l-[(lS,2R)-2- octylcyclopropyl]pentadecan-8-amine, R-N,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12- dien-1-yloxy]-3-(octyloxy)propan-2-amine, S-N,N-dimethyl-1-[(9Z,12Z)-octadeca- 9,12-dien-1-yloxy]-3-(octyloxy)propan-2-amine, 1-{2-[(9Z,12Z)-octadeca-9,12-dien- 1-yloxy]-1-[(octyloxy)methyl]ethyl}pyrrolidine, (2S)-Ν,Ν-dimethyl-1-[(9Z,12Z)- octadeca-9,12-dien-1-yloxy]-3-[(5Z)-oct-5-en-1-yloxy]propan- 2-amine, 1-{2- [(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-1-[(octyloxy)methyl]et hyl}azetidine, (2S)-1- (hexyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-ylo xy]propan-2-amine, (2S)-1-(heptyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-di en-1-yloxy]propan-2- amine, Ν,Ν-dimethyl-1-(nonyloxy)-3-[(9Z,12Z)-octadeca-9,12-dien-1 -yloxy]propan- 2-amine, Ν,Ν-dimethyl-1-[(9Z)-octadec-9-en-l-yloxy]-3-(octyloxy)pro pan-2-amine; (2S)-N,N-dimethyl-l-[(6Z,9Z,12Z)-octadeca-6,9,12-trien-l-ylo xy]-3- (octyloxy)propan-2-amine, (2S)-1-[(11Z,14Z)-icosa-11,14-dien-1-yloxy]-N,N- dimethyl-3-(pentyloxy)propan-2-amine, (2S)-1-(hexyloxy)-3-[(11Z,14Z)-icosa-11,14- dien-l-yloxy]-N,N-dimethylpropan-2-amine, 1-[(11Z,14Z)-icosa-11,14-dien-l-yloxy]- N,N-dimethyl-3-(octyloxy)propan-2-amine, 1-[(13Z,16Z)-docosa-13,16-dien-l- yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, (2S)-1-[(13Z, 16Z)-docosa-13,16- dien-1-yloxy]-3-(hexyloxy)-N,N-dimethylpropan-2-amine, (2S)-1-[(13Z)-docos-13- en-1-yloxy]-3-(hexyloxy)-N,N-dimethylpropan-2-amine, 1-[(13Z)-docos-13-en-1- yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, 1-[(9Z)-hexadec-9-en-1-yloxy]- N,N-dimethyl-3-(octyloxy)propan-2-amine, (2R)-N,N-dimethyl-H(1- metoyloctyl)oxy]-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]prop an-2-amine, (2R)-1- [(3,7-dimethyloctyl)oxy]-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9 ,12-dien-l- yloxy]propan-2-amine, Ν,Ν-dimethyl-1-(octyloxy)-3-({8-[(1S,2S)-2-{[(1R,2R)-2- pentylcyclopropyl]methyl}cyclopropyl]octyl}oxy)propan-2-amin e, Ν,Ν-dimethyl-1- {[8-(2-oclylcyclopropyl)octyl]oxy}-3-(octyloxy)propan-2-amin e, and (11E,20Z,23Z)- N,N-dimethylnonacosa-11,20,2-trien-10-amine, and any combination thereof. [00681] Phospholipids include, but are not limited to, glycerophospholipids such as phosphatidylcholines, phosphatidylethanolamines, phosphatidylserines, phosphatidylinositols, phosphatidy glycerols, and phosphatidic acids. Phospholipids also include phosphosphingolipid, such as sphingomyelin. In some embodiments, the Attorney Docket No.45817-0124WO1 / MTX959.20 phospholipids are DLPC, DMPC, DOPC, DPPC, DSPC, DUPC, 18:0 Diether PC, DLnPC, DAPC, DHAPC, DOPE, 4ME 16:0 PE, DSPE, DLPE,DLnPE, DAPE, DHAPE, DOPG, and any combination thereof. In some embodiments, the phospholipids are MPPC, MSPC, PMPC, PSPC, SMPC, SPPC, DHAPE, DOPG, and any combination thereof. In some embodiments, the amount of phospholipids (e.g., DSPC) in the lipid composition ranges from about 1 mol% to about 20 mol%. In some embodiments, the amount of phospholipids (e.g., DSPC) in the lipid composition ranges from about 5-15 mol%, optionally 10-12 mol%, for example, 5-6 mol%, 6-7 mol%, 7-8 mol%, 8-9 mol%, 9-10 mol%, 10-11 mol%, 11-12 mol%, 12-13 mol%, 13-14 mol%, or 14-15 mol%. [00682] The structural lipids include sterols and lipids containing sterol moieties. In some embodiments, the structural lipids include cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, and mixtures thereof. In some embodiments, the structural lipid is cholesterol. In some embodiments, the amount of the structural lipids (e.g., cholesterol) in the lipid composition ranges from about 20 mol% to about 60 mol%. In some embodiments, the amount of the structural lipids (e.g., cholesterol) in the lipid composition ranges from about 30-45 mol%, optionally 35-40 mol%, for example, 30-31 mol%, 31-32 mol%, 32-33 mol%, 33-34 mol%, 35-35 mol%, 35-36 mol%, 36-37 mol%, 38-38 mol%, 38-39 mol%, or 39-40 mol%. [00683] The PEG-modified lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines and PEG-modified 1,2- diacyloxypropan-3-amines. Such lipids are also referred to as PEGylated lipids. For example, a PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG DMPE, PEG-DPPC, or a PEG-DSPE lipid. In some embodiments, the PEG-lipid are 1,2- dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG-DMG), 1,2-distearoyl-sn- glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)] (PEG-DSPE), PEG- disteryl glycerol (PEG-DSG), PEG-dipalmetoleyl, PEG-dioleyl, PEG-distearyl, PEG- diacylglycamide (PEG-DAG), PEG-dipalmitoyl phosphatidylethanolamine (PEG- DPPE), or PEG-l,2-dimyristyloxlpropyl-3-amine (PEG-c-DMA). In some embodiments, the PEG moiety has a size of about 1000, 2000, 5000, 10,000, 15,000 Attorney Docket No.45817-0124WO1 / MTX959.20 or 20,000 daltons. In some embodiments, the amount of PEG-lipid in the lipid composition ranges from about 0 mol% to about 5 mol%. In some embodiments, the amount of PEG-lipid in the lipid composition ranges from about 1-5%, optionally 1-3 mol%, for example 1.5 to 2.5 mol%, 1-2 mol%, 2-3 mol%, 3-4 mol%, or 4-5 mol%. [00684] In some embodiments, the LNP formulations described herein can additionally comprise a permeability enhancer molecule. Non-limiting permeability enhancer molecules are described in U.S. Pub. No. US20050222064, herein incorporated by reference in its entirety. [00685] The LNP formulations can further contain a phosphate conjugate. The phosphate conjugate can increase in vivo circulation times and/or increase the targeted delivery of the nanoparticle. Phosphate conjugates can be made by the methods described in, e.g., Intl. Pub. No. WO2013033438 or U.S. Pub. No. US20130196948. The LNP formulation can also contain a polymer conjugate (e.g., a water soluble conjugate) as described in, e.g., U.S. Pub. Nos. US20130059360, US20130196948, and US20130072709. Each of the references is herein incorporated by reference in its entirety. [00686] The LNP formulations can comprise a conjugate to enhance the delivery of nanoparticles of the present invention in a subject. Further, the conjugate can inhibit phagocytic clearance of the nanoparticles in a subject. In some embodiments, the conjugate can be a "self" peptide designed from the human membrane protein CD47 (e.g., the "self" particles described by Rodriguez et al, Science 2013339, 971-975, herein incorporated by reference in its entirety). As shown by Rodriguez et al. the self peptides delayed macrophage-mediated clearance of nanoparticles which enhanced delivery of the nanoparticles. [00687] The LNP formulations can comprise a carbohydrate carrier. As a non- limiting example, the carbohydrate carrier can include, but is not limited to, an anhydride-modified phytoglycogen or glycogen-type material, phytoglycogen octenyl succinate, phytoglycogen beta-dextrin, anhydride-modified phytoglycogen beta- dextrin (e.g., Intl. Pub. No. WO2012109121, herein incorporated by reference in its entirety). [00688] The LNP formulations can be coated with a surfactant or polymer to improve the delivery of the particle. In some embodiments, the LNP can be coated Attorney Docket No.45817-0124WO1 / MTX959.20 with a hydrophilic coating such as, but not limited to, PEG coatings and/or coatings that have a neutral surface charge as described in U.S. Pub. No. US20130183244, herein incorporated by reference in its entirety. [00689] The LNP formulations can be engineered to alter the surface properties of particles so that the lipid nanoparticles can penetrate the mucosal barrier as described in U.S. Pat. No.8,241,670 or Intl. Pub. No. WO2013110028, each of which is herein incorporated by reference in its entirety. [00690] The LNP engineered to penetrate mucus can comprise a polymeric material (i.e., a polymeric core) and/or a polymer-vitamin conjugate and/or a tri-block co-polymer. The polymeric material can include, but is not limited to, polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, poly(styrenes), polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyeneimines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates. [00691] LNP engineered to penetrate mucus can also include surface altering agents such as, but not limited to, polynucleotides, anionic proteins (e.g., bovine serum albumin), surfactants (e.g., cationic surfactants such as for example dimethyldioctadecyl-ammonium bromide), sugars or sugar derivatives (e.g., cyclodextrin), nucleic acids, polymers (e.g., heparin, polyethylene glycol and poloxamer), mucolytic agents (e.g., N-acetylcysteine, mugwort, bromelain, papain, clerodendrum, acetylcysteine, bromhexine, carbocisteine, eprazinone, mesna, ambroxol, sobrerol, domiodol, letosteine, stepronin, tiopronin, gelsolin, thymosin β4 dornase alfa, neltenexine, erdosteine) and various DNases including rhDNase. [00692] In some embodiments, the mucus penetrating LNP can be a hypotonic formulation comprising a mucosal penetration enhancing coating. The formulation can be hypotonic for the epithelium to which it is being delivered. Non-limiting examples of hypotonic formulations can be found in, e.g., Intl. Pub. No. WO2013110028, herein incorporated by reference in its entirety. [00693] In some embodiments, the polynucleotide described herein is formulated as a lipoplex, such as, without limitation, the ATUPLEXTM system, the DACC system, the DBTC system and other siRNA-lipoplex technology from Silence Therapeutics (London, United Kingdom), STEMFECTTM from STEMGENT® Attorney Docket No.45817-0124WO1 / MTX959.20 (Cambridge, MA), and polyethylenimine (PEI) or protamine-based targeted and non- targeted delivery of nucleic acids (Aleku et al. Cancer Res.200868:9788-9798; Strumberg et al. Int J Clin Pharmacol Ther 201250:76-78; Santel et al., Gene Ther 200613:1222-1234; Santel et al., Gene Ther 200613:1360-1370; Gutbier et al., Pulm Pharmacol. Ther.201023:334-344; Kaufmann et al. Microvasc Res 201080:286- 293Weide et al. J Immunother.200932:498-507; Weide et al. J Immunother.2008 31:180-188; Pascolo Expert Opin. Biol. Ther.4:1285-1294; Fotin-Mleczek et al., 2011 J. Immunother.34:1-15; Song et al., Nature Biotechnol.2005, 23:709-717; Peer et al., Proc Natl Acad Sci U S A.20076;104:4095-4100; deFougerolles Hum Gene Ther.200819:125-132; all of which are incorporated herein by reference in its entirety). [00694] In some embodiments, the polynucleotides described herein are formulated as a solid lipid nanoparticle (SLN), which can be spherical with an average diameter between 10 to 1000 nm. SLN possess a solid lipid core matrix that can solubilize lipophilic molecules and can be stabilized with surfactants and/or emulsifiers. Exemplary SLN can be those as described in Intl. Pub. No. WO2013105101, herein incorporated by reference in its entirety. [00695] In some embodiments, the polynucleotides described herein can be formulated for controlled release and/or targeted delivery. As used herein, "controlled release" refers to a pharmaceutical composition or compound release profile that conforms to a particular pattern of release to effect a therapeutic outcome. In one embodiment, the polynucleotides can be encapsulated into a delivery agent described herein and/or known in the art for controlled release and/or targeted delivery. As used herein, the term "encapsulate" means to enclose, surround or encase. As it relates to the formulation of the compounds of the invention, encapsulation can be substantial, complete or partial. The term "substantially encapsulated" means that at least greater than 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, or greater than 99% of the pharmaceutical composition or compound of the invention can be enclosed, surrounded or encased within the delivery agent. "Partially encapsulation" means that less than 10, 10, 20, 30, 4050 or less of the pharmaceutical composition or compound of the invention can be enclosed, surrounded or encased within the delivery agent. Attorney Docket No.45817-0124WO1 / MTX959.20 [00696] Advantageously, encapsulation can be determined by measuring the escape or the activity of the pharmaceutical composition or compound of the invention using fluorescence and/or electron micrograph. For example, at least 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, or greater than 99% of the pharmaceutical composition or compound of the invention are encapsulated in the delivery agent. [00697] In some embodiments, the polynucleotides described herein can be encapsulated in a therapeutic nanoparticle, referred to herein as "therapeutic nanoparticle polynucleotides." Therapeutic nanoparticles can be formulated by methods described in, e.g., Intl. Pub. Nos. WO2010005740, WO2010030763, WO2010005721, WO2010005723, and WO2012054923; and U.S. Pub. Nos. US20110262491, US20100104645, US20100087337, US20100068285, US20110274759, US20100068286, US20120288541, US20120140790, US20130123351 and US20130230567; and U.S. Pat. Nos.8,206,747, 8,293,276, 8,318,208 and 8,318,211, each of which is herein incorporated by reference in its entirety. [00698] In some embodiments, the therapeutic nanoparticle polynucleotide can be formulated for sustained release. As used herein, "sustained release" refers to a pharmaceutical composition or compound that conforms to a release rate over a specific period of time. The period of time can include, but is not limited to, hours, days, weeks, months and years. As a non-limiting example, the sustained release nanoparticle of the polynucleotides described herein can be formulated as disclosed in Intl. Pub. No. WO2010075072 and U.S. Pub. Nos. US20100216804, US20110217377, US20120201859 and US20130150295, each of which is herein incorporated by reference in their entirety. [00699] In some embodiments, the therapeutic nanoparticle polynucleotide can be formulated to be target specific, such as those described in Intl. Pub. Nos. WO2008121949, WO2010005726, WO2010005725, WO2011084521 and WO2011084518; and U.S. Pub. Nos. US20100069426, US20120004293 and US20100104655, each of which is herein incorporated by reference in its entirety. [00700] The LNPs can be prepared using microfluidic mixers or micromixers. Exemplary microfluidic mixers can include, but are not limited to, a slit interdigital Attorney Docket No.45817-0124WO1 / MTX959.20 micromixer including, but not limited to those manufactured by Microinnova (Allerheiligen bei Wildon, Austria) and/or a staggered herringbone micromixer (SHM) (see Zhigaltsevet al., "Bottom-up design and synthesis of limit size lipid nanoparticle systems with aqueous and triglyceride cores using millisecond microfluidic mixing," Langmuir 28:3633-40 (2012); Belliveau et al., "Microfluidic synthesis of highly potent limit-size lipid nanoparticles for in vivo delivery of siRNA," Molecular Therapy-Nucleic Acids.1:e37 (2012); Chen et al., "Rapid discovery of potent siRNA-containing lipid nanoparticles enabled by controlled microfluidic formulation," J. Am. Chem. Soc.134(16):6948-51 (2012); each of which is herein incorporated by reference in its entirety). Exemplary micromixers include Slit Interdigital Microstructured Mixer (SIMM-V2) or a Standard Slit Interdigital Micro Mixer (SSIMM) or Caterpillar (CPMM) or Impinging-jet (IJMM,) from the Institut für Mikrotechnik Mainz GmbH, Mainz Germany. In some embodiments, methods of making LNP using SHM further comprise mixing at least two input streams wherein mixing occurs by microstructure-induced chaotic advection (MICA). According to this method, fluid streams flow through channels present in a herringbone pattern causing rotational flow and folding the fluids around each other. This method can also comprise a surface for fluid mixing wherein the surface changes orientations during fluid cycling. Methods of generating LNPs using SHM include those disclosed in U.S. Pub. Nos. US20040262223 and US20120276209, each of which is incorporated herein by reference in their entirety. [00701] In some embodiments, the polynucleotides described herein can be formulated in lipid nanoparticles using microfluidic technology (see Whitesides, George M., "The Origins and the Future of Microfluidics," Nature 442: 368-373 (2006); and Abraham et al., "Chaotic Mixer for Microchannels," Science 295: 647- 651 (2002); each of which is herein incorporated by reference in its entirety). In some embodiments, the polynucleotides can be formulated in lipid nanoparticles using a micromixer chip such as, but not limited to, those from Harvard Apparatus (Holliston, MA) or Dolomite Microfluidics (Royston, UK). A micromixer chip can be used for rapid mixing of two or more fluid streams with a split and recombine mechanism. [00702] In some embodiments, the polynucleotides described herein can be formulated in lipid nanoparticles having a diameter from about 1 nm to about 100 nm Attorney Docket No.45817-0124WO1 / MTX959.20 such as, but not limited to, about 1 nm to about 20 nm, from about 1 nm to about 30 nm, from about 1 nm to about 40 nm, from about 1 nm to about 50 nm, from about 1 nm to about 60 nm, from about 1 nm to about 70 nm, from about 1 nm to about 80 nm, from about 1 nm to about 90 nm, from about 5 nm to about from 100 nm, from about 5 nm to about 10 nm, about 5 nm to about 20 nm, from about 5 nm to about 30 nm, from about 5 nm to about 40 nm, from about 5 nm to about 50 nm, from about 5 nm to about 60 nm, from about 5 nm to about 70 nm, from about 5 nm to about 80 nm, from about 5 nm to about 90 nm, about 10 to about 20 nm, about 10 to about 30 nm, about 10 to about 40 nm, about 10 to about 50 nm, about 10 to about 60 nm, about 10 to about 70 nm, about 10 to about 80 nm, about 10 to about 90 nm, about 20 to about 30 nm, about 20 to about 40 nm, about 20 to about 50 nm, about 20 to about 60 nm, about 20 to about 70 nm, about 20 to about 80 nm, about 20 to about 90 nm, about 20 to about 100 nm, about 30 to about 40 nm, about 30 to about 50 nm, about 30 to about 60 nm, about 30 to about 70 nm, about 30 to about 80 nm, about 30 to about 90 nm, about 30 to about 100 nm, about 40 to about 50 nm, about 40 to about 60 nm, about 40 to about 70 nm, about 40 to about 80 nm, about 40 to about 90 nm, about 40 to about 100 nm, about 50 to about 60 nm, about 50 to about 70 nm about 50 to about 80 nm, about 50 to about 90 nm, about 50 to about 100 nm, about 60 to about 70 nm, about 60 to about 80 nm, about 60 to about 90 nm, about 60 to about 100 nm, about 70 to about 80 nm, about 70 to about 90 nm, about 70 to about 100 nm, about 80 to about 90 nm, about 80 to about 100 nm and/or about 90 to about 100 nm. [00703] In some embodiments, the lipid nanoparticles can have a diameter from about 10 to 500 nm. In one embodiment, the lipid nanoparticle can have a diameter greater than 100 nm, greater than 150 nm, greater than 200 nm, greater than 250 nm, greater than 300 nm, greater than 350 nm, greater than 400 nm, greater than 450 nm, greater than 500 nm, greater than 550 nm, greater than 600 nm, greater than 650 nm, greater than 700 nm, greater than 750 nm, greater than 800 nm, greater than 850 nm, greater than 900 nm, greater than 950 nm or greater than 1000 nm. [00704] In some embodiments, the polynucleotides can be delivered using smaller LNPs. Such particles can comprise a diameter from below 0.1 µm up to 100 nm such as, but not limited to, less than 0.1 µm, less than 1.0 µm, less than 5µm, less than 10 µm, less than 15 um, less than 20 um, less than 25 um, less than 30 um, less than 35 Attorney Docket No.45817-0124WO1 / MTX959.20 um, less than 40 um, less than 50 um, less than 55 um, less than 60 um, less than 65 um, less than 70 um, less than 75 um, less than 80 um, less than 85 um, less than 90 um, less than 95 um, less than 100 um, less than 125 um, less than 150 um, less than 175 um, less than 200 um, less than 225 um, less than 250 um, less than 275 um, less than 300 um, less than 325 um, less than 350 um, less than 375 um, less than 400 um, less than 425 um, less than 450 um, less than 475 um, less than 500 um, less than 525 um, less than 550 um, less than 575 um, less than 600 um, less than 625 um, less than 650 um, less than 675 um, less than 700 um, less than 725 um, less than 750 um, less than 775 um, less than 800 um, less than 825 um, less than 850 um, less than 875 um, less than 900 um, less than 925 um, less than 950 um, or less than 975 um. [00705] The nanoparticles and microparticles described herein can be geometrically engineered to modulate macrophage and/or the immune response. The geometrically engineered particles can have varied shapes, sizes and/or surface charges to incorporate the polynucleotides described herein for targeted delivery such as, but not limited to, pulmonary delivery (see, e.g., Intl. Pub. No. WO2013082111, herein incorporated by reference in its entirety). Other physical features the geometrically engineering particles can include, but are not limited to, fenestrations, angled arms, asymmetry and surface roughness, charge that can alter the interactions with cells and tissues. [00706] In some embodiment, the nanoparticles described herein are stealth nanoparticles or target-specific stealth nanoparticles such as, but not limited to, those described in U.S. Pub. No. US20130172406, herein incorporated by reference in its entirety. The stealth or target-specific stealth nanoparticles can comprise a polymeric matrix, which can comprise two or more polymers such as, but not limited to, polyethylenes, polycarbonates, polyanhydrides, polyhydroxyacids, polypropylfumerates, polycaprolactones, polyamides, polyacetals, polyethers, polyesters, poly(orthoesters), polycyanoacrylates, polyvinyl alcohols, polyurethanes, polyphosphazenes, polyacrylates, polymethacrylates, polycyanoacrylates, polyureas, polystyrenes, polyamines, polyesters, polyanhydrides, polyethers, polyurethanes, polymethacrylates, polyacrylates, polycyanoacrylates, or combinations thereof. Attorney Docket No.45817-0124WO1 / MTX959.20 b. Lipidoids [00707] In some embodiments, the compositions or formulations of the present disclosure comprise a delivery agent, e.g., a lipidoid. The polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a Snu13 polypeptide) can be formulated with lipidoids. Complexes, micelles, liposomes or particles can be prepared containing these lipidoids and therefore to achieve an effective delivery of the polynucleotide, as judged by the production of an encoded protein, following the injection of a lipidoid formulation via localized and/or systemic routes of administration. Lipidoid complexes of polynucleotides can be administered by various means including, but not limited to, intravenous, intramuscular, or subcutaneous routes. [00708] The synthesis of lipidoids is described in literature (see Mahon et al., Bioconjug. Chem.201021:1448-1454; Schroeder et al., J Intern Med.2010267:9-21; Akinc et al., Nat Biotechnol.200826:561-569; Love et al., Proc Natl Acad Sci U S A. 2010107:1864-1869; Siegwart et al., Proc Natl Acad Sci U S A.2011108:12996- 3001; all of which are incorporated herein in their entireties). [00709] Formulations with the different lipidoids, including, but not limited to penta[3-(1-laurylaminopropionyl)]-triethylenetetramine hydrochloride (TETA-5LAP; also known as 98N12-5, see Murugaiah et al., Analytical Biochemistry, 401:61 (2010)), C12-200 (including derivatives and variants), and MD1, can be tested for in vivo activity. The lipidoid "98N12-5" is disclosed by Akinc et al., Mol Ther.2009 17:872-879. The lipidoid "C12-200" is disclosed by Love et al., Proc Natl Acad Sci U S A.2010107:1864-1869 and Liu and Huang, Molecular Therapy.2010669-670. Each of the references is herein incorporated by reference in its entirety. [00710] In one embodiment, the polynucleotides described herein can be formulated in an aminoalcohol lipidoid. Aminoalcohol lipidoids can be prepared by the methods described in U.S. Patent No.8,450,298 (herein incorporated by reference in its entirety). [00711] The lipidoid formulations can include particles comprising either 3 or 4 or more components in addition to polynucleotides. Lipidoids and polynucleotide formulations comprising lipidoids are described in Intl. Pub. No. WO 2015051214 (herein incorporated by reference in its entirety. Attorney Docket No.45817-0124WO1 / MTX959.20 c. Hyaluronidase [00712] In some embodiments, the polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a Snu13 polypeptide) and hyaluronidase for injection (e.g., intramuscular or subcutaneous injection). Hyaluronidase catalyzes the hydrolysis of hyaluronan, which is a constituent of the interstitial barrier. Hyaluronidase lowers the viscosity of hyaluronan, thereby increases tissue permeability (Frost, Expert Opin. Drug Deliv. (2007) 4:427-440). Alternatively, the hyaluronidase can be used to increase the number of cells exposed to the polynucleotides administered intramuscularly, or subcutaneously. d. Nanoparticle Mimics [00713] In some embodiments, the polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a Snu13 polypeptide) is encapsulated within and/or absorbed to a nanoparticle mimic. A nanoparticle mimic can mimic the delivery function organisms or particles such as, but not limited to, pathogens, viruses, bacteria, fungus, parasites, prions and cells. As a non-limiting example, the polynucleotides described herein can be encapsulated in a non-viron particle that can mimic the delivery function of a virus (see e.g., Intl. Pub. No. WO2012006376 and U.S. Pub. Nos. US20130171241 and US20130195968, each of which is herein incorporated by reference in its entirety). e. Self-Assembled Nanoparticles, or Self-Assembled Macromolecules [00714] In some embodiments, the compositions or formulations of the present disclosure comprise the polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a Snu13 polypeptide) in self-assembled nanoparticles, or amphiphilic macromolecules (AMs) for delivery. AMs comprise biocompatible amphiphilic polymers that have an alkylated sugar backbone covalently linked to poly(ethylene glycol). In aqueous solution, the AMs self- assemble to form micelles. Nucleic acid self-assembled nanoparticles are described in Intl. Appl. No. PCT/US2014/027077, and AMs and methods of forming AMs are described in U.S. Pub. No. US20130217753, each of which is herein incorporated by reference in its entirety. Attorney Docket No.45817-0124WO1 / MTX959.20 f. Cations and Anions [00715] In some embodiments, the compositions or formulations of the present disclosure comprise the polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a Snu13 polypeptide) and a cation or anion, such as Z n2+ , Ca 2+ , Cu 2+ , Mg 2+ and combinations thereof. Exemplary formulations can include polymers and a polynucleotide complexed with a metal cation as described in, e.g., U.S. Pat. Nos.6,265,389 and 6,555,525, each of which is herein incorporated by reference in its entirety. In some embodiments, cationic nanoparticles can contain a combination of divalent and monovalent cations. The delivery of polynucleotides in cationic nanoparticles or in one or more depot comprising cationic nanoparticles can improve polynucleotide bioavailability by acting as a long-acting depot and/or reducing the rate of degradation by nucleases. g. Amino Acid Lipids [00716] In some embodiments, the compositions or formulations of the present disclosure comprise the polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a Snu13 polypeptide) that is formulation with an amino acid lipid. Amino acid lipids are lipophilic compounds comprising an amino acid residue and one or more lipophilic tails. Non-limiting examples of amino acid lipids and methods of making amino acid lipids are described in U.S. Pat. No. 8,501,824. The amino acid lipid formulations can deliver a polynucleotide in releasable form that comprises an amino acid lipid that binds and releases the polynucleotides. As a non-limiting example, the release of the polynucleotides described herein can be provided by an acid-labile linker as described in, e.g., U.S. Pat. Nos.7,098,032, 6,897,196, 6,426,086, 7,138,382, 5,563,250, and 5,505,931, each of which is herein incorporated by reference in its entirety. h. Interpolyelectrolyte Complexes [00717] In some embodiments, the compositions or formulations of the present disclosure comprise the polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a Snu13 polypeptide) in an interpolyelectrolyte complex. Interpolyelectrolyte complexes are formed when charge-dynamic polymers are complexed with one or more anionic molecules. Non- limiting examples of charge-dynamic polymers and interpolyelectrolyte complexes Attorney Docket No.45817-0124WO1 / MTX959.20 and methods of making interpolyelectrolyte complexes are described in U.S. Pat. No. 8,524,368, herein incorporated by reference in its entirety. i. Crystalline Polymeric Systems [00718] In some embodiments, the compositions or formulations of the present disclosure comprise the polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a Snu13 polypeptide) in crystalline polymeric systems. Crystalline polymeric systems are polymers with crystalline moieties and/or terminal units comprising crystalline moieties. Exemplary polymers are described in U.S. Pat. No.8,524,259 (herein incorporated by reference in its entirety). j. Polymers, Biodegradable Nanoparticles, and Core-Shell Nanoparticles [00719] In some embodiments, the compositions or formulations of the present disclosure comprise the polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a Snu13 polypeptide) and a natural and/or synthetic polymer. The polymers include, but not limited to, polyethenes, polyethylene glycol (PEG), poly(l-lysine)(PLL), PEG grafted to PLL, cationic lipopolymer, biodegradable cationic lipopolymer, polyethyleneimine (PEI), cross- linked branched poly(alkylene imines), a polyamine derivative, a modified poloxamer, elastic biodegradable polymer, biodegradable copolymer, biodegradable polyester copolymer, biodegradable polyester copolymer, multiblock copolymers, poly[α-(4-aminobutyl)-L-glycolic acid) (PAGA), biodegradable cross-linked cationic multi-block copolymers, polycarbonates, polyanhydrides, polyhydroxyacids, polypropylfumerates, polycaprolactones, polyamides, polyacetals, polyethers, polyesters, poly(orthoesters), polycyanoacrylates, polyvinyl alcohols, polyurethanes, polyphosphazenes, polyureas, polystyrenes, polyamines, polylysine, poly(ethylene imine), poly(serine ester), poly(L-lactide-co-L-lysine), poly(4-hydroxy-L-proline ester), amine-containing polymers, dextran polymers, dextran polymer derivatives or combinations thereof. [00720] Exemplary polymers include, DYNAMIC POLYCONJUGATE® (Arrowhead Research Corp., Pasadena, CA) formulations from MIRUS® Bio (Madison, WI) and Roche Madison (Madison, WI), PHASERXTM polymer formulations such as, without limitation, SMARTT POLYMER TECHNOLOGY™ Attorney Docket No.45817-0124WO1 / MTX959.20 (PHASERX®, Seattle, WA), DMRI/DOPE, poloxamer, VAXFECTIN® adjuvant from Vical (San Diego, CA), chitosan, cyclodextrin from Calando Pharmaceuticals (Pasadena, CA), dendrimers and poly(lactic-co-glycolic acid) (PLGA) polymers. RONDELTM (RNAi/Oligonucleotide Nanoparticle Delivery) polymers (Arrowhead Research Corporation, Pasadena, CA) and pH responsive co-block polymers such as PHASERX® (Seattle, WA). [00721] The polymer formulations allow a sustained or delayed release of the polynucleotide (e.g., following intramuscular or subcutaneous injection). The altered release profile for the polynucleotide can result in, for example, translation of an encoded protein over an extended period of time. The polymer formulation can also be used to increase the stability of the polynucleotide. Sustained release formulations can include, but are not limited to, PLGA microspheres, ethylene vinyl acetate (EVAc), poloxamer, GELSITE® (Nanotherapeutics, Inc. Alachua, FL), HYLENEX® (Halozyme Therapeutics, San Diego CA), surgical sealants such as fibrinogen polymers (Ethicon Inc. Cornelia, GA), TISSELL® (Baxter International, Inc. Deerfield, IL), PEG-based sealants, and COSEAL® (Baxter International, Inc. Deerfield, IL). [00722] As a non-limiting example modified mRNA can be formulated in PLGA microspheres by preparing the PLGA microspheres with tunable release rates (e.g., days and weeks) and encapsulating the modified mRNA in the PLGA microspheres while maintaining the integrity of the modified mRNA during the encapsulation process. EVAc are non-biodegradable, biocompatible polymers that are used extensively in pre-clinical sustained release implant applications (e.g., extended release products Ocusert a pilocarpine ophthalmic insert for glaucoma or progestasert a sustained release progesterone intrauterine device; transdermal delivery systems Testoderm, Duragesic and Selegiline; catheters). Poloxamer F-407 NF is a hydrophilic, non-ionic surfactant triblock copolymer of polyoxyethylene- polyoxypropylene-polyoxyethylene having a low viscosity at temperatures less than 5ºC and forms a solid gel at temperatures greater than 15ºC. [00723] As a non-limiting example, the polynucleotides described herein can be formulated with the polymeric compound of PEG grafted with PLL as described in U.S. Pat. No.6,177,274. As another non-limiting example, the polynucleotides Attorney Docket No.45817-0124WO1 / MTX959.20 described herein can be formulated with a block copolymer such as a PLGA-PEG block copolymer (see e.g., U.S. Pub. No. US20120004293 and U.S. Pat. Nos. 8,236,330 and 8,246,968), or a PLGA-PEG-PLGA block copolymer (see e.g., U.S. Pat. No.6,004,573). Each of the references is herein incorporated by reference in its entirety. [00724] In some embodiments, the polynucleotides described herein can be formulated with at least one amine-containing polymer such as, but not limited to polylysine, polyethylene imine, poly(amidoamine) dendrimers, poly(amine-co-esters) or combinations thereof. Exemplary polyamine polymers and their use as delivery agents are described in, e.g., U.S. Pat. Nos.8,460,696, 8,236,280, each of which is herein incorporated by reference in its entirety. [00725] In some embodiments, the polynucleotides described herein can be formulated in a biodegradable cationic lipopolymer, a biodegradable polymer, or a biodegradable copolymer, a biodegradable polyester copolymer, a biodegradable polyester polymer, a linear biodegradable copolymer, PAGA, a biodegradable cross- linked cationic multi-block copolymer or combinations thereof as described in, e.g., U.S. Pat. Nos.6,696,038, 6,517,869, 6,267,987, 6,217,912, 6,652,886, 8,057,821, and 8,444,992; U.S. Pub. Nos. US20030073619, US20040142474, US20100004315, US2012009145 and US20130195920; and Intl Pub. Nos. WO2006063249 and WO2013086322, each of which is herein incorporated by reference in its entirety. [00726] In some embodiments, the polynucleotides described herein can be formulated in or with at least one cyclodextrin polymer as described in U.S. Pub. No. US20130184453. In some embodiments, the polynucleotides described herein can be formulated in or with at least one crosslinked cation-binding polymers as described in Intl. Pub. Nos. WO2013106072, WO2013106073 and WO2013106086. In some embodiments, the polynucleotides described herein can be formulated in or with at least PEGylated albumin polymer as described in U.S. Pub. No. US20130231287. Each of the references is herein incorporated by reference in its entirety. [00727] In some embodiments, the polynucleotides disclosed herein can be formulated as a nanoparticle using a combination of polymers, lipids, and/or other biodegradable agents, such as, but not limited to, calcium phosphate. Components can be combined in a core-shell, hybrid, and/or layer-by-layer architecture, to allow for Attorney Docket No.45817-0124WO1 / MTX959.20 fine-tuning of the nanoparticle for delivery (Wang et al., Nat Mater.20065:791-796; Fuller et al., Biomaterials.200829:1526-1532; DeKoker et al., Adv Drug Deliv Rev. 201163:748-761; Endres et al., Biomaterials.201132:7721-7731; Su et al., Mol Pharm.2011 Jun 6;8(3):774-87; herein incorporated by reference in their entireties). As a non-limiting example, the nanoparticle can comprise a plurality of polymers such as, but not limited to hydrophilic-hydrophobic polymers (e.g., PEG-PLGA), hydrophobic polymers (e.g., PEG) and/or hydrophilic polymers (Intl. Pub. No. WO20120225129, herein incorporated by reference in its entirety). [00728] The use of core-shell nanoparticles has additionally focused on a high- throughput approach to synthesize cationic cross-linked nanogel cores and various shells (Siegwart et al., Proc Natl Acad Sci U S A.2011108:12996-13001; herein incorporated by reference in its entirety). The complexation, delivery, and internalization of the polymeric nanoparticles can be precisely controlled by altering the chemical composition in both the core and shell components of the nanoparticle. For example, the core-shell nanoparticles can efficiently deliver siRNA to mouse hepatocytes after they covalently attach cholesterol to the nanoparticle. [00729] In some embodiments, a hollow lipid core comprising a middle PLGA layer and an outer neutral lipid layer containing PEG can be used to delivery of the polynucleotides as described herein. In some embodiments, the lipid nanoparticles can comprise a core of the polynucleotides disclosed herein and a polymer shell, which is used to protect the polynucleotides in the core. The polymer shell can be any of the polymers described herein and are known in the art. The polymer shell can be used to protect the polynucleotides in the core. [00730] Core–shell nanoparticles for use with the polynucleotides described herein are described in U.S. Pat. No.8,313,777 or Intl. Pub. No. WO2013124867, each of which is herein incorporated by reference in their entirety. k. Peptides and Proteins [00731] In some embodiments, the compositions or formulations of the present disclosure comprise the polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a Snu13 polypeptide) that is formulated with peptides and/or proteins to increase transfection of cells by the polynucleotide, and/or to alter the biodistribution of the polynucleotide (e.g., by targeting specific Attorney Docket No.45817-0124WO1 / MTX959.20 tissues or cell types), and/or increase the translation of encoded protein (e.g., Intl. Pub. Nos. WO2012110636 and WO2013123298. In some embodiments, the peptides can be those described in U.S. Pub. Nos. US20130129726, US20130137644 and US20130164219. Each of the references is herein incorporated by reference in its entirety. l. Conjugates [00732] In some embodiments, the compositions or formulations of the present disclosure comprise the polynucleotides described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a Snu13 polypeptide) that is covalently linked to a carrier or targeting group, or including two encoding regions that together produce a fusion protein (e.g., bearing a targeting group and therapeutic protein or peptide) as a conjugate. The conjugate can be a peptide that selectively directs the nanoparticle to neurons in a tissue or organism, or assists in crossing the blood-brain barrier. [00733] The conjugates include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), high-density lipoprotein (HDL), or globulin); an carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid); or a lipid. The ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid, an oligonucleotide (e.g., an aptamer). Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2- hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N- isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide. [00734] In some embodiments, the conjugate can function as a carrier for the polynucleotide disclosed herein. The conjugate can comprise a cationic polymer such Attorney Docket No.45817-0124WO1 / MTX959.20 as, but not limited to, polyamine, polylysine, polyalkylenimine, and polyethylenimine that can be grafted to with poly(ethylene glycol). Exemplary conjugates and their preparations are described in U.S. Pat. No.6,586,524 and U.S. Pub. No. US20130211249, each of which herein is incorporated by reference in its entirety. [00735] The conjugates can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N- acetyl-glucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, biotin, an RGD peptide, an RGD peptide mimetic or an aptamer. [00736] Targeting groups can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as an endothelial cell or bone cell. Targeting groups can also include hormones and hormone receptors. They can also include non- peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl- glucosamine multivalent mannose, multivalent frucose, or aptamers. The ligand can be, for example, a lipopolysaccharide, or an activator of p38 MAP kinase. [00737] The targeting group can be any ligand that is capable of targeting a specific receptor. Examples include, without limitation, folate, GalNAc, galactose, mannose, mannose-6P, aptamers, integrin receptor ligands, chemokine receptor ligands, transferrin, biotin, serotonin receptor ligands, PSMA, endothelin, GCPII, somatostatin, LDL, and HDL ligands. In particular embodiments, the targeting group is an aptamer. The aptamer can be unmodified or have any combination of modifications disclosed herein. As a non-limiting example, the targeting group can be a glutathione receptor (GR)-binding conjugate for targeted delivery across the blood- central nervous system barrier as described in, e.g., U.S. Pub. No. US2013021661012 (herein incorporated by reference in its entirety). Attorney Docket No.45817-0124WO1 / MTX959.20 [00738] In some embodiments, the conjugate can be a synergistic biomolecule- polymer conjugate, which comprises a long-acting continuous-release system to provide a greater therapeutic efficacy. The synergistic biomolecule-polymer conjugate can be those described in U.S. Pub. No. US20130195799. In some embodiments, the conjugate can be an aptamer conjugate as described in Intl. Pat. Pub. No. WO2012040524. In some embodiments, the conjugate can be an amine containing polymer conjugate as described in U.S. Pat. No.8,507,653. Each of the references is herein incorporated by reference in its entirety. In some embodiments, the polynucleotides can be conjugated to SMARTT POLYMER TECHNOLOGY® (PHASERX®, Inc. Seattle, WA). [00739] In some embodiments, the polynucleotides described herein are covalently conjugated to a cell penetrating polypeptide, which can also include a signal sequence or a targeting sequence. The conjugates can be designed to have increased stability, and/or increased cell transfection; and/or altered the biodistribution (e.g., targeted to specific tissues or cell types). [00740] In some embodiments, the polynucleotides described herein can be conjugated to an agent to enhance delivery. In some embodiments, the agent can be a monomer or polymer such as a targeting monomer or a polymer having targeting blocks as described in Intl. Pub. No. WO2011062965. In some embodiments, the agent can be a transport agent covalently coupled to a polynucleotide as described in, e.g., U.S. Pat. Nos.6,835.393 and 7,374,778. In some embodiments, the agent can be a membrane barrier transport enhancing agent such as those described in U.S. Pat. Nos.7,737,108 and 8,003,129. Each of the references is herein incorporated by reference in its entirety. 23. Methods of Use [00741] The Snu13 polynucleotides, pharmaceutical compositions and formulations described above are used in the preparation, manufacture and therapeutic use of compositions to express Snu13 and/or to regulate expression of a polypeptide. In some embodiments, the Snu13 polynucleotides, compositions and formulations of the present disclosure are used to regulate expression of a polypeptide (e.g., a target Attorney Docket No.45817-0124WO1 / MTX959.20 polypeptide), wherein the polypeptide is encoded by a polynucleotide comprising a Snu13-binding site (e.g., a sequence set forth in any one of SEQ ID NOs:500-521, e.g., SEQ ID NO:500) and an ORF encoding the polypeptide. In some instances, the Snu13 polynucleotides are used to preferentially regulate expression of a polypeptide encoded by a G5 polynucleotide (compared to an unmodified polynucleotide). [00742] Thus, provided herein is a method for regulating expression of a polypeptide in a subject (e.g., human), the method comprising administering to the subject: (i) a first polynucleotide comprising (a) a Snu13-binding site (e.g., a sequence set forth in any one of SEQ ID NOs:500-521, e.g., SEQ ID NO:500), and (b) an open reading frame encoding a first polypeptide; and (ii) a second polynucleotide comprising a nucleotide sequence encoding a second polypeptide, wherein the second polypeptide comprises a Snu13 polypeptide described herein. In some instances, binding of the second polypeptide to the Snu13-binding site represses translation of the first polypeptide from the first polynucleotide. In some instances, translation of the first polypeptide is reduced by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at lease 90%, at least 95%, or 100% (compared to translation of the first polypeptide in the absence of the second polynucleotide). [00743] Also provided herein is a method for regulating expression of a polypeptide, the method comprising contacting a cell with: (i) a first polynucleotide comprising (a) a Snu13-binding site (e.g., a sequence set forth in any one of SEQ ID NOs:500-521, e.g., SEQ ID NO:500), and (b) an open reading frame encoding a first polypeptide; and (ii) a second polynucleotide comprising a nucleotide sequence encoding a second polypeptide, wherein the second polypeptide comprises a Snu13 polypeptide described herein. In some instances, binding of the second polypeptide to the Snu13-binding site represses translation of the first polypeptide from the first polynucleotide. In some instances, translation of the first polypeptide is reduced by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at lease 90%, at least 95%, or 100% (compared to translation of the first polypeptide in the absence of the second polynucleotide). Attorney Docket No.45817-0124WO1 / MTX959.20 [00744] In some embodiments, the polynucleotides, pharmaceutical compositions and formulations of the invention are used in methods for increasing the level of Snu13 in a subject in need thereof. [00745] In some embodiments, the polynucleotides, pharmaceutical compositions and formulations of the invention are used in methods for increasing the level of a target polypeptide in a subject in thereof (e.g., by administering to the subject in need thereof a Snu13 polynucleotide described herein (or a composition or formulation comprising same) and a polynucleotide comprising a Snu13-binding site and an ORF encoding the target polypeptide). [00746] In some embodiments, the administration of a composition or formulation comprising polynucleotide encoding Snu13 of the present disclosure to a subject results in an increase in Snu13 protein in cells to a level at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or to 100% higher than the level observed prior to the administration of the composition or formulation. [00747] In some embodiments, the administration of a composition or formulation comprising polynucleotide encoding Snu13 of the present disclosure to a subject results in an increase in a target polypeptide in cells to a level at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or to 100% higher than the level observed prior to the administration of the composition or formulation. [00748] In some embodiments, the administration of the polynucleotide encoding Snu13, pharmaceutical composition or formulation of the present disclosure results in expression of Snu13 protein in cells of the subject. In some embodiments, administering the polynucleotide encoding Snu13, pharmaceutical composition or formulation of the present disclosure results in an increase of Snu13 protein activity in the subject. For example, in some embodiments, the polynucleotides of the present disclosure are used in methods of administering a composition or formulation comprising an mRNA encoding a Snu13 polypeptide to a subject, wherein the method results in an increase of Snu13 protein activity in at least some cells of a subject. Attorney Docket No.45817-0124WO1 / MTX959.20 [00749] In some embodiments, the administration of the polynucleotide encoding Snu13, pharmaceutical composition or formulation of the present disclosure results in expression of Snu13 protein and a target polypeptide in cells of the subject. In some embodiments, administering the polynucleotide encoding Snu13, pharmaceutical composition or formulation of the present disclosure results in an increase of Snu13 protein activity and of a target polypeptide in the subject. For example, in some embodiments, the polynucleotides of the present disclosure are used in methods of administering a composition or formulation comprising an mRNA encoding a Snu13 polypeptide to a subject, in combination with a polynucleotide comprising a Snu13- binding site (e.g., a sequence set forth in any one of SEQ ID NOs:500-521, e.g., SEQ ID NO:500) and an ORF encoding a target polypeptide, wherein the method results in an increase of Snu13 protein activity and an increase in the target polypeptide activity in at least some cells of a subject. [00750] In some embodiments, the administration of a composition or formulation comprising an mRNA encoding a Snu13 polypeptide to a subject results in an increase of Snu13 protein activity in cells subject to a level at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or to 100% or more of the activity level expected in a normal subject, e.g., a human not suffering from deficiency in Snu13 or defective Snu13. Snu13 activity can be evaluated using assays known in the art and as described herein. [00751] In another embodiment, the polynucleotides encoding Snu13, pharmaceutical compositions, or formulations of the present disclosure can be repeatedly administered such that Snu13 protein, respectively, is expressed at a therapeutic level for a period of time sufficient to have a beneficial biological effect as described herein (e.g., regulation of a target polypeptide encoded by a polynucleotide comprising a Snu13-binding site). [00752] In some embodiments, the method or use comprises administering a polynucleotide, e.g., mRNA, comprising a nucleotide sequence having sequence similarity (e.g., at least 65% identity) to a polynucleotide of any one of SEQ ID Attorney Docket No.45817-0124WO1 / MTX959.20 NOs:300-317, wherein the polynucleotide encodes a Snu13 polypeptide described herein (e.g., any one of SEQ ID NOs: 320-373). [00753] Other aspects of the present disclosure relate to transplantation of cells containing polynucleotides to a mammalian subject. Administration of cells to mammalian subjects is known to those of ordinary skill in the art, and includes, but is not limited to, local implantation (e.g., topical or subcutaneous administration), organ delivery or systemic injection (e.g., intravenous injection or inhalation), and the formulation of cells in pharmaceutically acceptable carriers. [00754] The present disclosure also provides methods to increase Snu13 activity in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a composition or formulation comprising mRNA encoding a Snu13 polypeptide disclosed herein. In some instances, the method further comprises administering to the subject in need thereof a therapeutically effective amount of a composition or formulation comprising an mRNA encoding a target polypeptide, wherein the mRNA encoding the target polypeptide comprises a Snu13-binding site (e.g., a sequence set forth in any one of SEQ ID NOs:500-521, e.g., SEQ ID NO:500). In some instances, the mRNA encoding the target polypeptide is G5 modified. In some instances, the subject in need thereof is in need of the target polypeptide (e.g., is deficient in the target polypeptide or has a defective target polypeptide). [00755] In some embodiments, the polynucleotides (e.g., mRNA), pharmaceutical compositions and formulations used in the methods of the invention comprise a uracil-modified sequence encoding a Snu13 polypeptide disclosed herein and a miRNA binding site disclosed herein, e.g., a miRNA binding site that binds to miR- 142 and/or a miRNA binding site that binds to miR-126. In some embodiments, the uracil-modified sequence encoding a Snu13 polypeptide comprises at least one chemically modified nucleobase, e.g., N1-methylpseudouracil or 5-methoxyuracil. In some embodiments, at least 95% of a type of nucleobase (e.g., uracil) in a uracil- modified sequence encoding a Snu13 polypeptide of the invention are modified nucleobases. In some embodiments, at least 95% of uracil in a uracil-modified sequence encoding a Snu13 polypeptide is 1-N-methylpseudouridine or 5- methoxyuridine. In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein is formulated with a delivery agent comprising, e.g., a Attorney Docket No.45817-0124WO1 / MTX959.20 compound having the Formula (I), e.g., Compound II or Compound B; or a compound having the Formula (III), (IV), (V), or (VI), e.g., Compound I or Compound VI, or any combination thereof. In some embodiments, the delivery agent comprises an ionizable amino lipid (e.g., Compound II, VI, or B), a helper lipid (e.g., DSPC), a sterol (e.g., Cholesterol), and a PEG lipid (e.g., Compound I or PEG-DMG), e.g., with a mole ratio in the range of about (i) 40-50 mol% ionizable amino lipid (e.g., Compound II, VI, or B), optionally 45-50 mol% ionizable amino lipid, for example, 45-46 mol%, 46-47 mol%, 47-48 mol%, 48-49 mol%, or 49-50 mol% for example about 45 mol%, 45.5 mol%, 46 mol%, 46.5 mol%, 47 mol%, 47.5 mol%, 48 mol%, 48.5 mol%, 49 mol%, or 49.5 mol%; (ii) 30-45 mol% sterol (e.g., cholesterol), optionally 35-42 mol% sterol, for example, 30-31 mol%, 31-32 mol%, 32-33 mol%, 33-34 mol%, 35-35 mol%, 35-36 mol%, 36-37 mol%, 37-38 mol%, 38-39 mol%, or 39-40 mol%, or 40-42 mol% sterol; (iii) 5-15 mol% helper lipid (e.g., DSPC), optionally 10-15 mol% helper lipid, for example, 5-6 mol%, 6-7 mol%, 7-8 mol%, 8- 9 mol%, 9-10 mol%, 10-11 mol%, 11-12 mol%, 12-13 mol%, 13-14 mol%, or 14-15 mol% helper lipid; and (iv) 1-5% PEG lipid (e.g., Compound I or PEG-DMG), optionally 1-5 mol% PEG lipid, for example 1.5 to 2.5 mol%, 1-2 mol%, 2-3 mol%, 3-4 mol%, or 4-5 mol% PEG lipid. In some embodiments, the delivery agent comprises Compound II, Cholesterol, DSPC, and Compound I. [00756] The skilled artisan will appreciate that the therapeutic effectiveness of a drug or a treatment of the instant invention can be characterized or determined by measuring the level of expression of an encoded protein in a sample or in samples taken from a subject (e.g., from a preclinical test subject (rodent, primate, etc.) or from a clinical subject (human)). Likewise, the therapeutic effectiveness of a drug or a treatment of the instant invention can be characterized or determined by measuring the level of activity of an encoded protein in a sample or in samples taken from a subject (e.g., from a preclinical test subject (rodent, primate, etc.) or from a clinical subject (human). Furthermore, the therapeutic effectiveness of a drug or a treatment of the instant invention can be characterized or determined by measuring the level of an appropriate biomarker in sample(s) taken from a subject. Levels of protein and/or biomarkers can be determined post-administration with a single dose of an mRNA therapeutic of the invention or can be determined and/or monitored at several time Attorney Docket No.45817-0124WO1 / MTX959.20 points following administration with a single dose or can be determined and/or monitored throughout a course of treatment, e.g., a multi-dose treatment. Protein Expression Levels [00757] Certain aspects of the invention feature measurement, determination and/or monitoring of the expression level or levels of protein (e.g., Snu13 or a target polypeptide) in a subject, for example, in an animal (e.g., rodents, primates, and the like) or in a human subject. Animals include normal, healthy or wildtype animals, as well as animal disease models. Snu13 protein or target polypeptide expression levels can be measured or determined by any art-recognized method for determining protein levels in biological samples, e.g., blood or bone marrow cells. The term "level" or "level of a protein" as used herein, preferably means the weight, mass or concentration of the protein within a sample or a subject. It will be understood by the skilled artisan that in certain embodiments the sample may be subjected, e.g., to any of the following: purification, precipitation, separation, e.g. centrifugation and/or HPLC, and subsequently subjected to determining the level of the protein, e.g., using mass and/or spectrometric analysis. In exemplary embodiments, enzyme-linked immunosorbent assay (ELISA) can be used to determine protein expression levels. In other exemplary embodiments, protein purification, separation and LC-MS can be used as a means for determining the level of a protein according to the invention. 24. Compositions and Formulations for Use [00758] Certain aspects of the invention are directed to compositions or formulations comprising any of the polynucleotides disclosed above. In some instances, the composition or formulation comprises a polynucleotide encoding a Snu13 polypeptide. In some instances, the composition or formulation comprises a first polynucleotide encoding a Snu13 polypeptide and a second polynucleotide comprising a Snu13-binding site (e.g., a sequence set forth in any one of SEQ ID NOs:500-521, e.g., SEQ ID NO:500) and an ORF encoding a second polypeptide. [00759] In some embodiments, the composition or formulation comprises: (i) a polynucleotide (e.g., a RNA, e.g., an mRNA) comprising a sequence- optimized nucleotide sequence (e.g., an ORF) encoding a Snu13 polypeptide, wherein Attorney Docket No.45817-0124WO1 / MTX959.20 the polynucleotide comprises at least one chemically modified nucleobase, e.g., N1-methylpseudouracil or 5-methoxyuracil (e.g., wherein at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or 100% of the uracils are N1-methylpseudouracils or 5-methoxyuracils), and wherein the polynucleotide further comprises a miRNA binding site, e.g., a miRNA binding site that binds to miR-142 (e.g., a miR-142-3p or miR-142-5p binding site) and/or a miRNA binding site that binds to miR-126 (e.g., a miR-126-3p or miR-126-5p binding site); and (ii) a delivery agent comprising a compound having the Formula (I), e.g., Compound II or Compound B; a compound having the Formula (III), (IV), (V), or (VI), e.g., Compound I or Compound VI, or any combination thereof. In some embodiments, the delivery agent is a lipid nanoparticle comprising Compound II, Compound VI, a salt or a stereoisomer thereof, or any combination thereof. In some embodiments, the delivery agent comprises an ionizable amino lipid (e.g., Compound II, VI, or B), a helper lipid (e.g., DSPC), a sterol (e.g., Cholesterol), and a PEG lipid (e.g., Compound I or PEG-DMG), e.g., with a mole ratio in the range of about (i) 40- 50 mol% ionizable amino lipid (e.g., Compound II, VI, or B), optionally 45-50 mol% ionizable amino lipid, for example, 45-46 mol%, 46-47 mol%, 47-48 mol%, 48-49 mol%, or 49-50 mol% for example about 45 mol%, 45.5 mol%, 46 mol%, 46.5 mol%, 47 mol%, 47.5 mol%, 48 mol%, 48.5 mol%, 49 mol%, or 49.5 mol%; (ii) 30- 45 mol% sterol (e.g., cholesterol), optionally 35-42 mol% sterol, for example, 30-31 mol%, 31-32 mol%, 32-33 mol%, 33-34 mol%, 35-35 mol%, 35-36 mol%, 36-37 mol%, 37-38 mol%, 38-39 mol%, or 39-40 mol%, or 40-42 mol% sterol; (iii) 5-15 mol% helper lipid (e.g., DSPC), optionally 10-15 mol% helper lipid, for example, 5-6 mol%, 6-7 mol%, 7-8 mol%, 8-9 mol%, 9-10 mol%, 10-11 mol%, 11-12 mol%, 12-13 mol%, 13-14 mol%, or 14-15 mol% helper lipid; and (iv) 1-5% PEG lipid (e.g., Compound I or PEG-DMG), optionally 1-5 mol% PEG lipid, for example 1.5 to 2.5 mol%, 1-2 mol%, 2-3 mol%, 3-4 mol%, or 4-5 mol% PEG lipid. In some embodiments, the delivery agent comprises Compound II, Cholesterol, DSPC, and Compound I. Attorney Docket No.45817-0124WO1 / MTX959.20 [00760] In some embodiments, the uracil or thymine content of the ORF relative to the theoretical minimum uracil or thymine content of a nucleotide sequence encoding the Snu13 polypeptide (%UTM or %TTM), is between about 100% and about 150%. [00761] In some embodiments, the polynucleotides, compositions or formulations above are used to express a Snu13 polypeptide in a subject. [00762] In some embodiments, the polynucleotides, compositions or formulations above are used to regulate expression of a polypeptide (e.g., a polypeptide encoded by a polynucleotide comprising a Snu13-binding site (e.g., a sequence set forth in any one of SEQ ID NOs:500-521, e.g., SEQ ID NO:500)). 25. Forms of Administration [00763] The polynucleotides, pharmaceutical compositions and formulations of the invention described above can be administered by any route that results in a therapeutically effective outcome, such as intravenous (into a vein) administration. These also include, but are not limited to enteral (into the intestine), gastroenteral, epidural (into the dura matter), oral (by way of the mouth), transdermal, peridural, intracerebral (into the cerebrum), intracerebroventricular (into the cerebral ventricles), epicutaneous (application onto the skin), intradermal, (into the skin itself), subcutaneous (under the skin), nasal administration (through the nose), intravenous bolus, intravenous drip, intraarterial (into an artery), intramuscular (into a muscle), intracardiac (into the heart), intraosseous infusion (into the bone marrow), intrathecal (into the spinal canal), intraperitoneal, (infusion or injection into the peritoneum), intravesical infusion, intravitreal, (through the eye), intracavernous injection (into a pathologic cavity) intracavitary (into the base of the penis), intravaginal administration, intrauterine, extra-amniotic administration, transdermal (diffusion through the intact skin for systemic distribution), transmucosal (diffusion through a mucous membrane), transvaginal, insufflation (snorting), sublingual, sublabial, enema, eye drops (onto the conjunctiva), in ear drops, auricular (in or by way of the ear), buccal (directed toward the cheek), conjunctival, cutaneous, dental (to a tooth or teeth), electro-osmosis, endocervical, endosinusial, endotracheal, extracorporeal, hemodialysis, infiltration, interstitial, intra-abdominal, intra-amniotic, intra-articular, Attorney Docket No.45817-0124WO1 / MTX959.20 intrabiliary, intrabronchial, intrabursal, intracartilaginous (within a cartilage), intracaudal (within the cauda equine), intracisternal (within the cisterna magna cerebellomedularis), intracorneal (within the cornea), dental intracornal, intracoronary (within the coronary arteries), intracorporus cavernosum (within the dilatable spaces of the corporus cavernosa of the penis), intradiscal (within a disc), intraductal (within a duct of a gland), intraduodenal (within the duodenum), intradural (within or beneath the dura), intraepidermal (to the epidermis), intraesophageal (to the esophagus), intragastric (within the stomach), intragingival (within the gingivae), intraileal (within the distal portion of the small intestine), intralesional (within or introduced directly to a localized lesion), intraluminal (within a lumen of a tube), intralymphatic (within the lymph), intramedullary (within the marrow cavity of a bone), intrameningeal (within the meninges), intraocular (within the eye), intraovarian (within the ovary), intrapericardial (within the pericardium), intrapleural (within the pleura), intraprostatic (within the prostate gland), intrapulmonary (within the lungs or its bronchi), intrasinal (within the nasal or periorbital sinuses), intraspinal (within the vertebral column), intrasynovial (within the synovial cavity of a joint), intratendinous (within a tendon), intratesticular (within the testicle), intrathecal (within the cerebrospinal fluid at any level of the cerebrospinal axis), intrathoracic (within the thorax), intratubular (within the tubules of an organ), intratympanic (within the aurus media), intravascular (within a vessel or vessels), intraventricular (within a ventricle), iontophoresis (by means of electric current where ions of soluble salts migrate into the tissues of the body), irrigation (to bathe or flush open wounds or body cavities), laryngeal (directly upon the larynx), nasogastric (through the nose and into the stomach), occlusive dressing technique (topical route administration that is then covered by a dressing that occludes the area), ophthalmic (to the external eye), oropharyngeal (directly to the mouth and pharynx), parenteral, percutaneous, periarticular, peridural, perineural, periodontal, rectal, respiratory (within the respiratory tract by inhaling orally or nasally for local or systemic effect), retrobulbar (behind the pons or behind the eyeball), intramyocardial (entering the myocardium), soft tissue, subarachnoid, subconjunctival, submucosal, topical, transplacental (through or across the placenta), transtracheal (through the wall of the trachea), transtympanic (across or through the tympanic cavity), ureteral (to the ureter), urethral Attorney Docket No.45817-0124WO1 / MTX959.20 (to the urethra), vaginal, caudal block, diagnostic, nerve block, biliary perfusion, cardiac perfusion, photopheresis or spinal. In specific embodiments, compositions can be administered in a way that allows them cross the blood-brain barrier, vascular barrier, or other epithelial barrier. In some embodiments, a formulation for a route of administration can include at least one inactive ingredient. 26. Definitions [00764] In order that the present disclosure can be more readily understood, certain terms are first defined. As used in this application, except as otherwise expressly provided herein, each of the following terms shall have the meaning set forth below. Additional definitions are set forth throughout the application. [00765] The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process. [00766] In this specification and the appended claims, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. The terms "a" (or "an"), as well as the terms "one or more," and "at least one" can be used interchangeably herein. In certain aspects, the term "a" or "an" means "single." In other aspects, the term "a" or "an" includes "two or more" or "multiple." [00767] Furthermore, "and/or" where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term "and/or" as used in a phrase such as "A and/or B" herein is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Likewise, the term "and/or" as used in a phrase such as "A, B, and/or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone). [00768] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure is related. For example, the Concise Dictionary of Biomedicine Attorney Docket No.45817-0124WO1 / MTX959.20 and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary Of Biochemistry And Molecular Biology, Revised, 2000, Oxford University Press, provide one of skill with a general dictionary of many of the terms used in this disclosure. [00769] Wherever aspects are described herein with the language "comprising," otherwise analogous aspects described in terms of "consisting of" and/or "consisting essentially of" are also provided. [00770] Units, prefixes, and symbols are denoted in their Système International de Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range. Where a range of values is recited, it is to be understood that each intervening integer value, and each fraction thereof, between the recited upper and lower limits of that range is also specifically disclosed, along with each subrange between such values. The upper and lower limits of any range can independently be included in or excluded from the range, and each range where either, neither or both limits are included is also encompassed within the invention. Where a value is explicitly recited, it is to be understood that values which are about the same quantity or amount as the recited value are also within the scope of the invention. Where a combination is disclosed, each subcombination of the elements of that combination is also specifically disclosed and is within the scope of the invention. Conversely, where different elements or groups of elements are individually disclosed, combinations thereof are also disclosed. Where any element of an invention is disclosed as having a plurality of alternatives, examples of that invention in which each alternative is excluded singly or in any combination with the other alternatives are also hereby disclosed; more than one element of an invention can have such exclusions, and all combinations of elements having such exclusions are hereby disclosed. [00771] Nucleotides are referred to by their commonly accepted single-letter codes. Unless otherwise indicated, nucleic acids are written left to right in 5′ to 3′ orientation. Nucleobases are referred to herein by their commonly known one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Accordingly, A represents adenine, C represents cytosine, G represents guanine, T represents thymine, U represents uracil. Attorney Docket No.45817-0124WO1 / MTX959.20 [00772] Amino acids are referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Unless otherwise indicated, amino acid sequences are written left to right in amino to carboxy orientation. [00773] About: The term "about" as used in connection with a numerical value throughout the specification and the claims denotes an interval of accuracy, familiar and acceptable to a person skilled in the art, such interval of accuracy is ± 10 %. [00774] Where ranges are given, endpoints are included. Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise. [00775] Administered in combination: As used herein, the term "administered in combination" or "combined administration" means that two or more agents are administered to a subject at the same time or within an interval such that there can be an overlap of an effect of each agent on the patient. In some embodiments, they are administered within about 60, 30, 15, 10, 5, or 1 minute of one another. In some embodiments, the administrations of the agents are spaced sufficiently closely together such that a combinatorial (e.g., a synergistic) effect is achieved. [00776] Amino acid substitution: The term "amino acid substitution" refers to replacing an amino acid residue present in a parent or reference sequence (e.g., a wild type Snu13 sequence) with another amino acid residue. An amino acid can be substituted in a parent or reference sequence (e.g., a wild type Snu13 sequence), for example, via chemical peptide synthesis or through recombinant methods known in the art. Accordingly, a reference to a "substitution at position X" refers to the substitution of an amino acid present at position X with an alternative amino acid residue. In some aspects, substitution patterns can be described according to the schema AnY, wherein A is the single letter code corresponding to the amino acid naturally or originally present at position n, and Y is the substituting amino acid residue. In other aspects, substitution patterns can be described according to the schema An(YZ), wherein A is the single letter code corresponding to the amino acid Attorney Docket No.45817-0124WO1 / MTX959.20 residue substituting the amino acid naturally or originally present at position X, and Y and Z are alternative substituting amino acid residue. [00777] In the context of the present disclosure, substitutions (even when they referred to as amino acid substitution) are conducted at the nucleic acid level, i.e., substituting an amino acid residue with an alternative amino acid residue is conducted by substituting the codon encoding the first amino acid with a codon encoding the second amino acid. [00778] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to humans at any stage of development. In some embodiments, "animal" refers to non-human animals at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and worms. In some embodiments, the animal is a transgenic animal, genetically-engineered animal, or a clone. [00779] Approximately: As used herein, the term "approximately," as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain embodiments, the term "approximately" refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value). [00780] Associated with: As used herein with respect to a disease, the term "associated with" means that the symptom, measurement, characteristic, or status in question is linked to the diagnosis, development, presence, or progression of that disease. As association can, but need not, be causatively linked to the disease. [00781] When used with respect to two or more moieties, the terms "associated with," "conjugated," "linked," "attached," and "tethered," when used with respect to two or more moieties, means that the moieties are physically associated or connected with one another, either directly or via one or more additional moieties that serves as a linking agent, to form a structure that is sufficiently stable so that the moieties remain physically associated under the conditions in which the structure is used, e.g., Attorney Docket No.45817-0124WO1 / MTX959.20 physiological conditions. An "association" need not be strictly through direct covalent chemical bonding. It can also suggest ionic or hydrogen bonding or a hybridization based connectivity sufficiently stable such that the "associated" entities remain physically associated. [00782] Biocompatible: As used herein, the term "biocompatible" means compatible with living cells, tissues, organs or systems posing little to no risk of injury, toxicity or rejection by the immune system. [00783] Biodegradable: As used herein, the term "biodegradable" means capable of being broken down into innocuous products by the action of living things. [00784] Biologically active: As used herein, the phrase "biologically active" refers to a characteristic of any substance that has activity in a biological system and/or organism. For instance, a substance that, when administered to an organism, has a biological effect on that organism, is considered to be biologically active. In particular embodiments, a polynucleotide of the present invention can be considered biologically active if even a portion of the polynucleotide is biologically active or mimics an activity considered biologically relevant. [00785] Chimera: As used herein, "chimera" is an entity having two or more incongruous or heterogeneous parts or regions. For example, a chimeric molecule can comprise a first part comprising a Snu13 polypeptide, and a second part (e.g., genetically fused to the first part) comprising a second therapeutic protein (e.g., a protein with a distinct enzymatic activity, an antigen binding moiety, or a moiety capable of extending the plasma half life of Snu13, for example, an Fc region of an antibody). [00786] Sequence Optimization: The term "sequence optimization" refers to a process or series of processes by which nucleobases in a reference nucleic acid sequence are replaced with alternative nucleobases, resulting in a nucleic acid sequence with improved properties, e.g., improved protein expression or decreased immunogenicity. [00787] In general, the goal in sequence optimization is to produce a synonymous nucleotide sequence than encodes the same polypeptide sequence encoded by the reference nucleotide sequence. Thus, there are no amino acid substitutions (as a result of codon optimization) in the polypeptide encoded by the codon optimized nucleotide Attorney Docket No.45817-0124WO1 / MTX959.20 sequence with respect to the polypeptide encoded by the reference nucleotide sequence. [00788] Codon substitution: The terms "codon substitution" or "codon replacement" in the context of sequence optimization refer to replacing a codon present in a reference nucleic acid sequence with another codon. A codon can be substituted in a reference nucleic acid sequence, for example, via chemical peptide synthesis or through recombinant methods known in the art. Accordingly, references to a "substitution" or "replacement" at a certain location in a nucleic acid sequence (e.g., an mRNA) or within a certain region or subsequence of a nucleic acid sequence (e.g., an mRNA) refer to the substitution of a codon at such location or region with an alternative codon. [00789] As used herein, the terms "coding region" and "region encoding" and grammatical variants thereof, refer to an Open Reading Frame (ORF) in a polynucleotide that upon expression yields a polypeptide or protein. [00790] Compound: As used herein, the term “compound,” is meant to include all stereoisomers and isotopes of the structure depicted. As used herein, the term “stereoisomer” means any geometric isomer (e.g., cis- and trans- isomer), enantiomer, or diastereomer of a compound. The present disclosure encompasses any and all stereoisomers of the compounds described herein, including stereomerically pure forms (e.g., geometrically pure, enantiomerically pure, or diastereomerically pure) and enantiomeric and stereoisomeric mixtures, e.g., racemates. Enantiomeric and stereomeric mixtures of compounds and means of resolving them into their component enantiomers or stereoisomers are well-known. “Isotopes” refers to atoms having the same atomic number but different mass numbers resulting from a different number of neutrons in the nuclei. For example, isotopes of hydrogen include tritium and deuterium. Further, a compound, salt, or complex of the present disclosure can be prepared in combination with solvent or water molecules to form solvates and hydrates by routine methods. [00791] Contacting: As used herein, the term “contacting” means establishing a physical connection between two or more entities. For example, contacting a mammalian cell with a nanoparticle composition means that the mammalian cell and a nanoparticle are made to share a physical connection. Methods of contacting cells Attorney Docket No.45817-0124WO1 / MTX959.20 with external entities both in vivo and ex vivo are well known in the biological arts. For example, contacting a nanoparticle composition and a mammalian cell disposed within a mammal can be performed by varied routes of administration (e.g., intravenous, intramuscular, intradermal, and subcutaneous) and can involve varied amounts of nanoparticle compositions. Moreover, more than one mammalian cell can be contacted by a nanoparticle composition. [00792] Conservative amino acid substitution: A "conservative amino acid substitution" is one in which the amino acid residue in a protein sequence is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, or histidine), acidic side chains (e.g., aspartic acid or glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, or cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, or tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, or histidine). Thus, if an amino acid in a polypeptide is replaced with another amino acid from the same side chain family, the amino acid substitution is considered to be conservative. In another aspect, a string of amino acids can be conservatively replaced with a structurally similar string that differs in order and/or composition of side chain family members. [00793] Non-conservative amino acid substitution: Non-conservative amino acid substitutions include those in which (i) a residue having an electropositive side chain (e.g., Arg, His or Lys) is substituted for, or by, an electronegative residue (e.g., Glu or Asp), (ii) a hydrophilic residue (e.g., Ser or Thr) is substituted for, or by, a hydrophobic residue (e.g., Ala, Leu, Ile, Phe or Val), (iii) a cysteine or proline is substituted for, or by, any other residue, or (iv) a residue having a bulky hydrophobic or aromatic side chain (e.g., Val, His, Ile or Trp) is substituted for, or by, one having a smaller side chain (e.g., Ala or Ser) or no side chain (e.g., Gly). [00794] Other amino acid substitutions can be readily identified by workers of ordinary skill. For example, for the amino acid alanine, a substitution can be taken from any one of D-alanine, glycine, beta-alanine, L-cysteine and D-cysteine. For lysine, a replacement can be any one of D-lysine, arginine, D-arginine, homo- Attorney Docket No.45817-0124WO1 / MTX959.20 arginine, methionine, D-methionine, ornithine, or D- ornithine. Generally, substitutions in functionally important regions that can be expected to induce changes in the properties of isolated polypeptides are those in which (i) a polar residue, e.g., serine or threonine, is substituted for (or by) a hydrophobic residue, e.g., leucine, isoleucine, phenylalanine, or alanine; (ii) a cysteine residue is substituted for (or by) any other residue; (iii) a residue having an electropositive side chain, e.g., lysine, arginine or histidine, is substituted for (or by) a residue having an electronegative side chain, e.g., glutamic acid or aspartic acid; or (iv) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) one not having such a side chain, e.g., glycine. The likelihood that one of the foregoing non-conservative substitutions can alter functional properties of the protein is also correlated to the position of the substitution with respect to functionally important regions of the protein: some non- conservative substitutions can accordingly have little or no effect on biological properties. [00795] Conserved: As used herein, the term "conserved" refers to nucleotides or amino acid residues of a polynucleotide sequence or polypeptide sequence, respectively, that are those that occur unaltered in the same position of two or more sequences being compared. Nucleotides or amino acids that are relatively conserved are those that are conserved amongst more related sequences than nucleotides or amino acids appearing elsewhere in the sequences. [00796] In some embodiments, two or more sequences are said to be "completely conserved" if they are 100% identical to one another. In some embodiments, two or more sequences are said to be "highly conserved" if they are at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another. In some embodiments, two or more sequences are said to be "highly conserved" if they are about 70% identical, about 80% identical, about 90% identical, about 95%, about 98%, or about 99% identical to one another. In some embodiments, two or more sequences are said to be "conserved" if they are at least 30% identical, at least 40% identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another. In some embodiments, two or more sequences are said to be "conserved" if they are about 30% identical, about 40% identical, about 50% identical, about 60% identical, about Attorney Docket No.45817-0124WO1 / MTX959.20 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to one another. Conservation of sequence can apply to the entire length of an polynucleotide or polypeptide or can apply to a portion, region or feature thereof. [00797] Controlled Release: As used herein, the term "controlled release" refers to a pharmaceutical composition or compound release profile that conforms to a particular pattern of release to effect a therapeutic outcome. [00798] Cyclic or Cyclized: As used herein, the term "cyclic" refers to the presence of a continuous loop. Cyclic molecules need not be circular, only joined to form an unbroken chain of subunits. Cyclic molecules such as the engineered RNA or mRNA of the present invention can be single units or multimers or comprise one or more components of a complex or higher order structure. [00799] Delivering: As used herein, the term “delivering” means providing an entity to a destination. For example, delivering a polynucleotide to a subject can involve administering a nanoparticle composition including the polynucleotide to the subject (e.g., by an intravenous, intramuscular, intradermal, or subcutaneous route). Administration of a nanoparticle composition to a mammal or mammalian cell can involve contacting one or more cells with the nanoparticle composition. [00800] Delivery Agent: As used herein, "delivery agent" refers to any substance that facilitates, at least in part, the in vivo, in vitro, or ex vivo delivery of a polynucleotide to targeted cells. [00801] Domain: As used herein, when referring to polypeptides, the term "domain" refers to a motif of a polypeptide having one or more identifiable structural or functional characteristics or properties (e.g., binding capacity, serving as a site for protein-protein interactions). [00802] Dosing regimen: As used herein, a "dosing regimen" or a "dosing regimen" is a schedule of administration or physician determined regimen of treatment, prophylaxis, or palliative care. [00803] Effective Amount: As used herein, the term "effective amount" of an agent is that amount sufficient to effect beneficial or desired results, for example, clinical results, and, as such, an "effective amount" depends upon the context in which it is being applied. For example, in the context of administering an agent that treats a Attorney Docket No.45817-0124WO1 / MTX959.20 protein deficiency, an effective amount of an agent is, for example, an amount of mRNA expressing sufficient protein, respectively, to ameliorate, reduce, eliminate, or prevent the symptoms associated with the protein deficiency, respectively, as compared to the severity of the symptom observed without administration of the agent. The term "effective amount" can be used interchangeably with "effective dose," "therapeutically effective amount," or "therapeutically effective dose." [00804] Encapsulate: As used herein, the term "encapsulate" means to enclose, surround or encase. [00805] Encapsulation Efficiency: As used herein, “encapsulation efficiency” refers to the amount of a polynucleotide that becomes part of a nanoparticle composition, relative to the initial total amount of polynucleotide used in the preparation of a nanoparticle composition. For example, if 97 mg of polynucleotide are encapsulated in a nanoparticle composition out of a total 100 mg of polynucleotide initially provided to the composition, the encapsulation efficiency can be given as 97%. As used herein, “encapsulation” can refer to complete, substantial, or partial enclosure, confinement, surrounding, or encasement. [00806] Enhanced Delivery: As used herein, the term “enhanced delivery” means delivery of more (e.g., at least 1.5 fold more, at least 2-fold more, at least 3-fold more, at least 4-fold more, at least 5-fold more, at least 6-fold more, at least 7-fold more, at least 8-fold more, at least 9-fold more, at least 10-fold more) of a polynucleotide by a nanoparticle to a target tissue of interest (e.g., mammalian liver) compared to the level of delivery of a polynucleotide by a control nanoparticle to a target tissue of interest (e.g., MC3, KC2, or DLinDMA). The level of delivery of a nanoparticle to a particular tissue can be measured by comparing the amount of protein produced in a tissue to the weight of said tissue, comparing the amount of polynucleotide in a tissue to the weight of said tissue, comparing the amount of protein produced in a tissue to the amount of total protein in said tissue, or comparing the amount of polynucleotide in a tissue to the amount of total polynucleotide in said tissue. It will be understood that the enhanced delivery of a nanoparticle to a target tissue need not be determined in a subject being treated, it can be determined in a surrogate such as an animal model (e.g., a rat model). Attorney Docket No.45817-0124WO1 / MTX959.20 [00807] Expression: As used herein, "expression" of a nucleic acid sequence refers to one or more of the following events: (1) production of an mRNA template from a DNA sequence (e.g., by transcription); (2) processing of an mRNA transcript (e.g., by splicing, editing, 5′ cap formation, and/or 3′ end processing); (3) translation of an mRNA into a polypeptide or protein; and (4) post-translational modification of a polypeptide or protein. [00808] Formulation: As used herein, a "formulation" includes at least a polynucleotide and one or more of a carrier, an excipient, and a delivery agent. [00809] Fragment: A "fragment," as used herein, refers to a portion. For example, fragments of proteins can comprise polypeptides obtained by digesting full-length protein isolated from cultured cells. In some embodiments, a fragment is a subsequences of a full length protein (e.g., Snu13) wherein N-terminal, and/or C- terminal, and/or internal subsequences have been deleted. In some preferred aspects of the present invention, the fragments of a protein of the present invention are functional fragments. [00810] Functional: As used herein, a "functional" biological molecule is a biological molecule in a form in which it exhibits a property and/or activity by which it is characterized. Thus, a functional fragment of a polynucleotide of the present invention is a polynucleotide capable of expressing a functional Snu13 fragment. As used herein, a functional fragment of Snu13 refers to a fragment of wild type Snu13 (i.e., a fragment of any of its naturally occurring isoforms), or a mutant or variant thereof, wherein the fragment retains a least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% of the biological activity of the corresponding full length protein. [00811] Helper Lipid: As used herein, the term “helper lipid” refers to a compound or molecule that includes a lipidic moiety (for insertion into a lipid layer, e.g., lipid bilayer) and a polar moiety (for interaction with physiologic solution at the surface of the lipid layer). Typically the helper lipid is a phospholipid. A function of the helper lipid is to “complement” the amino lipid and increase the fusogenicity of the bilayer Attorney Docket No.45817-0124WO1 / MTX959.20 and/or to help facilitate endosomal escape, e.g., of nucleic acid delivered to cells. Helper lipids are also believed to be a key structural component to the surface of the LNP. [00812] Homology: As used herein, the term "homology" refers to the overall relatedness between polymeric molecules, e.g. between nucleic acid molecules (e.g. DNA molecules and/or RNA molecules) and/or between polypeptide molecules. Generally, the term "homology" implies an evolutionary relationship between two molecules. Thus, two molecules that are homologous will have a common evolutionary ancestor. In the context of the present invention, the term homology encompasses both to identity and similarity. [00813] In some embodiments, polymeric molecules are considered to be "homologous" to one another if at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of the monomers in the molecule are identical (exactly the same monomer) or are similar (conservative substitutions). The term "homologous" necessarily refers to a comparison between at least two sequences (polynucleotide or polypeptide sequences). [00814] Identity: As used herein, the term "identity" refers to the overall monomer conservation between polymeric molecules, e.g., between polynucleotide molecules (e.g. DNA molecules and/or RNA molecules) and/or between polypeptide molecules. Calculation of the percent identity of two polynucleotide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second nucleic acid sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence. The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. Attorney Docket No.45817-0124WO1 / MTX959.20 The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. When comparing DNA and RNA, thymine (T) and uracil (U) can be considered equivalent. [00815] Suitable software programs are available from various sources, and for alignment of both protein and nucleotide sequences. One suitable program to determine percent sequence identity is bl2seq, part of the BLAST suite of program available from the U.S. government's National Center for Biotechnology Information BLAST web site (blast.ncbi.nlm.nih.gov). Bl2seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. Other suitable programs are, e.g., Needle, Stretcher, Water, or Matcher, part of the EMBOSS suite of bioinformatics programs and also available from the European Bioinformatics Institute (EBI) at www.ebi.ac.uk/Tools/psa. [00816] Sequence alignments can be conducted using methods known in the art such as MAFFT, Clustal (ClustalW, Clustal X or Clustal Omega), MUSCLE, etc. [00817] Different regions within a single polynucleotide or polypeptide target sequence that aligns with a polynucleotide or polypeptide reference sequence can each have their own percent sequence identity. It is noted that the percent sequence identity value is rounded to the nearest tenth. For example, 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. It also is noted that the length value will always be an integer. [00818] In certain aspects, the percentage identity "%ID" of a first amino acid sequence (or nucleic acid sequence) to a second amino acid sequence (or nucleic acid sequence) is calculated as %ID = 100 x (Y/Z), where Y is the number of amino acid residues (or nucleobases) scored as identical matches in the alignment of the first and second sequences (as aligned by visual inspection or a particular sequence alignment program) and Z is the total number of residues in the second sequence. If the length of a first sequence is longer than the second sequence, the percent identity of the first sequence to the second sequence will be higher than the percent identity of the second sequence to the first sequence. [00819] One skilled in the art will appreciate that the generation of a sequence alignment for the calculation of a percent sequence identity is not limited to binary Attorney Docket No.45817-0124WO1 / MTX959.20 sequence-sequence comparisons exclusively driven by primary sequence data. It will also be appreciated that sequence alignments can be generated by integrating sequence data with data from heterogeneous sources such as structural data (e.g., crystallographic protein structures), functional data (e.g., location of mutations), or phylogenetic data. A suitable program that integrates heterogeneous data to generate a multiple sequence alignment is T-Coffee, available at www.tcoffee.org, and alternatively available, e.g., from the EBI. It will also be appreciated that the final alignment used to calculate percent sequence identity can be curated either automatically or manually. [00820] Insertional and deletional variants: "Insertional variants" when referring to polypeptides are those with one or more amino acids inserted immediately adjacent to an amino acid at a particular position in a native or starting sequence. "Immediately adjacent" to an amino acid means connected to either the alpha-carboxy or alpha- amino functional group of the amino acid. "Deletional variants" when referring to polypeptides are those with one or more amino acids in the native or starting amino acid sequence removed. Ordinarily, deletional variants will have one or more amino acids deleted in a particular region of the molecule. [00821] Intact: As used herein, in the context of a polypeptide, the term "intact" means retaining an amino acid corresponding to the wild type protein, e.g., not mutating or substituting the wild type amino acid. Conversely, in the context of a nucleic acid, the term "intact" means retaining a nucleobase corresponding to the wild type nucleic acid, e.g., not mutating or substituting the wild type nucleobase. [00822] Ionizable amino lipid: The term “ionizable amino lipid” includes those lipids having one, two, three, or more fatty acid or fatty alkyl chains and a pH- titratable amino head group (e.g., an alkylamino or dialkylamino head group). An ionizable amino lipid is typically protonated (i.e., positively charged) at a pH below the pKa of the amino head group and is substantially not charged at a pH above the pKa. Such ionizable amino lipids include, but are not limited to DLin-MC3-DMA (MC3), (13Z,165Z)-N,N-dimethyl-3-nonydocosa-13-16-dien-1-amine (L608), and a compound of any one of Formula I, II, and II described herein (e.g., any one of Compound II, Compound VI, and Compound B). Attorney Docket No.45817-0124WO1 / MTX959.20 [00823] Linker: As used herein, a "linker" refers to a group of atoms, e.g., 10-1,000 atoms, and can be comprised of the atoms or groups such as, but not limited to, carbon, amino, alkylamino, oxygen, sulfur, sulfoxide, sulfonyl, carbonyl, and imine. The linker can be attached to a modified nucleoside or nucleotide on the nucleobase or sugar moiety at a first end, and to a payload, e.g., a detectable or therapeutic agent, at a second end. The linker can be of sufficient length as to not interfere with incorporation into a nucleic acid sequence. The linker can be used for any useful purpose, such as to form polynucleotide multimers (e.g., through linkage of two or more chimeric polynucleotides molecules or IVT polynucleotides) or polynucleotides conjugates, as well as to administer a payload, as described herein. Examples of chemical groups that can be incorporated into the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amido, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted, as described herein. Examples of linkers include, but are not limited to, unsaturated alkanes, polyethylene glycols (e.g., ethylene or propylene glycol monomeric units, e.g., diethylene glycol, dipropylene glycol, triethylene glycol, tripropylene glycol, tetraethylene glycol, or tetraethylene glycol), and dextran polymers and derivatives thereof., Other examples include, but are not limited to, cleavable moieties within the linker, such as, for example, a disulfide bond (-S-S-) or an azo bond (-N=N-), which can be cleaved using a reducing agent or photolysis. Non-limiting examples of a selectively cleavable bond include an amido bond can be cleaved for example by the use of tris(2-carboxyethyl)phosphine (TCEP), or other reducing agents, and/or photolysis, as well as an ester bond can be cleaved for example by acidic or basic hydrolysis. [00824] Methods of Administration: As used herein, “methods of administration” can include intravenous, intramuscular, intradermal, subcutaneous, or other methods of delivering a composition to a subject. A method of administration can be selected to target delivery (e.g., to specifically deliver) to a specific region or system of a body. [00825] Modified: As used herein "modified" refers to a changed state or structure of a molecule of the invention. Molecules can be modified in many ways including chemically, structurally, and functionally. In some embodiments, the mRNA Attorney Docket No.45817-0124WO1 / MTX959.20 molecules of the present invention are modified by the introduction of non-natural nucleosides and/or nucleotides, e.g., as it relates to the natural ribonucleotides A, U, G, and C. Noncanonical nucleotides such as the cap structures are not considered "modified" although they differ from the chemical structure of the A, C, G, U ribonucleotides. [00826] Nanoparticle Composition: As used herein, a “nanoparticle composition” is a composition comprising one or more lipids. Nanoparticle compositions are typically sized on the order of micrometers or smaller and can include a lipid bilayer. Nanoparticle compositions encompass lipid nanoparticles (LNPs), liposomes (e.g., lipid vesicles), and lipoplexes. For example, a nanoparticle composition can be a liposome having a lipid bilayer with a diameter of 500 nm or less. [00827] Naturally occurring: As used herein, "naturally occurring" means existing in nature without artificial aid. [00828] Nucleic acid sequence: The terms "nucleic acid sequence," "nucleotide sequence," or "polynucleotide sequence" are used interchangeably and refer to a contiguous nucleic acid sequence. The sequence can be either single stranded or double stranded DNA or RNA, e.g., an mRNA. [00829] The term "nucleic acid," in its broadest sense, includes any compound and/or substance that comprises a polymer of nucleotides. These polymers are often referred to as polynucleotides. Exemplary nucleic acids or polynucleotides of the invention include, but are not limited to, ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a β- D-ribo configuration, α-LNA having an α-L-ribo configuration (a diastereomer of LNA), 2′- amino-LNA having a 2′-amino functionalization, and 2′-amino- α-LNA having a 2′- amino functionalization), ethylene nucleic acids (ENA), cyclohexenyl nucleic acids (CeNA) or hybrids or combinations thereof. [00830] The phrase "nucleotide sequence encoding" refers to the nucleic acid (e.g., an mRNA or DNA molecule) coding sequence which encodes a polypeptide. The coding sequence can further include initiation and termination signals operably linked to regulatory elements including a promoter and polyadenylation signal capable of directing expression in the cells of an individual or mammal to which the nucleic acid Attorney Docket No.45817-0124WO1 / MTX959.20 is administered. The coding sequence can further include sequences that encode signal peptides. [00831] Operably linked: As used herein, the phrase "operably linked" refers to a functional connection between two or more molecules, constructs, transcripts, entities, moieties or the like. [00832] Optionally substituted: Herein a phrase of the form "optionally substituted X" (e.g., optionally substituted alkyl) is intended to be equivalent to "X, wherein X is optionally substituted" (e.g., "alkyl, wherein said alkyl is optionally substituted"). It is not intended to mean that the feature "X" (e.g., alkyl) per se is optional. [00833] Part: As used herein, a "part" or "region" of a polynucleotide is defined as any portion of the polynucleotide that is less than the entire length of the polynucleotide. [00834] Patient: As used herein, "patient" refers to a subject who can seek or be in need of treatment, requires treatment, is receiving treatment, will receive treatment, or a subject who is under care by a trained professional for a particular disease or condition. In some embodiments, the treatment is needed, required, or received to prevent or decrease the risk of developing acute disease, i.e., it is a prophylactic treatment. [00835] Pharmaceutically acceptable: The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and/or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio. [00836] Pharmaceutically acceptable excipients: The phrase "pharmaceutically acceptable excipient," as used herein, refers any ingredient other than the compounds described herein (for example, a vehicle capable of suspending or dissolving the active compound) and having the properties of being substantially nontoxic and non- inflammatory in a patient. Excipients can include, for example: antiadherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, fragrances, glidants (flow enhancers), lubricants, preservatives, printing inks, sorbents, Attorney Docket No.45817-0124WO1 / MTX959.20 suspension or dispersing agents, sweeteners, and waters of hydration. Exemplary excipients include, but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, crosslinked polyvinyl pyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methyl paraben, microcrystalline cellulose, polyethylene glycol, polyvinyl pyrrolidone, povidone, pregelatinized starch, propyl paraben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol. [00837] Pharmaceutically acceptable salts: The present disclosure also includes pharmaceutically acceptable salts of the compounds described herein. As used herein, "pharmaceutically acceptable salts" refers to derivatives of the disclosed compounds wherein the parent compound is modified by converting an existing acid or base moiety to its salt form (e.g., by reacting the free base group with a suitable organic acid). Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. Representative acid addition salts include acetate, acetic acid, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzene sulfonic acid, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2- hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, Attorney Docket No.45817-0124WO1 / MTX959.20 tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. The pharmaceutically acceptable salts of the present disclosure include the conventional non-toxic salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. The pharmaceutically acceptable salts of the present disclosure can be synthesized from the parent compound that contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are used. Lists of suitable salts are found in Remington's Pharmaceutical Sciences, 17 th ed., Mack Publishing Company, Easton, Pa., 1985, p.1418, Pharmaceutical Salts: Properties, Selection, and Use, P.H. Stahl and C.G. Wermuth (eds.), Wiley-VCH, 2008, and Berge et al., Journal of Pharmaceutical Science, 66, 1-19 (1977), each of which is incorporated herein by reference in its entirety. [00838] Pharmaceutically acceptable solvate: The term "pharmaceutically acceptable solvate," as used herein, means a compound of the invention wherein molecules of a suitable solvent are incorporated in the crystal lattice. A suitable solvent is physiologically tolerable at the dosage administered. For example, solvates can be prepared by crystallization, recrystallization, or precipitation from a solution that includes organic solvents, water, or a mixture thereof. Examples of suitable solvents are ethanol, water (for example, mono-, di-, and tri-hydrates), N- methylpyrrolidinone (NMP), dimethyl sulfoxide (DMSO), N,N'-dimethylformamide (DMF), N,N'-dimethylacetamide (DMAC), 1,3-dimethyl-2-imidazolidinone (DMEU), 1,3-dimethyl-3,4,5,6-tetrahydro-2-(1H)-pyrimidinone (DMPU), acetonitrile (ACN), propylene glycol, ethyl acetate, benzyl alcohol, 2-pyrrolidone, benzyl benzoate, and the like. When water is the solvent, the solvate is referred to as a "hydrate." [00839] Pharmacokinetic: As used herein, "pharmacokinetic" refers to any one or more properties of a molecule or compound as it relates to the determination of the fate of substances administered to a living organism. Pharmacokinetics is divided into several areas including the extent and rate of absorption, distribution, metabolism and excretion. This is commonly referred to as ADME where: (A) Absorption is the Attorney Docket No.45817-0124WO1 / MTX959.20 process of a substance entering the blood circulation; (D) Distribution is the dispersion or dissemination of substances throughout the fluids and tissues of the body; (M) Metabolism (or Biotransformation) is the irreversible transformation of parent compounds into daughter metabolites; and (E) Excretion (or Elimination) refers to the elimination of the substances from the body. In rare cases, some drugs irreversibly accumulate in body tissue. [00840] Polynucleotide: The term "polynucleotide" as used herein refers to polymers of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof. This term refers to the primary structure of the molecule. Thus, the term includes triple-, double- and single- stranded deoxyribonucleic acid ("DNA"), as well as triple-, double- and single- stranded ribonucleic acid ("RNA"). It also includes modified, for example by alkylation, and/or by capping, and unmodified forms of the polynucleotide. More particularly, the term "polynucleotide" includes polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), including tRNA, rRNA, hRNA, siRNA and mRNA, whether spliced or unspliced, any other type of polynucleotide which is an N- or C-glycoside of a purine or pyrimidine base, and other polymers containing normucleotidic backbones, for example, polyamide (e.g., peptide nucleic acids "PNAs") and polymorpholino polymers, and other synthetic sequence-specific nucleic acid polymers providing that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in DNA and RNA. In particular aspects, the polynucleotide comprises an mRNA. In other aspect, the mRNA is a synthetic mRNA. In some aspects, the synthetic mRNA comprises at least one unnatural nucleobase. In some aspects, all nucleobases of a certain class have been replaced with unnatural nucleobases (e.g., all uridines in a polynucleotide disclosed herein can be replaced with an unnatural nucleobase, e.g., 5-methoxyuridine). In some aspects, the polynucleotide (e.g., a synthetic RNA or a synthetic DNA) comprises only natural nucleobases, i.e., A (adenosine), G (guanosine), C (cytidine), and T (thymidine) in the case of a synthetic DNA, or A, C, G, and U (uridine) in the case of a synthetic RNA. [00841] The skilled artisan will appreciate that the T bases in the codon maps disclosed herein are present in DNA, whereas the T bases would be replaced by U Attorney Docket No.45817-0124WO1 / MTX959.20 bases in corresponding RNAs. For example, a codon-nucleotide sequence disclosed herein in DNA form, e.g., a vector or an in-vitro translation (IVT) template, would have its T bases transcribed as U based in its corresponding transcribed mRNA. In this respect, both codon-optimized DNA sequences (comprising T) and their corresponding mRNA sequences (comprising U) are considered codon-optimized nucleotide sequence of the present invention. A skilled artisan would also understand that equivalent codon-maps can be generated by replaced one or more bases with non- natural bases. Thus, e.g., a TTC codon (DNA map) would correspond to a UUC codon (RNA map), which in turn would correspond to a ΨΨC codon (RNA map in which U has been replaced with pseudouridine). [00842] Standard A-T and G-C base pairs form under conditions which allow the formation of hydrogen bonds between the N3-H and C4-oxy of thymidine and the N1 and C6-NH2, respectively, of adenosine and between the C2-oxy, N3 and C4-NH2, of cytidine and the C2-NH2, N′—H and C6-oxy, respectively, of guanosine. Thus, for example, guanosine (2-amino-6-oxy-9-β-D-ribofuranosyl-purine) can be modified to form isoguanosine (2-oxy-6-amino-9-β-D-ribofuranosyl-purine). Such modification results in a nucleoside base which will no longer effectively form a standard base pair with cytosine. However, modification of cytosine (1-β-D-ribofuranosyl-2-oxy-4- amino-pyrimidine) to form isocytosine (1-β-D-ribofuranosyl-2-amino-4-oxy- pyrimidine-) results in a modified nucleotide which will not effectively base pair with guanosine but will form a base pair with isoguanosine (U.S. Pat. No.5,681,702 to Collins et al.). Isocytosine is available from Sigma Chemical Co. (St. Louis, Mo.); isocytidine can be prepared by the method described by Switzer et al. (1993) Biochemistry 32:10489-10496 and references cited therein; 2′-deoxy-5-methyl- isocytidine can be prepared by the method of Tor et al., 1993, J. Am. Chem. Soc. 115:4461-4467 and references cited therein; and isoguanine nucleotides can be prepared using the method described by Switzer et al., 1993, supra, and Mantsch et al., 1993, Biochem.14:5593-5601, or by the method described in U.S. Pat. No. 5,780,610 to Collins et al. Other nonnatural base pairs can be synthesized by the method described in Piccirilli et al., 1990, Nature 343:33-37, for the synthesis of 2,6- diaminopyrimidine and its complement (1-methylpyrazolo-[4,3]pyrimidine-5,7- (4H,6H)-dione. Other such modified nucleotide units which form unique base pairs Attorney Docket No.45817-0124WO1 / MTX959.20 are known, such as those described in Leach et al. (1992) J. Am. Chem. Soc. 114:3675-3683 and Switzer et al., supra. [00843] Polypeptide: The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The polymer can comprise modified amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine), as well as other modifications known in the art. [00844] The term, as used herein, refers to proteins, polypeptides, and peptides of any size, structure, or function. Polypeptides include encoded polynucleotide products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing. A polypeptide can be a monomer or can be a multi-molecular complex such as a dimer, trimer or tetramer. They can also comprise single chain or multichain polypeptides. Most commonly disulfide linkages are found in multichain polypeptides. The term polypeptide can also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid. In some embodiments, a "peptide" can be less than or equal to 50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long. [00845] Polypeptide variant: As used herein, the term "polypeptide variant" refers to molecules that differ in their amino acid sequence from a native or reference sequence. The amino acid sequence variants can possess substitutions, deletions, and/or insertions at certain positions within the amino acid sequence, as compared to a native or reference sequence. Ordinarily, variants will possess at least about 50% identity, at least about 60% identity, at least about 70% identity, at least about 80% identity, at least about 90% identity, at least about 95% identity, at least about 99% Attorney Docket No.45817-0124WO1 / MTX959.20 identity to a native or reference sequence. In some embodiments, they will be at least about 80%, or at least about 90% identical to a native sequence [00846] Preventing: As used herein, the term "preventing" refers to partially or completely delaying onset of an infection, disease, disorder and/or condition; partially or completely delaying onset of one or more symptoms, features, or clinical manifestations of a particular infection, disease, disorder, and/or condition; partially or completely delaying onset of one or more symptoms, features, or manifestations of a particular infection, disease, disorder, and/or condition; partially or completely delaying progression from an infection, a particular disease, disorder and/or condition; and/or decreasing the risk of developing pathology associated with the infection, the disease, disorder, and/or condition. [00847] Prophylactic: As used herein, "prophylactic" refers to a therapeutic or course of action used to prevent the spread of disease. [00848] Prophylaxis: As used herein, a "prophylaxis" refers to a measure taken to maintain health and prevent the spread of disease. An "immune prophylaxis" refers to a measure to produce active or passive immunity to prevent the spread of disease. [00849] Pseudouridine: As used herein, pseudouridine (ψ) refers to the C- glycoside isomer of the nucleoside uridine. A "pseudouridine analog" is any modification, variant, isoform or derivative of pseudouridine. For example, pseudouridine analogs include but are not limited to 1-carboxymethyl-pseudouridine, 1-propynyl-pseudouridine, 1-taurinomethyl-pseudouridine, 1-taurinomethyl-4-thio- pseudouridine, 1-methylpseudouridine (m 1 ψ) (also known as N1-methyl- pseudouridine), 1-methyl-4-thio-pseudouridine (m 1 s 4 ψ), 4-thio-1-methyl- pseudouridine, 3-methyl-pseudouridine (m 3 ψ), 2-thio-1-methyl-pseudouridine, 1- methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydropseudouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4- thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, 1-methyl-3- (3-amino-3-carboxypropyl)pseudouridine (acp 3 ψ), and 2′-O-methyl-pseudouridine (ψm). [00850] Purified: As used herein, "purify," "purified," "purification" means to make substantially pure or clear from unwanted components, material defilement, admixture or imperfection. Attorney Docket No.45817-0124WO1 / MTX959.20 [00851] Reference Nucleic Acid Sequence: The term "reference nucleic acid sequence" or “reference nucleic acid” or “reference nucleotide sequence” or “reference sequence” refers to a starting nucleic acid sequence (e.g., a RNA, e.g., an mRNA sequence) that can be sequence optimized. In some embodiments, the reference nucleic acid sequence is a wild type nucleic acid sequence, a fragment or a variant thereof. In some embodiments, the reference nucleic acid sequence is a previously sequence optimized nucleic acid sequence. [00852] Salts: In some aspects, the pharmaceutical composition for delivery disclosed herein and comprises salts of some of their lipid constituents. The term “salt” includes any anionic and cationic complex. Non-limiting examples of anions include inorganic and organic anions, e.g., fluoride, chloride, bromide, iodide, oxalate (e.g., hemioxalate), phosphate, phosphonate, hydrogen phosphate, dihydrogen phosphate, oxide, carbonate, bicarbonate, nitrate, nitrite, nitride, bisulfite, sulfide, sulfite, bisulfate, sulfate, thiosulfate, hydrogen sulfate, borate, formate, acetate, benzoate, citrate, tartrate, lactate, acrylate, polyacrylate, fumarate, maleate, itaconate, glycolate, gluconate, malate, mandelate, tiglate, ascorbate, salicylate, polymethacrylate, perchlorate, chlorate, chlorite, hypochlorite, bromate, hypobromite, iodate, an alkylsulfonate, an arylsulfonate, arsenate, arsenite, chromate, dichromate, cyanide, cyanate, thiocyanate, hydroxide, peroxide, permanganate, and mixtures thereof. [00853] Sample: As used herein, the term "sample" or "biological sample" refers to a subset of its tissues, cells or component parts (e.g., body fluids, including but not limited to blood, mucus, lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva, amniotic fluid, amniotic cord blood, urine, vaginal fluid and semen). A sample further can include a homogenate, lysate or extract prepared from a whole organism or a subset of its tissues, cells or component parts, or a fraction or portion thereof, including but not limited to, for example, plasma, serum, spinal fluid, lymph fluid, the external sections of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, tumors, organs. A sample further refers to a medium, such as a nutrient broth or gel, which can contain cellular components, such as proteins or nucleic acid molecule. Attorney Docket No.45817-0124WO1 / MTX959.20 [00854] Signal Sequence: As used herein, the phrases "signal sequence," "signal peptide," and "transit peptide" are used interchangeably and refer to a sequence that can direct the transport or localization of a protein to a certain organelle, cell compartment, or extracellular export. The term encompasses both the signal sequence polypeptide and the nucleic acid sequence encoding the signal sequence. Thus, references to a signal sequence in the context of a nucleic acid refer in fact to the nucleic acid sequence encoding the signal sequence polypeptide. [00855] Similarity: As used herein, the term "similarity" refers to the overall relatedness between polymeric molecules, e.g. between polynucleotide molecules (e.g. DNA molecules and/or RNA molecules) and/or between polypeptide molecules. Calculation of percent similarity of polymeric molecules to one another can be performed in the same manner as a calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as is understood in the art. [00856] Single unit dose: As used herein, a "single unit dose" is a dose of any therapeutic administered in one dose/at one time/single route/single point of contact, i.e., single administration event. [00857] Specific delivery: As used herein, the term “specific delivery,” “specifically deliver,” or “specifically delivering” means delivery of more (e.g., at least 1.5 fold more, at least 2-fold more, at least 3-fold more, at least 4-fold more, at least 5-fold more, at least 6-fold more, at least 7-fold more, at least 8-fold more, at least 9-fold more, at least 10-fold more) of a polynucleotide by a nanoparticle to a target tissue of interest (e.g., mammalian liver) compared to an off-target tissue (e.g., mammalian spleen). The level of delivery of a nanoparticle to a particular tissue can be measured by comparing the amount of protein produced in a tissue to the weight of said tissue, comparing the amount of polynucleotide in a tissue to the weight of said tissue, comparing the amount of protein produced in a tissue to the amount of total protein in said tissue, or comparing the amount of polynucleotide in a tissue to the amount of total polynucleotide in said tissue. For example, for renovascular targeting, a polynucleotide is specifically provided to a mammalian kidney as compared to the liver and spleen if 1.5, 2-fold, 3-fold, 5-fold, 10-fold, 15 fold, or 20 fold more polynucleotide per 1 g of tissue is delivered to a kidney compared to that delivered to Attorney Docket No.45817-0124WO1 / MTX959.20 the liver or spleen following systemic administration of the polynucleotide. It will be understood that the ability of a nanoparticle to specifically deliver to a target tissue need not be determined in a subject being treated, it can be determined in a surrogate such as an animal model (e.g., a rat model). [00858] Stable: As used herein "stable" refers to a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and in some cases capable of formulation into an efficacious therapeutic agent. [00859] Stabilized: As used herein, the term "stabilize," "stabilized," "stabilized region" means to make or become stable. [00860] Subject: By "subject" or "individual" or "animal" or "patient" or "mammal," is meant any subject, particularly a mammalian subject, for whom diagnosis, prognosis, or therapy is desired. Mammalian subjects include, but are not limited to, humans, domestic animals, farm animals, zoo animals, sport animals, pet animals such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, cows; primates such as apes, monkeys, orangutans, and chimpanzees; canids such as dogs and wolves; felids such as cats, lions, and tigers; equids such as horses, donkeys, and zebras; bears, food animals such as cows, pigs, and sheep; ungulates such as deer and giraffes; rodents such as mice, rats, hamsters and guinea pigs; and so on. In certain embodiments, the mammal is a human subject. In other embodiments, a subject is a human patient. In a particular embodiment, a subject is a human patient in need of treatment. [00861] Substantially: As used herein, the term "substantially" refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will understand that biological and chemical characteristics rarely, if ever, go to completion and/or proceed to completeness or achieve or avoid an absolute result. The term "substantially" is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical characteristics. [00862] Substantially equal: As used herein as it relates to time differences between doses, the term means plus/minus 2%. Attorney Docket No.45817-0124WO1 / MTX959.20 [00863] Suffering from: An individual who is "suffering from" a disease, disorder, and/or condition has been diagnosed with or displays one or more symptoms of the disease, disorder, and/or condition. [00864] Susceptible to: An individual who is "susceptible to" a disease, disorder, and/or condition has not been diagnosed with and/or cannot exhibit symptoms of the disease, disorder, and/or condition but harbors a propensity to develop a disease or its symptoms. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition can be characterized by one or more of the following: (1) a genetic mutation associated with development of the disease, disorder, and/or condition; (2) a genetic polymorphism associated with development of the disease, disorder, and/or condition; (3) increased and/or decreased expression and/or activity of a protein and/or nucleic acid associated with the disease, disorder, and/or condition; (4) habits and/or lifestyles associated with development of the disease, disorder, and/or condition; (5) a family history of the disease, disorder, and/or condition; and (6) exposure to and/or infection with a microbe associated with development of the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will develop the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will not develop the disease, disorder, and/or condition. [00865] Sustained release: As used herein, the term "sustained release" refers to a pharmaceutical composition or compound release profile that conforms to a release rate over a specific period of time. [00866] Synthetic: The term "synthetic" means produced, prepared, and/or manufactured by the hand of man. Synthesis of polynucleotides or other molecules of the present invention can be chemical or enzymatic. [00867] Targeted Cells: As used herein, "targeted cells" refers to any one or more cells of interest. The cells can be found in vitro, in vivo, in situ or in the tissue or organ of an organism. The organism can be an animal, for example a mammal, a human, a subject or a patient. [00868] Target tissue: As used herein “target tissue” refers to any one or more tissue types of interest in which the delivery of a polynucleotide would result in a desired biological and/or pharmacological effect. Examples of target tissues of Attorney Docket No.45817-0124WO1 / MTX959.20 interest include specific tissues, organs, and systems or groups thereof. In particular applications, a target tissue can be a liver, a kidney, a lung, a spleen, or a vascular endothelium in vessels (e.g., intra-coronary or intra-femoral). An “off-target tissue” refers to any one or more tissue types in which the expression of the encoded protein does not result in a desired biological and/or pharmacological effect. [00869] The presence of a therapeutic agent in an off-target issue can be the result of: (i) leakage of a polynucleotide from the administration site to peripheral tissue or distant off-target tissue via diffusion or through the bloodstream (e.g., a polynucleotide intended to express a polypeptide in a certain tissue would reach the off-target tissue and the polypeptide would be expressed in the off-target tissue); or (ii) leakage of an polypeptide after administration of a polynucleotide encoding such polypeptide to peripheral tissue or distant off-target tissue via diffusion or through the bloodstream (e.g., a polynucleotide would expressed a polypeptide in the target tissue, and the polypeptide would diffuse to peripheral tissue). [00870] Targeting sequence: As used herein, the phrase "targeting sequence" refers to a sequence that can direct the transport or localization of a protein or polypeptide. [00871] Therapeutic Agent: The term "therapeutic agent" refers to an agent that, when administered to a subject, has a therapeutic, diagnostic, and/or prophylactic effect and/or elicits a desired biological and/or pharmacological effect. For example, in some embodiments, an mRNA encoding a Snu13 polypeptide can be a therapeutic agent. [00872] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" means an amount of an agent to be delivered (e.g., nucleic acid, drug, therapeutic agent, diagnostic agent, prophylactic agent, etc.) that is sufficient, when administered to a subject suffering from or susceptible to an infection, disease, disorder, and/or condition, to treat, improve symptoms of, diagnose, prevent, and/or delay the onset of the infection, disease, disorder, and/or condition. [00873] Therapeutically effective outcome: As used herein, the term "therapeutically effective outcome" means an outcome that is sufficient in a subject suffering from or susceptible to an infection, disease, disorder, and/or condition, to treat, improve symptoms of, diagnose, prevent, and/or delay the onset of the infection, disease, disorder, and/or condition. Attorney Docket No.45817-0124WO1 / MTX959.20 [00874] Transcription: As used herein, the term "transcription" refers to methods to produce mRNA (e.g., an mRNA sequence or template) from DNA (e.g., a DNA template or sequence). [00875] Transfection: As used herein, "transfection" refers to the introduction of a polynucleotide (e.g., exogenous nucleic acids) into a cell wherein a polypeptide encoded by the polynucleotide is expressed (e.g., mRNA) or the polypeptide modulates a cellular function (e.g., siRNA, miRNA). As used herein, "expression" of a nucleic acid sequence refers to translation of a polynucleotide (e.g., an mRNA) into a polypeptide or protein and/or post-translational modification of a polypeptide or protein. Methods of transfection include, but are not limited to, chemical methods, physical treatments and cationic lipids or mixtures. [00876] Treating, treatment, therapy: As used herein, the term "treating" or "treatment" or "therapy" refers to partially or completely alleviating, ameliorating, improving, relieving, delaying onset of, inhibiting progression of, reducing severity of, and/or reducing incidence of one or more symptoms or features of a disease. For example, "treating" a disease can refer to diminishing symptoms associate with the disease, prolong the lifespan (increase the survival rate) of patients, reducing the severity of the disease, preventing or delaying the onset of the disease, etc. Treatment can be administered to a subject who does not exhibit signs of a disease, disorder, and/or condition and/or to a subject who exhibits only early signs of a disease, disorder, and/or condition for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and/or condition. [00877] Unmodified: As used herein, "unmodified" refers to any substance, compound or molecule prior to being changed in some way. Unmodified can, but does not always, refer to the wild type or native form of a biomolecule. Molecules can undergo a series of modifications whereby each modified molecule can serve as the "unmodified" starting molecule for a subsequent modification. [00878] Uracil: Uracil is one of the four nucleobases in the nucleic acid of RNA, and it is represented by the letter U. Uracil can be attached to a ribose ring, or more specifically, a ribofuranose via a ^-N 1 -glycosidic bond to yield the nucleoside uridine. The nucleoside uridine is also commonly abbreviated according to the one letter code of its nucleobase, i.e., U. Thus, in the context of the present disclosure, when a Attorney Docket No.45817-0124WO1 / MTX959.20 monomer in a polynucleotide sequence is U, such U is designated interchangeably as a "uracil" or a "uridine." [00879] Uridine Content: The terms "uridine content" or "uracil content" are interchangeable and refer to the amount of uracil or uridine present in a certain nucleic acid sequence. Uridine content or uracil content can be expressed as an absolute value (total number of uridine or uracil in the sequence) or relative (uridine or uracil percentage respect to the total number of nucleobases in the nucleic acid sequence). [00880] Uridine-Modified Sequence: The terms "uridine-modified sequence" refers to a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with a different overall or local uridine content (higher or lower uridine content) or with different uridine patterns (e.g., gradient distribution or clustering) with respect to the uridine content and/or uridine patterns of a candidate nucleic acid sequence. In the content of the present disclosure, the terms "uridine-modified sequence" and "uracil- modified sequence" are considered equivalent and interchangeable. [00881] A "high uridine codon" is defined as a codon comprising two or three uridines, a "low uridine codon" is defined as a codon comprising one uridine, and a "no uridine codon" is a codon without any uridines. In some embodiments, a uridine- modified sequence comprises substitutions of high uridine codons with low uridine codons, substitutions of high uridine codons with no uridine codons, substitutions of low uridine codons with high uridine codons, substitutions of low uridine codons with no uridine codons, substitution of no uridine codons with low uridine codons, substitutions of no uridine codons with high uridine codons, and combinations thereof. In some embodiments, a high uridine codon can be replaced with another high uridine codon. In some embodiments, a low uridine codon can be replaced with another low uridine codon. In some embodiments, a no uridine codon can be replaced with another no uridine codon. A uridine-modified sequence can be uridine enriched or uridine rarefied. [00882] Uridine Enriched: As used herein, the terms "uridine enriched" and grammatical variants refer to the increase in uridine content (expressed in absolute value or as a percentage value) in a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with respect to the uridine content of the corresponding candidate Attorney Docket No.45817-0124WO1 / MTX959.20 nucleic acid sequence. Uridine enrichment can be implemented by substituting codons in the candidate nucleic acid sequence with synonymous codons containing less uridine nucleobases. Uridine enrichment can be global (i.e., relative to the entire length of a candidate nucleic acid sequence) or local (i.e., relative to a subsequence or region of a candidate nucleic acid sequence). [00883] Uridine Rarefied: As used herein, the terms "uridine rarefied" and grammatical variants refer to a decrease in uridine content (expressed in absolute value or as a percentage value) in a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with respect to the uridine content of the corresponding candidate nucleic acid sequence. Uridine rarefication can be implemented by substituting codons in the candidate nucleic acid sequence with synonymous codons containing less uridine nucleobases. Uridine rarefication can be global (i.e., relative to the entire length of a candidate nucleic acid sequence) or local (i.e., relative to a subsequence or region of a candidate nucleic acid sequence). [00884] Variant: The term variant as used in present disclosure refers to both natural variants (e.g., polymorphisms, isoforms, etc.) and artificial variants in which at least one amino acid residue in a native or starting sequence (e.g., a wild type sequence) has been removed and a different amino acid inserted in its place at the same position. These variants can be described as "substitutional variants." The substitutions can be single, where only one amino acid in the molecule has been substituted, or they can be multiple, where two or more amino acids have been substituted in the same molecule. If amino acids are inserted or deleted, the resulting variant would be an "insertional variant" or a "deletional variant" respectively. [00885] Initiation Codon: As used herein, the term “initiation codon”, used interchangeably with the term “start codon”, refers to the first codon of an open reading frame that is translated by the ribosome and is comprised of a triplet of linked adenine-uracil-guanine nucleobases. The initiation codon is depicted by the first letter codes of adenine (A), uracil (U), and guanine (G) and is often written simply as “AUG”. Although natural mRNAs may use codons other than AUG as the initiation codon, which are referred to herein as “alternative initiation codons”, the initiation codons of polynucleotides described herein use the AUG codon. During the process of translation initiation, the sequence comprising the initiation codon is recognized via Attorney Docket No.45817-0124WO1 / MTX959.20 complementary base-pairing to the anticodon of an initiator tRNA (Met-tRNAi Met ) bound by the ribosome. Open reading frames may contain more than one AUG initiation codon, which are referred to herein as “alternate initiation codons”. [00886] The initiation codon plays a critical role in translation initiation. The initiation codon is the first codon of an open reading frame that is translated by the ribosome. Typically, the initiation codon comprises the nucleotide triplet AUG, however, in some instances translation initiation can occur at other codons comprised of distinct nucleotides. The initiation of translation in eukaryotes is a multistep biochemical process that involves numerous protein-protein, protein-RNA, and RNA- RNA interactions between messenger RNA molecules (mRNAs), the 40S ribosomal subunit, other components of the translation machinery (e.g., eukaryotic initiation factors; eIFs). The current model of mRNA translation initiation postulates that the pre-initiation complex (alternatively “43S pre-initiation complex”; abbreviated as “PIC”) translocates from the site of recruitment on the mRNA (typically the 5′ cap) to the initiation codon by scanning nucleotides in a 5′ to 3′ direction until the first AUG codon that resides within a specific translation-promotive nucleotide context (the Kozak sequence) is encountered (Kozak (1989) J Cell Biol 108:229-241). Scanning by the PIC ends upon complementary base-pairing between nucleotides comprising the anticodon of the initiator Met-tRNA i Met transfer RNA and nucleotides comprising the initiation codon of the mRNA. Productive base-pairing between the AUG codon and the Met-tRNA i Met anticodon elicits a series of structural and biochemical events that culminate in the joining of the large 60S ribosomal subunit to the PIC to form an active ribosome that is competent for translation elongation. [00887] Kozak Sequence: The term “Kozak sequence” (also referred to as “Kozak consensus sequence”) refers to a translation initiation enhancer element to enhance expression of a gene or open reading frame, and which in eukaryotes, is located in the 5′ UTR. The Kozak consensus sequence was originally defined as the sequence GCCRCC, where R = a purine, following an analysis of the effects of single mutations surrounding the initiation codon (AUG) on translation of the preproinsulin gene (Kozak (1986) Cell 44:283-292). Polynucleotides disclosed herein comprise a Kozak consensus sequence, or a derivative or modification thereof. (Examples of translational enhancer compositions and methods of use thereof, see U.S. Pat. No. Attorney Docket No.45817-0124WO1 / MTX959.20 5,807,707 to Andrews et al., incorporated herein by reference in its entirety; U.S. Pat. No.5,723,332 to Chernajovsky, incorporated herein by reference in its entirety; U.S. Pat. No.5,891,665 to Wilson, incorporated herein by reference in its entirety.) [00888] Modified: As used herein “modified” or “modification” refers to a changed state or a change in composition or structure of a polynucleotide (e.g., mRNA). Polynucleotides may be modified in various ways including chemically, structurally, and/or functionally. For example, polynucleotides may be structurally modified by the incorporation of one or more RNA elements, wherein the RNA element comprises a sequence and/or an RNA secondary structure(s) that provides one or more functions (e.g., translational regulatory activity). Accordingly, polynucleotides of the disclosure may be comprised of one or more modifications (e.g., may include one or more chemical, structural, or functional modifications, including any combination thereof). [00889] Nucleobase: As used herein, the term “nucleobase” (alternatively “nucleotide base” or “nitrogenous base”) refers to a purine or pyrimidine heterocyclic compound found in nucleic acids, including any derivatives or analogs of the naturally occurring purines and pyrimidines that confer improved properties (e.g., binding affinity, nuclease resistance, chemical stability) to a nucleic acid or a portion or segment thereof. Adenine, cytosine, guanine, thymine, and uracil are the nucleobases predominately found in natural nucleic acids. Other natural, non-natural, and/or synthetic nucleobases, as known in the art and/or described herein, can be incorporated into nucleic acids. Unless otherwise specified, the nucleobase sequence of a SEQ ID NO described herein encompasses both natural nucleobases and chemically modified nucleobases (e.g., a “U” designation in a SEQ ID NO encompasses both uracil and chemically modified uracil). [00890] Nucleoside/Nucleotide: As used herein, the term “nucleoside” refers to a compound containing a sugar molecule (e.g., a ribose in RNA or a deoxyribose in DNA), or derivative or analog thereof, covalently linked to a nucleobase (e.g., a purine or pyrimidine), or a derivative or analog thereof (also referred to herein as “nucleobase”), but lacking an internucleoside linking group (e.g., a phosphate group). As used herein, the term “nucleotide” refers to a nucleoside covalently bonded to an internucleoside linking group (e.g., a phosphate group), or any derivative, analog, or modification thereof that confers improved chemical and/or functional properties Attorney Docket No.45817-0124WO1 / MTX959.20 (e.g., binding affinity, nuclease resistance, chemical stability) to a nucleic acid or a portion or segment thereof. [00891] Nucleic acid: As used herein, the term “nucleic acid” is used in its broadest sense and encompasses any compound and/or substance that includes a polymer of nucleotides, or derivatives or analogs thereof. These polymers are often referred to as “polynucleotides”. Accordingly, as used herein the terms “nucleic acid” and “polynucleotide” are equivalent and are used interchangeably. Exemplary nucleic acids or polynucleotides of the disclosure include, but are not limited to, ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), DNA-RNA hybrids, RNAi-inducing agents, RNAi agents, siRNAs, shRNAs, mRNAs, modified mRNAs, miRNAs, antisense RNAs, ribozymes, catalytic DNA, RNAs that induce triple helix formation, threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a β-D-ribo configuration, α-LNA having an α-L-ribo configuration (a diastereomer of LNA), 2'-amino-LNA having a 2'-amino functionalization, and 2'-amino-α-LNA having a 2'-amino functionalization) or hybrids thereof. [00892] Nucleic Acid Structure: As used herein, the term “nucleic acid structure” (used interchangeably with “polynucleotide structure”) refers to the arrangement or organization of atoms, chemical constituents, elements, motifs, and/or sequence of linked nucleotides, or derivatives or analogs thereof, that comprise a nucleic acid (e.g., an mRNA). The term also refers to the two-dimensional or three-dimensional state of a nucleic acid. Accordingly, the term “RNA structure” refers to the arrangement or organization of atoms, chemical constituents, elements, motifs, and/or sequence of linked nucleotides, or derivatives or analogs thereof, comprising an RNA molecule (e.g., an mRNA) and/or refers to a two-dimensional and/or three dimensional state of an RNA molecule. Nucleic acid structure can be further demarcated into four organizational categories referred to herein as “molecular structure”, “primary structure”, “secondary structure”, and “tertiary structure” based on increasing organizational complexity. [00893] Open Reading Frame: As used herein, the term “open reading frame”, abbreviated as “ORF”, refers to a segment or region of an mRNA molecule that encodes a polypeptide. The ORF comprises a continuous stretch of non-overlapping, Attorney Docket No.45817-0124WO1 / MTX959.20 in-frame codons, beginning with the initiation codon and ending with a stop codon, and is translated by the ribosome. [00894] Pre-Initiation Complex (PIC): As used herein, the term “pre-initiation complex” (alternatively “43S pre-initiation complex”; abbreviated as “PIC”) refers to a ribonucleoprotein complex comprising a 40S ribosomal subunit, eukaryotic initiation factors (eIF1, eIF1A, eIF3, eIF5), and the eIF2-GTP-Met-tRNA i Met ternary complex, that is intrinsically capable of attachment to the 5′ cap of an mRNA molecule and, after attachment, of performing ribosome scanning of the 5′ UTR. [00895] RNA element: As used herein, the term “RNA element” refers to a portion, fragment, or segment of an RNA molecule that provides a biological function and/or has biological activity (e.g., translational regulatory activity). Modification of a polynucleotide by the incorporation of one or more RNA elements, such as those described herein, provides one or more desirable functional properties to the modified polynucleotide. RNA elements, as described herein, can be naturally-occurring, non- naturally occurring, synthetic, engineered, or any combination thereof. For example, naturally-occurring RNA elements that provide a regulatory activity include elements found throughout the transcriptomes of viruses, prokaryotic and eukaryotic organisms (e.g., humans). RNA elements in particular eukaryotic mRNAs and translated viral RNAs have been shown to be involved in mediating many functions in cells. Exemplary natural RNA elements include, but are not limited to, translation initiation elements (e.g., internal ribosome entry site (IRES), see Kieft et al., (2001) RNA 7(2):194-206), translation enhancer elements (e.g., the APP mRNA translation enhancer element, see Rogers et al., (1999) J Biol Chem 274(10):6421-6431), mRNA stability elements (e.g., AU-rich elements (AREs), see Garneau et al., (2007) Nat Rev Mol Cell Biol 8(2):113-126), translational repression element (see e.g., Blumer et al., (2002) Mech Dev 110(1-2):97-112), protein-binding RNA elements (e.g., iron- responsive element, see Selezneva et al., (2013) J Mol Biol 425(18):3301-3310), cytoplasmic polyadenylation elements (Villalba et al., (2011) Curr Opin Genet Dev 21(4):452-457), and catalytic RNA elements (e.g., ribozymes, see Scott et al., (2009) Biochim Biophys Acta 1789(9-10):634-641). Attorney Docket No.45817-0124WO1 / MTX959.20 [00896] Residence time: As used herein, the term “residence time” refers to the time of occupancy of a pre-initiation complex (PIC) or a ribosome at a discrete position or location along an mRNA molecule. [00897] Translational Regulatory Activity: As used herein, the term “translational regulatory activity” (used interchangeably with “translational regulatory function”) refers to a biological function, mechanism, or process that modulates (e.g., regulates, influences, controls, varies) the activity of the translational apparatus, including the activity of the PIC and/or ribosome. In some aspects, the desired translation regulatory activity promotes and/or enhances the translational fidelity of mRNA translation. In some aspects, the desired translational regulatory activity reduces and/or inhibits leaky scanning. 27. Equivalents and Scope [00898] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments in accordance with the invention described herein. The scope of the present invention is not intended to be limited to the above Description, but rather is as set forth in the appended claims. In the claims, articles such as "a," "an," and "the" can mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include "or" between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process. [00899] It is also noted that the term "comprising" is intended to be open and permits but does not require the inclusion of additional elements or steps. When the term "comprising" is used herein, the term "consisting of" is thus also encompassed and disclosed. Attorney Docket No.45817-0124WO1 / MTX959.20 [00900] Where ranges are given, endpoints are included. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise. [00901] In addition, it is to be understood that any particular embodiment of the present invention that falls within the prior art can be explicitly excluded from any one or more of the claims. Since such embodiments are deemed to be known to one of ordinary skill in the art, they can be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the compositions of the invention (e.g., any nucleic acid or protein encoded thereby; any method of production; any method of use; etc.) can be excluded from any one or more claims, for any reason, whether or not related to the existence of prior art. [00902] All cited sources, for example, references, publications, databases, database entries, and art cited herein, are incorporated into this application by reference, even if not expressly stated in the citation. In case of conflicting statements of a cited source and the instant application, the statement in the instant application shall control. [00903] Section and table headings are not intended to be limiting. CONSTRUCT SEQUENCES [00904] Table 9 By “G5” is meant that all uracils (U) in the mRNA are replaced by N1- methylpseudouracils. By “G6” is meant that all uracils (U) in the mRNA are replaced by 5-methoxyuracils. mRNA ORF ORF Sequence 5′ 3′ UTR Constru Attorney Docket No.45817-0124WO1 / MTX959.20 mRNA ORF ORF Sequence 5′ 3′ UTR Constru Name Sequen (Nucleotide) UTR ct s f c f 8 Attorney Docket No.45817-0124WO1 / MTX959.20 mRNA ORF ORF Sequence 5′ 3′ UTR Constru Name Sequen (Nucleotide) UTR ct 4 s f c 0, f 8 5 s Attorney Docket No.45817-0124WO1 / MTX959.20 mRNA ORF ORF Sequence 5′ 3′ UTR Constru Name Sequen (Nucleotide) UTR ct f c 1, f 8 6 s f Attorney Docket No.45817-0124WO1 / MTX959.20 mRNA ORF ORF Sequence 5′ 3′ UTR Constru Name Sequen (Nucleotide) UTR ct c 2, f 8 7 s f c 3, Attorney Docket No.45817-0124WO1 / MTX959.20 mRNA ORF ORF Sequence 5′ 3′ UTR Constru Name Sequen (Nucleotide) UTR ct f 8 8 s f c 4, f 8 Attorney Docket No.45817-0124WO1 / MTX959.20 mRNA ORF ORF Sequence 5′ 3′ UTR Constru Name Sequen (Nucleotide) UTR ct 9 s f c 5, f 8 Attorney Docket No.45817-0124WO1 / MTX959.20 mRNA ORF ORF Sequence 5′ 3′ UTR Constru Name Sequen (Nucleotide) UTR ct 0 s f c 6, f 8 Attorney Docket No.45817-0124WO1 / MTX959.20 mRNA ORF ORF Sequence 5′ 3′ UTR Constru Name Sequen (Nucleotide) UTR ct 1 s f c 7, f 8 Attorney Docket No.45817-0124WO1 / MTX959.20 mRNA ORF ORF Sequence 5′ 3′ UTR Constru Name Sequen (Nucleotide) UTR ct 2 s f c 8, f 8 3 s Attorney Docket No.45817-0124WO1 / MTX959.20 mRNA ORF ORF Sequence 5′ 3′ UTR Constru Name Sequen (Nucleotide) UTR ct f c 9, f 8 4 s f Attorney Docket No.45817-0124WO1 / MTX959.20 mRNA ORF ORF Sequence 5′ 3′ UTR Constru Name Sequen (Nucleotide) UTR ct c 0, f 8 5 s f c 1, Attorney Docket No.45817-0124WO1 / MTX959.20 mRNA ORF ORF Sequence 5′ 3′ UTR Constru Name Sequen (Nucleotide) UTR ct f 8 6 s f c 2, f 8 Attorney Docket No.45817-0124WO1 / MTX959.20 mRNA ORF ORF Sequence 5′ 3′ UTR Constru Name Sequen (Nucleotide) UTR ct 7 s f c 3, f 8 Attorney Docket No.45817-0124WO1 / MTX959.20 mRNA ORF ORF Sequence 5′ 3′ UTR Constru Name Sequen (Nucleotide) UTR ct 8 s f c 4, f 8 Attorney Docket No.45817-0124WO1 / MTX959.20 mRNA ORF ORF Sequence 5′ 3′ UTR Constru Name Sequen (Nucleotide) UTR ct 9 s f c 5, f 8 Attorney Docket No.45817-0124WO1 / MTX959.20 mRNA ORF ORF Sequence 5′ 3′ UTR Constru Name Sequen (Nucleotide) UTR ct 0 s f c 6, f 8 1 s Attorney Docket No.45817-0124WO1 / MTX959.20 mRNA ORF ORF Sequence 5′ 3′ UTR Constru Name Sequen (Nucleotide) UTR ct f c 7, f 8 EXAMPLES EXAMPLE 1: Synthesis of mRNAs Encoding Snu13 Variants [00905] mRNAs encoding Snu13 polypeptide variants can be constructed, e.g., by using the ORF sequence (amino acid) provided in any one of SEQ ID NOs: 320-373. [00906] Exemplary sequence optimized nucleotide sequence encoding Snu13 variants are provided in SEQ ID NOs:300-317. Attorney Docket No.45817-0124WO1 / MTX959.20 [00907] The mRNA sequence includes both 5′ and 3′ UTR regions flanking the ORF sequence (nucleotide). In an exemplary construct, the 5′ UTR and 3′ UTR sequences are SEQ ID NOs:50 and 108, respectively. 5′UTR: GGAAAUCGCAAAAUUUGCUCUUCGCGUUAGAUUUCUUUUAGUUUUCUCGCAACUAGC AAGCUUUUUGUUCUCGCC (SEQ ID NO:50) 3′UTR: UGAUAAUAGGCUGGAGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAG CCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGG GCGGC (SEQ ID NO:108) [00908] The Snu13 variant mRNA sequence is prepared as modified mRNA. Specifically, during in vitro transcription, modified mRNA can be generated using N1-methylpseudouridine-5′-Triphosphate to ensure that the mRNAs contain 100% N1-methylpseudouridine instead of uridine. Alternatively, during in vitro transcription, modified mRNA can be generated using N1-methoxyuridine-5′- Triphosphate to ensure that the mRNAs contain 100% 5-methoxyuridine instead of uridine. Further, Snu13 variant mRNA can be synthesized with a primer that introduces a polyA-tail, and a cap structure is generated on both mRNAs using co- transcriptional capping via m 7 G-ppp-Gm-AG tetranucleotide to incorporate a m 7 G- ppp-Gm-AG 5′ cap1. Alternatively, Snu13 variant mRNA can be synthesized and the polyA-tail introduced during Gibson assembly of the DNA template. EXAMPLE 2: Production of Nanoparticle Compositions A. Production of nanoparticle compositions [00909] Nanoparticles can be made with mixing processes such as microfluidics and T-junction mixing of two fluid streams, one of which contains the polynucleotide and the other has the lipid components. [00910] Lipid compositions are prepared by combining an ionizable amino lipid disclosed herein, e.g., a lipid according to Formula (I) such as Compound II or a lipid according to Formula (III) such as Compound VI, a phospholipid (such as DOPE or Attorney Docket No.45817-0124WO1 / MTX959.20 DSPC, obtainable from Avanti Polar Lipids, Alabaster, AL), a PEG lipid (such as 1,2 dimyristoyl sn glycerol methoxypolyethylene glycol, also known as PEG-DMG, obtainable from Avanti Polar Lipids, Alabaster, AL), and a structural lipid (such as cholesterol, obtainable from Sigma Aldrich, Taufkirchen, Germany, or a corticosteroid (such as prednisolone, dexamethasone, prednisone, and hydrocortisone), or a combination thereof) at concentrations of about 50 mM in ethanol. Solutions should be refrigerated for storage at, for example, -20° C. Lipids are combined to yield desired molar ratios and diluted with water and ethanol to a final lipid concentration of between about 5.5 mM and about 25 mM. [00911] Nanoparticle compositions including a polynucleotide and a lipid composition are prepared by combining the lipid solution with a solution including the a polynucleotide at lipid composition to polynucleotide wt:wt ratios between about 5:1 and about 50:1. The lipid solution is rapidly injected using a NanoAssemblr microfluidic based system at flow rates between about 10 ml/min and about 18 ml/min into the polynucleotide solution to produce a suspension with a water to ethanol ratio between about 1:1 and about 4:1. [00912] For nanoparticle compositions including an RNA, solutions of the RNA at concentrations of 0.1 mg/ml in deionized water are diluted in 50 mM sodium citrate buffer at a pH between 3 and 4 to form a stock solution. [00913] Nanoparticle compositions can be processed by dialysis to remove ethanol and achieve buffer exchange. Formulations are dialyzed twice against phosphate buffered saline (PBS), pH 7.4, at volumes 200 times that of the primary product using Slide-A-Lyzer cassettes (Thermo Fisher Scientific Inc., Rockford, IL) with a molecular weight cutoff of 10 kD. The first dialysis is carried out at room temperature for 3 hours. The formulations are then dialyzed overnight at 4° C. The resulting nanoparticle suspension is filtered through 0.2 μm sterile filters (Sarstedt, Nümbrecht, Germany) into glass vials and sealed with crimp closures. Nanoparticle composition solutions of 0.01 mg/ml to 0.10 mg/ml are generally obtained. [00914] The method described above induces nano-precipitation and particle formation. Alternative processes including, but not limited to, T-junction and direct injection, can be used to achieve the same nano-precipitation. B. Characterization of nanoparticle compositions Attorney Docket No.45817-0124WO1 / MTX959.20 [00915] A Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) can be used to determine the particle size, the polydispersity index (PDI) and the zeta potential of the nanoparticle compositions in 1×PBS in determining particle size and 15 mM PBS in determining zeta potential. [00916] Ultraviolet-visible spectroscopy can be used to determine the concentration of a polynucleotide (e.g., RNA) in nanoparticle compositions.100 μL of the diluted formulation in 1×PBS is added to 900 μL of a 4:1 (v/v) mixture of methanol and chloroform. After mixing, the absorbance spectrum of the solution is recorded, for example, between 230 nm and 330 nm on a DU 800 spectrophotometer (Beckman Coulter, Beckman Coulter, Inc., Brea, CA). The concentration of polynucleotide in the nanoparticle composition can be calculated based on the extinction coefficient of the polynucleotide used in the composition and on the difference between the absorbance at a wavelength of, for example, 260 nm and the baseline value at a wavelength of, for example, 330 nm. [00917] For nanoparticle compositions including an RNA, a QUANT-IT™ RIBOGREEN® RNA assay (Invitrogen Corporation Carlsbad, CA) can be used to evaluate the encapsulation of an RNA by the nanoparticle composition. The samples are diluted to a concentration of approximately 5 μg/mL in a TE buffer solution (10 mM Tris-HCl, 1 mM EDTA, pH 7.5). 50 μL of the diluted samples are transferred to a polystyrene 96 well plate and either 50 μL of TE buffer or 50 μL of a 2% Triton X- 100 solution is added to the wells. The plate is incubated at a temperature of 37° C for 15 minutes. The RIBOGREEN® reagent is diluted 1:100 in TE buffer, and 100 μL of this solution is added to each well. The fluorescence intensity can be measured using a fluorescence plate reader (Wallac Victor 1420 Multilablel Counter; Perkin Elmer, Waltham, MA) at an excitation wavelength of, for example, about 480 nm and an emission wavelength of, for example, about 520 nm. The fluorescence values of the reagent blank are subtracted from that of each of the samples and the percentage of free RNA is determined by dividing the fluorescence intensity of the intact sample (without addition of Triton X-100) by the fluorescence value of the disrupted sample (caused by the addition of Triton X-100). [00918] Exemplary formulations of the nanoparticle compositions are presented in the Table 10 below. The term "Compound" refers to an ionizable amino lipid such as Attorney Docket No.45817-0124WO1 / MTX959.20 MC3, Compound II, Compound VI, or Compound B. "Phospholipid" can be DSPC or DOPE. "PEG-lipid" can be PEG-DMG or Compound I. Table 10. Exemplary Formulations of Nanoparticles Composition (mol Components %) d Attorney Docket No.45817-0124WO1 / MTX959.20 48:10.5:38.5:3 Compound:Phospholipid:Chol:PEG-lipid EXAMPLE 3: Design and Synthesis of Snu13 protein variants [00919] Codon-optimized mRNAs encoding Snu13 variants (Snu13_02 to Snu13_19; see Table 9) were generated. The Snu13 variant polypeptides contain the substitutions (relative to wild type Snu13, SEQ ID NO:1) described in Table 11 below. In addition to the substitutions described in Table 11, below, the generated Snu13 variant polypeptides contain (i) C30A, C73A, C93A, and C102A substitutions (relative to SEQ ID NO:1) for yeast display and (ii) an additional C-terminal GS sequence (relative to wild type Snu13, SEQ ID NO:1). [00920] Table 11. Polypeptide Substitutions (relative to SEQ ID NO:1) mRNA ORF S Attorney Docket No.45817-0124WO1 / MTX959.20 Snu13_10 N40K; A42V; A60M; I65V; K86Q; V95L; S96D; SEQ ID R97V; I100A; A101V; Q114H NO:308 [00921] A subset of the generated Snu13 variants were tested for Snu13-mediated repression of target mRNA encoding enhanced green fluorescent protein (eGFP). FIG.1A is a cartoon depicting the experimental set-up. Briefly, HeLa cells were transfected with (i) 10x molar excess of mRNA encoding Snu13 (wild type), parental Snu13 (Snu13_01, identical to SEQ ID NO:1 except for C30A, C73A, C93A, and C102A substitutions; SEQ ID NO:3), or Snu13 variant (SEQ ID NOs:300-309) and (ii) 10 ng eGFP target mRNA containing a 5’ kink turn Snu13 repressor binding site (GGAUCCGUGAUCGGAAACGUGAGAUCC, SEQ ID NO:500) using Lipofectamine 2000 according to the manufacturer’s instructions. Forty-eight hours after transfection, the total GFP integrated intensity was measured using Incucyte Attorney Docket No.45817-0124WO1 / MTX959.20 according to the manufacturer’s instructions. As a control for eGFP expression, cells were transfected with mRNA encoding human erythropoietin, which is not predicted to suppress kink turn (ctrl). mRNA encoding L7Ae repressor was also used as a control. [00922] FIG.1B is a graph depicting total GFP integrated intensity area under the curve. All constructs repressed the target. EXAMPLE 4: Snu13 protein variant selectivity [00923] The selectivity of Snu13 protein variants for N1 methylpseudouracil-(G5-) modified target mRNA versus unmodified (G0) target mRNA was tested. All uracils in G5-modified mRNAs were replaced with N1-methylpseudouracil. Briefly, HeLa cells were transfected with (i) 10 ng of G5 or G0 mRNA encoding eGFP and containing a 5’ kink turn Snu13 repressor binding site (SEQ ID NO:500) and (ii) 10x molar excess of mRNA encoding Snu13 (wild type) or Snu13_01, Snu13_02, Snu13_03, Snu13_04, or Snu13_08 (SEQ ID NOs: 3, 300-302, and 306, respectively) using Lipofectamine 2000 according to the manufacturer’s instructions. Forty-eight hours after transfection, the total GFP integrated intensity was measured using Incucyte according to the manufacturer’s instructions. [00924] The AUC is depicted in FIG.2A (for G5 target mRNA) and FIG.2B (for G0 target mRNA). The percent inhibition is summarized in Table 12. The tested Snu13 variants repressed both G5 and G0 target mRNA; however, they showed stronger suppression for G5 target RNA. [00925] Table 12 Snu13 Snu13_01 Snu13_02 Snu13_03 Snu13_04 Snu13_08 [00926] To further test the selectivity of Snu13 variants for G5 mRNA over G0 mRNA, a competition experiment was done with fixed amount of repressor Snu13, fixed amount of G5 ktLuc target (mRNA encoding luciferase and containing a 5’ kink turn Snu13 repressor binding site, SEQ ID NO:500) and increasing molar excess of Attorney Docket No.45817-0124WO1 / MTX959.20 G0 ktGFP (mRNA encoding eGFP and containing a 5’ kink turn Snu13 repressor binding site, SEQ ID NO:500) as depicted (FIG.3A and FIG.3B). Transfections were performed using Lipofectamine 2000 according to the manufacturer’s instructions. Forty-eight hours after transfection, the total expression of eGFP and of luciferase was measured using Incucyte and Promega One-glo luciferase assay system, respectively, according to the manufacturer’s instructions. [00927] FIG.3A is a graph depicting the percent expression of G0 target mRNA (encoding GFP). FIG.3B is a graph depicting the percent expression of G5 target mRNA (encoding luciferase). Snu13_02 and Snu13_03 showed stronger repression for G5 target RNA compared to WT Snu13, even at 20-30x molar excess of G0 target mRNA in direct competition. EXAMPLE 5: Snu13 protein variant selectivity [00928] The selectivity of additional Snu13 protein variants for N1 methylpseudouracil-(G5-) modified target mRNA versus unmodified (G0) target mRNA was tested as described in Example 3, using 10x molar excess of mRNA encoding Snu13 (wild type), parental Snu13 (Snu13_01, identical to SEQ ID NO:1 except for C30A, C73A, C93A, and C102A substitutions; SEQ ID NO:3), or Snu13 variant (Snu13_02 to Snu13_14, ORF SEQ ID NOs:300-312, respectively) using Lipofectamine 2000 according to the manufacturer’s instructions. As a control for eGFP expression, cells were transfected with mRNA encoding human erythropoietin, which is not predicted to suppress kink turn containing mRNA, or mRNA encoding L7Ae repressor. Seventy-two hours after transfection, the total GFP integrated intensity was measured using Incucyte according to the manufacturer’s instructions. [00929] The AUC is depicted in FIG.4A (for G5 target mRNA) and FIG.4B (for G0 target mRNA) for 10x molar excess of the Snu13 mRNA and in FIG.4C (for G5 target mRNA) and FIG.4D (for G0 target mRNA) for 1:1 molar ratio. [00930] To further test the selectivity of Snu13 variants for G5 mRNA over G0 mRNA, a competition experiment was done with fixed amount of repressor Snu13, fixed amount of G5 ktLuc target (mRNA encoding luciferase and containing a 5’ kink turn Snu13 repressor binding site, SEQ ID NO:500) and increasing molar excess of Attorney Docket No.45817-0124WO1 / MTX959.20 G0 ktGFP (mRNA encoding eGFP and containing a 5’ kink turn Snu13 repressor binding site, SEQ ID NO:500) as depicted. Transfections were performed using Lipofectamine 2000 according to the manufacturer’s instructions. Seventy-two hours after transfection, the total expression of eGFP was measured using Incucyte and the total expression of luciferase was measured by Promega One-glo luciferase assay according to the manufacturer’s instructions. [00931] FIG.5A is a graph depicting the percent expression of G0 target mRNA (encoding GFP) at 20x or 10x molar ratio of G0 target mRNA. FIG.5B is a graph depicting the percent expression of G0 target mRNA (encoding GFP) at 5x or 1x molar ratio of G0 target mRNA. FIG.5C is a graph depicting the percent expression of G0 target mRNA (encoding GFP) at 0.2x molar ratio of G0 target mRNA. FIG. 6A is a graph depicting the percent expression of G5 target mRNA (encoding luciferase) at 20x or 10x molar ratio of G0 target mRNA. FIG.6B is a graph depicting the percent expression of G5 target mRNA (encoding luciferase) at 10x or 5x molar ratio of G0 target mRNA. FIG.6C is a graph depicting the percent expression of G5 target mRNA (encoding luciferase) at 0.2x molar ratio of G0 target mRNA. G5 selective variants Snu13_02, Snu13_03, Snu13_12, and Snu13_13 (SEQ ID NOs:300, 301, 310, and 311, respectively) showed reduced repression on G0 target, even at high levels compared to G5 target (FIGs.5A-5C). G5 selective variants Snu13_02, Snu13_03, Snu13_12, and Snu13_13 (SEQ ID NOs:300, 301, 310, and 311, respectively) repressed G5 target to the same degree, regardless of increases in competing G0 target content (FIGs.6A-6C). The percent inhibition is summarized in Tables 13 and 14. [00932] Table 13. Percent knockdown as compared to epo control for FIGs. 5A-5C G0 Snu13 Snu13_02 Snu13_03 Snu13_12 Snu13_13 Attorney Docket No.45817-0124WO1 / MTX959.20 1x 92.5 12.5 -17 37.3 -0.9 0.2x 65.5 17.4 0.58 46.5 -14.7 A-6C G5 Snu13 Snu13_02 Snu13_03 Snu13_12 Snu13_13 repression (wild type) (SEQ ID (SEQ ID (SEQ ID (SEQ ID
Next Patent: RECESSED LIGHTING WITH UPPER VISUAL HEMISPHERE CEILING WASH