The invention relates to a novel association between a known polymorphism in the gene encoding the human chemokine receptor CCR5 and the inflammatory bowel diseases Crohn's disease (CD) and ulcerative colitis (UC).

BACKGROUND OF THE INVENTION.

Ulcerative colitis (UC) and Crohn's disease (CD) are inflammatory diseases of the bowel which tend to affect young adults and have a combined prevalence of 200/100,000. Although not common they are an important cause of morbidity and suffering in this age group. The main symptoms are abdominal pain and diarrhoea, with rectal bleeding in ulcerative colitis and colon bleeding in Crohn's disease. The diagnosis of inflammatory bowel disease (IBD), particularly Crohn's disease, can be difficult as these symptoms are fairly non-specific and may be caused by a variety of different disorders such as the irritable bowel syndrome. It is not uncommon therefore for patients with Crohn's disease to be misdiagnosed initially and in some cases a definitive diagnosis may not be made for over a year after the onset of symptoms. Clearly, this delay could be eliminated if a reliable, sensitive and specific genetic test was available.

The importance of inherited genetic factors in the pathogenesis of the inflammatory bowel diseases, ulcerative colitis and Crohn's disease has become increasingly clear in recent years. There is good evidence for a strong genetic predisposition to these conditions based on data from populationl, family2~5 and twin67 concordance studies. These data suggest

that the genetic contribution is particularly important in Crohn's disease: the coefficient of heritability in Crohn's disease derived from the Swedish twin study is greater than those in schizophrenia, insulin dependent-diabetes, or hypertension. However, complex segregation analysis of a large group of North European patients indicates that a simple mendelian pattern of inheritance is involved in only a small minority of cases'.

Furthermore, the finding of mixed families in which some members have ulcerative colits and others have Crohn's gives rise to a complex polygenic model of two related disorders that share some susceptibility factors yet differ for others.

The availability of comprehensive high resolution linkage maps has made it possible to screen the entire genome for chromosomal segments that are linked to disease susceptibility by analysing allele-sharing in affected sibling pairs. Hugot et al. 9 reported the first genome-wide search for susceptibility genes in Crohn's disease in 1996, with evidence for linkage to a 40 cM region spanning the centromere on chromosome 16. In notable contrast to studies in other complex diseases, this initial linkage has been replicated in studies in Europe, North America and Australia14.

The present inventors have reported the results of a two-stage genome-wide search for susceptibility loci involved in the pathogenesis of both Crohn's disease and ulcerative colitis15. This provided evidence of novel linkages between susceptibility to inflammatory bowel disease and regions on chromosomes 12,7 and 3. Moreover, individual markers on chromosomes 2 and 6 (the HLA region) were linked with ulcerative colitis but not Crohn's disease; and the

region on chromosome 16 seemed to be linked exclusively with Crohn's disease. These data provided the first molecular genetic evidence to date that Crohn's disease and ulcerative colitis are likely to be related polygenic disorders, sharing some but not all susceptibility genes. The chromosome 12 linkage has subsequently been replicated by a large number of other groups from around the world 12 11. The genome wide search provided suggestive evidence for linkage between ulcerative colitis and Crohn's disease to a locus at chromosome 3p21 (2 adjacent markers, D3S1573, P=2. 1x10-4, lod score 2.69 and D3S1076, P=0.0027, lod score 1.69), although this has not as yet been replicated in an independent dataset.

The chemokine receptor genes CCR5 and CCR2 map to the chromosome 3 linkage interval. Common functional polymorphisms in these two genes have been described recently. The CCR5 32 base pair deletion (CCR5-A32) and a single nucleotide polymorphism in CCR2 (V64I) have been associated with resistance to HIV-1 infectionl'-18 19 20 and slowing the progression to AIDS in HIV infected individuals21, respectively.

CCR5 and CCR2 are attractive candidate susceptibility genes for inflammatory bowel disease.

The intestinal mucosa in IBD is characterised by a chronic inflammatory infiltrate of macrophages and lymphocytes with acute exacerbations involving the infiltration of neutrophils. Chemokines secreted at sites of inflammation or infection, act via chemokine receptors to increase the expression of leukocyte integrins thus inducing endothelial adherence and extravasation of inflammatory cells into inflamed tissue sites. Elevated levels of the chemokines MCP-1, MIP-la and IL-8 are detected in the inflamed intestine in inflammatory bowel disease22 23 and MCP-1, MIP-la are

among the natural ligands of CCR2 and CCR5. The role of chemokines in the pathogenesis of IBD has recently been reviewed BRIEF DESCRIPTION OF THE INVENTION.

The present invention provides a method of screening a human subject for susceptibility to inflammatory bowel disease, which method comprises screening for the presence or absence in the genome of said human subject of the CCR5-A32 allele.

In addition the invention provides a method of screening a human subject for susceptibility to inflammatory bowel disease, which method comprises screening for the presence or absence in the genome of said human subject of one or more DNA polymorphisms in linkage disequilibrium with CCR5-A32.

In a further aspect the invention provides a method of diagnosing inflammatory bowel disease in a human subject, which method comprises screening for the presence or absence in the genome of said human subject of the CCR5-A32 allele.

Also provided is a method of diagnosing inflammatory bowel disease in a human subject, which method comprises screening for the presence or absence in the genome of said subject of one or more DNA polymorphisms in linkage disequilibrium with CCR5-A32.

In a further aspect the invention provides a method of establishing the or any genetic basis for inflammatory bowel disease the symptoms of which are manifested in a human subject by screening the genome of said subject for the presence or absence of the CCR5-A32 allele or one or more DNA polymorphisms in linkage disequilibrium with CCR5-A32.

The above methods of screening or diagnosis may be useful both in diagnosing IBD, particularly CD or

UC, in subjects suspected of having disease and also in differentiating between CD and UC or between different subtypes of CD and UC. Accordingly, the term diagnosing'as used in connection with the methods of the invention should be taken to include within its scope both distinguishing between different types of IBD, i. e. UC versus CD and distinguishing between different sub-types of the two conditions.

The ability to distinguish between CD and UC can be important in formulating regimes of treatment. If a patient has severe disease necessitating surgical removal of the colon then it becomes very important to be able to differentiate between the two. The reason for this is that reconstructive surgery-the formation of an ileal pouch-is a favoured treatment for those who have undergone colectomy for UC but is usually a failure in patients with Crohn's disease, resulting in greatly increased complications, morbidity and often the need for the pouch to be excised. Thus a genetic test which reliably differentiates UC from CD avoid this problem.

The observed association between CCR5 and IBD allows for the possibility of an in vitro screening method for identifying molecules which modify wild- type CCR5 activity and hence have potential therapeutic uses in the treatment of IDB.

Thus, in another of its aspects the invention provides a method of identifying a molecule with the potential to be suitable for use as a therapeutic agent for the treatment of inflammatory bowel disease which method comprises measuring an indicator of the intracellular effect of the binding to CCR5 of an agonist thereof in the presence or absence ov the molecule to be tested; wherein an intracellular measurement which indicates that CCR5 activity is

increased in the presence of said test molecule is an indication that said molecule has potential to be suitable for the treatment of inflammatory bowel disease.

Compounds identified as enhancers of CCR5 activity are also encompassed by the invention.

DETAILED DESCRIPTION OF THE INVENTION.

The present invention is particularly directed to a method of screening a human subject for susceptibility to inflammatory bowel disease. The invention is based on the discovery by the present inventors of an association between carriage of CCR5- A32 and susceptibility to both ulcerative colitis and Crohn's disease, as illustrated in the Example included herein. Accordingly, the method of the invention comprises screening for the presence or absence in the genome of the human subject of the CCR5-A32 allele, homozygosity or heterozygosity for the CCR5-A32 deletion providing an indication that the individual may be susceptible to inflammatory bowel disease.

Unless otherwise defined, all medical and scientific terms used herein have the ordinary meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Accordingly, the term inflammatory bowel disease'encompasses both Crohn's disease (CD) and ulcerative colitis (UC).

The present inventors have demonstrated an association between the CCR5-A32 allele and inflammatory bowel disease. As used herein the term CCR5 refers to a human gene encoding the chemokine receptor designated CCR5 (also known as CKR5) and present at the GenBank Accession Nos. U95626, U83326 and U66285 as well as all allelic variations thereof.

CCR5-A32 refers to an allelic variant of CCR5 having a 32 base pair deletion as described in reference 19 and by Ansari-Lari M. A. et al (1997) Nature Genet. 16, 221-222.

The possibility that the pathogenic mutation may be another polymorphism closely linked to CCR5-A32 cannot be ruled out and the invention also provides a method of screening a human subject for susceptibility to inflammatory bowel disease which comprises screening for the presence or absence in the genome of said human subject of one or more DNA polymorphisms in linkage disequilibrium with CCR5-A32.

As would be readily apparent to persons of ordinary skill in the relevant art, linkage disequilibrium'occurs between a marker (e. g. a DNA polymorphism) and a disease if the marker is situated in close proximity to the functional (disease contributing) variant. Due to the close physical proximity, many generations may be required for the marker and the disease-causing variant to be separated by recombination. As a result they will be present together on the same haplotype at higher frequency than expected even in very distantly related people.

Polymorphisms known to show linkage disequilibrium with CCR5-A32 include: CCR5, CYS303TER (Quillent C et al; 1998, Lancet 315 14 to 18), CCR5, ARG233GLN, ALA335VAL and a CCR5, one base pair deletion CC to C at nucleotides 893-894 (numbered from the first base of the initiation codon) causing a frame shift at amino acid position 299 (referred to herein as frame shift 299 (Ansari-Lari, M. A. et al, 1997, Nature Genet. 16: 221-222), and

promoter polymorphisms 59029G/A and 59353T/C (bases numbered from GenBank sequence U95626) described in the Multicenter AIDS Conhort Study (MACS) Lancet, Sept 1998,12; 352 (9131): 866-70.

The step of screening for the presence or absence of specific CCR5 polymorphisms, including the A32 deletion and the other polymorphisms mentioned herein, can be carried out using any of the methodologies known in the art. The process of screening for the presence or absence of specific alleles may also be referred to herein as genotyping'. In a preferred embodiment, genotyping is carried out by performing PCR using allele specific primers, a technique known in the art as PCR-SSP.

In a specific embodiment, exemplified herein, PCR analysis of the CCR5-A32 deletion is performed on purified genomic DNA using the wild-type primer 5'- ATGTCTGGAAATTCTTCCAGA or the CCR5-A32 primer 5'- CCCAAGATGACTATCTTTAATG in conjunction with the consensus primer 5'-AAGTGTCAAGTCCAATCTATG. Using these primers the predicted amplicon sizes for the wild type and A32 deletion are 169bp and 143bp, respectively. The PCR products can thus be distinguished on the basis of size by gel electrophoresis. Alternatively, and also within the scope of the invention, the PCR products generated from the wild-type and the A32 deletion could be distinguished by sequencing of the PCR products or by hybridisation to oligonucleotide probes specific for the 32 base pair deleted region. In the latter approach, the oligonucleotide probe could optionally be immobilised/anchored on a solid support, for example in the form of a array or microarray (See Lockhart et al., Nature Biotechnology, vol. 14, December 1996"Expression monitoring by hybridisation

to high density oligonucleotide arrays".

The presence of an amplification product in PCR reaction using the CCR5-A32 primer and the consensus primer indicates the presence of at least one CCR5-A32 allele in the genome of the subject, whereas the presence of an amplification product in PCR reaction using the wild-type primer and consensus primer indicates the presence of at least one CCR5 allele normal for the A32 deletion in the genome of said subject.

Because the CCR5-A32 deletion occurs in the coding region of the CCR5 gene the PCR-based genotyping procedure can also be carried out using cDNA rather than genomic DNA as the PCR template.

Genomic DNA is, however, the preferred template.

A further technique known in the art which could be used to screen for the presence or absence of the CCR5-A32 deletion is based on the detection of a restriction fragment length polymorphism on Southern blots of genomic DNA.

The Southern blot technique is well known in the art and is described, for example, in Molecular Cloning: A Laboratory Manual, Sambrook, Fritsch and Maniatis, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Briefly, genomic DNA from the subject to be genotyped is first digested with one or more restriction enzymes and the restriction fragments are separated by gel electrophoresis on the basis of size.

The fragments are then transferred from the electrophoresis gel to a solid support suitable for nucleic acid hybridisation, for example a membrane filter of nitrocellulose or nylon. The fragments are fixed on the solid support, for example by exposure to UV radiation (UV cross-liking) and the filter is then probed with a CCR5-specific probe under standard

conditions for DNA hybridisation (see Molecular Cloning: A Laboratory Manual, ibid). Fragments which hybridise to the CCR5-specific probe are then visualised and the pattern of CCR5-containing restriction fragments generated from the genomic DNA of the said subject is compared to the pattern generated from the genomic DNA of a wild-type individual known not to carry the CCR5-A32 deletion.

The presence of at least one CCR5-A32 allele in the genome of the subject is indicated by the presence of a restriction fragment approximately 32 base pairs shorter than the equivalent fragment from the wild- type individual.

The use of Southern blotting for the detection of the CCR5-A32 deletion is described in detail in WO 98/05798, as a way of identifying individuals who may be resistant to HIV-1 infection. WO 98/05798 describes a method in which genomic DNA is digested with the enzymes EcoRI and BglII, blotted and then probed with a BamHI-SalI fragment of the CCR5 cDNA.

The wild-type allele produces a fragment of 283bp, whilst the A32 allele produces a fragment of 251bp.

An identical methodology could be used, in accordance with the present invention, to identify individuals who are susceptible to inflammatory bowel disease.

Further techniques are known in the art for the scoring of single nucleotide polymorphisms (see review by Schafer, A. J. and Hawkins, J. R. in Nature Biotechnology, Vol 16, pp33-39 (1998) including mass spectrometry, particularly matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS, se Roskey, M. T. et al., 1996, PNAS USA, 93: 4724-4729), single nucleotide primer extension (Shumaker, J. M. et al., 1996, Hum. Mutat., 7: 346-354; Pastinen, T. et al., 1997, Genome Res., 7:

606-614) and DNA microchips/microarrays (Underhill, P.

A. et al., 1996, PNAS USA, 93: 196-200). The known techniques for scoring polymorphisms are of general applicability and it would therefore be readily apparent to persons skilled in the art that the known techniques could be adapted for the scoring of single nucleotide polymorphisms in the CCR5 gene.

Given that both Crohn's disease and ulcerative colitis are likely to be polygenic disorders, possibly sharing a number of susceptibility genes, it is also within the scope of the invention to perform the screen for the CCR5-A32 deletion in conjunction with screens for other polymorphisms shown to be associated with susceptibility to IBD, for example as part of a panel of screens for possibly up to 10 different genes/polymorphisms.

In addition to the above-described diagnostic applications the present inventors'work provides important information for the development of therapies for inflammatory bowel disease, in particular Crohn's disease and ulcerative colitis. The inventors are the first to observe that the chemokine receptor CCR5 is associated with this disease. In cells homozygous for the CCR5-A32 allele no CCR5 receptor protein is detectable on the cell-surface. Although not wishing to be bound thereby it is hypothesised by the inventors that normal CCR5 expression both on inflammatory cells and the intestinal mucosa acts as a negative feedback receptor to down-regulate inflammatory and immune responses. If CCR5 function is reduced or absent then this negative control is released, resulting in enhanced cytokine secretion and more vigorous T-cell immune responses-both of which are features central to the pathogenesis of inflammatory bowel disease. Thus, molecules which are

CCR5 agonists capable of enhancing the downstream intracellular effects of CCR5 have potential for the treatment of IBD in patients when CCR5 is expressed on epithelial cells of the intestine or on immune and/or inflammatory cells.

At present there is no rational therapy for IBD.

The mainstays are corticosteroids and immunosuppressives, both of which are non-specific anti-inflammatory treatments with frequent unpleasant side effects. Therefore, a specific therapy based on knowledge of the genetic basis of IBD is highly desirable.

The observations of the present inventors have allowed for the development of an in vitro screen for detecting molecules which are agonists of CCR5 and enhancers of the downstream, intracellular effects of CCR5. Such molecules have potential to be useful therapeutic agents for the treatment of IBD.

The in vitro screening method of the invention comprises exposing a cell expressing CCR5 to an agonist thereof in the presence or absence of the test molecule and measuring the intracellular effect of agonist binding. CCR5 is a G-protein coupled receptor and intracellular indicators of CCR5 activity are calcium influx, GTP binding, cAMP generation or inositol phosphate levels. Any or all of these may be measured in a cell by known methods such as described by Ling et al (1999) Proc Natl Acad Sci 6 ; 96 (14): 7922-7 or in WO 97/32019. Disruption of the cells may be required for such measurements although methods are known to those skilled in the art for making such measurements in in-tact cells. For example, intracellular calcium sensing can be performed using calcium sensitive flourochromes (such as fluo-3 and fura-2) which fluoresce in the presence of changing

calcium concentration (Kao J. P. Y., Practical aspects of measuring Ca2+ with flourescent indicators. (1994) in Methods in Cell Biology, 40; 155-181--A Practical Guide to the Study of Ca2+ in living cells. ed.

R. Nuccitelli, Academic Press). An increased level of any of these in the presence of the test molecule indicates that said molecule is an enhancer of CCR5 activity and is therefore a potential therapeutic agent for the treatment of IBD.

Suitable naturally-occurring agonists of CCR5 for use in the above described methods are RANTES, MIP-la or MIP-lb. Any cell capable of in vitro culture which expresses CCR5 on the surface thereof is suitable for use in the method. For example they could be any CCR5 immortalised cell-line, either a naturally-occurring cell or one transfected with CCR5 encoding nucleic acid. CCR5 positive peripheral blood mononuclear cells would also be suitable as well as gut epithelial cells. Any method well-known to one skilled in the art would be suitable for culture of the above- described cells. Such methods are described in? As an alternative to the use of whole cells membrane fragments bearing CCR5 may be used in the screening method of the invention.

There is no limitation as to the type of molecule to be tested in the screening method of the invention.

They may include proteins, peptides, DNA, RNA, PNA, oligo-nucleotides, nucleotides, amino acids and smaller molecular weight organic and inorganic molecules. The molecules may already have a known pharmacological or biochemical activity or be known molecules with no such identified activity. Novel molecules may also be tested such as those found in a library generated by combinatorial chemistry.

All patents, patent applications, scientific

articles and other publications mentioned in this article are incorporated herein by reference.

The invention is further illustrated by the following experimental example: EXAMPLE 1-CANDIDATE GENE STUDY MATERIALS AND METHODS.

Patients/families European caucasian patients were recruited from the inflammatory bowel disease clinics of the John Radcliffe Hospital, Oxford, UK and Wycombe General Hospital, High Wycombe, UK. All patients were under local specialist follow up and had had their diagnosis of IBD confirmed by standard clinical, radiological and histologic criteria (Table 1). The two cohorts of Crohn's patients were ascertained at different points in time. The second cohort of ulcerative colitis patients from Oxford had all had surgical treatment and an ileo-anal pouch anastamosis performed for severe or intractable disease. 101 Caucasoid cadaveric renal allograft donors were used as controls.

Genotyping Genomic DNA was extracted from EDTA or tri-sodium citrate anticoagulated peripheral blood by a salting out method. Polymorphisms were typed using PCR with sequence specific primers (PCR-SSP).

Each reaction contained an allele specific primer, the 3'nucleotide of which determined allele specificity, and a consensus primer.

Primers for the CCR5 32 base pair deletion polymorphism were designed from the published sequence

U54994. Predicted amplicon sizes for the wild type and 32 base pair deletion were 169 base pairs and 143 base pairs respectively.

CCR5 wild type 5'-ATGTCTGGAAATTCTTCCAGA-3' CCR5 deletion 5'-CCCAAGATGACTATCTTTAATG-3' CCR5 consensus 5'-AAGTGTCAAGTCCAATCTATG-3' Primers to detect the position 64 valine to isoleucine amino acid substitution in the CCR2 polypeptide were designed from the published sequence U95626. The predicted amplicon size was 155 base pairs for each reaction.

CCR2 64V 5'-GTGGGCAACATGCTGGTCG-3' CCR2 64I 5'-GTGGGCAACATGCTGGTCA-3' CCR2 consensus 5'-CCCAAAGACCCACTCATTTG-3' In addition, amplification control primers giving rise to a 796 base pair fragment of the third intron of HLADR B were added to each reaction.

HLA DRBl F 5'-TGCCAAGTGGAGCACCCAA-3' HLA DRB1 R 5'-GCATCTTGCTCTGTGCAGAT-3' Reaction mixtures of 13 yl were used, consisting of 67 mM Tris base pH 8.8,16.6 mM ammonium sulphate, 2 mM magnesium chloride, 0.01% (v/v) Tween 20,200 mM each of dATP, dTTP, dGTP and dCTP, forward and reverse primers at 6.8 HM each, control primers at 0.68 pM, between 0.1 and 0.01 yg DNA and 0.1875 units of Taq polymerase (Advanced Biotechnology, London, UK).

Reaction mixtures were dispensed under 10 pu ouf mineral oil (Sigma, UK) in 96-well PCR plates (Costar, High Wycombe, UK).

DNA samples were amplified in GeneAmp PCR system 9600 (Perkin-Elmer Corporation) or in MJ Research PTC-200 thermal cyclers with cycling parameters as follows:

one minute at 96°C followed by five cycles of 96°C for 25 seconds, 70°C for 45 seconds, and 72°C for 45 seconds, followed by 21 cycles of 96°C for 25 seconds, 65°C for 50 seconds, and 72°C for 45 seconds, followed by four cycles of 96°C for 25 seconds, 55°C for 60 seconds, and 72°C for 120 seconds. PCR plates were sealed with Thermowell sealers (Costar) and dipped in mineral oil to improve plate to block contact.

Gel electrophoresis and product detection Following PCR, 5 pl of loading buffer consisting of 0. 25% Orange G, 30% v/v glycerol, and 0.5x TBE buffer (89 mM Tris base, 89 mM boric acid, 2 mM EDTA, pH 8.0) was added to each reaction mix. PCR products (amplicons) were then electrophoresed in 1.0% agarose gels containing 0.5 yg/ml ethidium bromide for 20-25 minutes at 15 V/cm in 0.5x TBE buffer, visualized with W illumination and photo-graphed with a Polaroid land camera.

Genotype frequencies were calculated and initially analysed by the Chi squared test using a 3x3 contingency table. Carriage of the mutant alleles (i. e. the proportion of individuals possessing one or more mutant allele) in the disease cohorts was analysed against controls in 2x2 contingency tables using Fisher's exact test. The odds ratio and 95% confidence intervals were calculated.

RESULTS AND DISCUSSION.

Genotyping results for CCR2 and CCR5 are presented in Tables 2 and 3 respectively. The overall genotype data for CCR5-A32 reveals significant differences between patients and controls (3x3 contingency table, Chi-square=19.1, P=0.0008). This is accounted for by increases in the frequency of both

A32 heterozygotes and homozygotes in both disease groups. Carriage of one or more copy of the 32 base pair deletion was significantly increased in both disease cohorts compared to controls (Control 13. 9%.

Crohns disease 43.9%, Fisher's Exact P<0.0001, OR 4. 8 (2.2-10.5). Ulcerative colitis 31%, Fisher's Exact P=0.002, OR 2.8 (1.4-5. 4)).

No significant differences in CCR2 V64I genotype were detected between patient groups and controls.

The results of this study demonstrate a strong association between carriage of CCR5-A32 and susceptibility to both ulcerative colitis and Crohn's disease. No significant association was detected with the common CCR2 coding polymorphism despite the fact that CCR2 and CCR5 are adjacent genes, separated by only 11.8kb. However, the possibility that the pathogenic mutation may be another polymorphism closely linked to CCR5-A32 cannot be ruled out.

Table 1: Demographic and clinical characteristics of the association study cohorts<BR> Crohn's diseases Ulcerative colitis<BR> n=151 n=197<BR> Male/Female 37.5%/62.5% 50%/50%<BR> Median age at Dx 26 38.5<BR> UC distal 56%<BR> UC extensive 44%<BR> CD Ileal 47%<BR> CD Ileo-colonic 33%<BR> CD colonic 20% Table 2. CCR5 #32 genotype and allele carriage frequencies<BR> Crohn's Disease Ulcerative Colitis @<BR> Genotype number % number % number<BR> WT 101 66.9% 134 68.4% 155<BR> WT/# 32 45 29.8% 50 25.5% 36<BR> D32 5 3.3% 12 6.1% 3<BR> Carriage number % number % number<BR> WT 151 100.0% 184 93.9% 191<BR> # 32 50 33.1% * 62 31.6% # 39<BR> # 3x3 Chi square, P=0.01<BR> * Fisher's Exacp P=0.007, OR 2.0 (1.2-3.2), CD v Control, D32 carried v not carried.<BR> <P># Fisher's Exact P=0.01, OR 1.8 (1.1-2.9), UC v Control, D32 carried v not carried.<BR> <P>&num Fisher's Exact P=0.003, OR 1.9 (1.2-2.9), IBD overall v Control, D32 carried v not carried.

Table 3. CCR2 V64I genotype and allele carriage frequencies<BR> Crohn's Disease Ulcerative Colitis @<BR> Genotype number % number % number<BR> V/V 50 87.7% 124 80.0% 150<BR> V/I 6 10.5% 30 19.4% 26<BR> I/I 1 1.8% 1 0.6% 3<BR> Carriage number % number % number<BR> V 151 100.0% 184 93.9% 191<BR> I 50 33.1% * 62 31.6% # 39<BR> No association detected between CCR2 V64I and either disease gr

REFERENCES 1. Probert CSJ, Jayanthi V, Hughes AO, Thompson JR, Wicks ACB, Mayberry JF. Prevalence and family risk of ulcerative colitis and Crohn's disease: an epidemiological study among Europeans and South Asians in Leicestershire. Gut 1993 ; 34: 1547-1551.

2. Lee JC, Lennard-Jones JE. Inflammatory bowel disease in 67 families each with three or more affected first-degree relatives. Gastroenterology 1996; 111 (3): 587-96.

3. Peeters M, Nevens H, Baert F, et al. Familial aggregation in Crohn's disease: increased age-adjusted risk and concordance in clinical characteristics.

Gastroenterology 1996 ; 111 (3): 597-603.

4. Bayless TM, Tokayer AZ, Polito JM, 2nd, Quaskey SA, Mellits ED, Harris ML. Crohn's disease: concordance for site and clinical type in affected family members- -potential hereditary influences. Gastroenterology 1996 ; 111 (3): 573-9.

5. Satsangi J, Grootscholten C, Holt H, Jewell DP.

Clinical patterns of familial inflammatory bowel disease. Gut 1996 ; 38 (5): 738-41.

6. Tysk C, Lindberg E, Jarnerot G, Floderus-Myrhed B.

Ulcerative colitis and Crohn's disease in an unselected population of monozygotic and dizygotic twins. A study of heritability and the influence of smoking. Gut 1988; 29 (7): 990-6.

7. Subhani J, Montgomery S, Pounder R, Wakefield A.

Concordance rates of twins and siblings in

inflammatory bowel disease (IBD). Gastroenterology 1998 ; 114 (4): A1093.

8. Orholm M, Iselius L, Sorensen TI, Munkholm P, Langholz E, Binder V. Investigation of inheritance of chronic inflammatory bowel diseases by complex segregation analysis. BMJ 1993 ; 306 (6869): 20-4.

9. Hugot JP, Laurent-Puig P, Gower-Rousseau C, et al.

Mapping of a susceptibility locus for Crohn's disease on chromosome 16. Nature 1996; 379: 821-823.

10. Parkes M, Satsangi J, Lathrop GM, Bell JI.

Susceptibility loci in inflammatory bowel disease (letter). Lancet 1996; 348 (9041): 1588-1588.

11. Hampe J, Schreiber S, Shaw SH, et al. A genomewide analysis provides evidence for novel linkages in inflammatory bowel disease in a large European cohort.

Am J Hum Genet 1999; 64 (3): 808-16.

12. Ohmen JD, Yang H, Yamomoto KK, et al.

Susceptibility locus for IBD on chromosome 16 has a role in Crohn's disease but not in ulcerative colitis.

Hum. Mol. Gen 1996 ; 5 (10): 1679-1683.

13. Cho J, Nicolae D, Gold L, et al. Identification of novel susceptibility loci for IBD on chromosomes lp, 3q and 4q: evidence for epistasis between lp and IBD1.

Proc. Nat. Acad. Sci. USA 1998 ; 95: 7502-7.

14. Cavanaugh JA, Callen DF, Wilson SR, et al.

Analysis of Australian Crohn's disease pedigrees refines the localization for susceptibility to inflammatory bowel disease on chromosome 16. Ann Hum Genet 1998; 62 (Pt 4): 291-8.

15. Satsangi J, Parkes M, Louis E, et al. Two-stage genome-wide search in inflammatory bowel disease: evidence for susceptibility loci on chromosomes 3, 7 and 12. Nature Genetics 1996 ; 14 (2): 199-202.

16. Duerr RH, Barmada MM, Zhang L, et al. Linkage and association between inflammatory bowel disease and a locus on chromosome 12. Am J Hum Genet 1998; 63 (1) : 95- 100.

17. Liu R, Paxton WA, Choe S, et al. Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection. Cell 1996 ; 86 (3): 367-77.

18. Paxton WA, Martin SR, Tse D, et al. Relative resistance to HIV-1 infection of CD4 lymphocytes from persons who remain uninfected despite multiple high- risk sexual exposure. Nat Med 1996; 2 (4): 412-7.

19. Dean M, Carrington M, Winkler C, et al. Genetic restriction of HIV-1 infection and progression to AIDS by a deletion allele of the CKR5 structural gene.

Hemophilia Growth and Development Study, Multicenter AIDS Cohort Study, Multicenter Hemophilia Cohort Study, San Francisco City Cohort, ALIVE Study [published erratum appears in Science 1996 Nov 15; 274 (5290): 1069]. Science 1996; 273 (5283): 1856-62.

20. Samson M, Libert F, Doranz BJ, et al. Resistance to HIV-1 infection in caucasian individuals bearing mutant alleles of the CCR-5 chemokine receptor gene.

Nature 1996 ; 382 (6593): 722-5.

21. Smith MW, Dean M, Carrington M, et al. Contrasting

genetic influence of CCR2 and CCR5 variants on HIV-1 infection and disease progression. Hemophilia Growth and Development Study (HGDS), Multicenter AIDS Cohort Study (MACS), Multicenter Hemophilia Cohort Study (MHCS), San Francisco City Cohort (SFCC), ALIVE Study.

Science 1997; 277 (5328): 959-65.

22. Reinecker HC, Loh EY, Ringler DJ, Mehta A, Rombeau JL, MacDermott RP. Monocyte-chemoattractant protein 1 gene expression in intestinal epithelial cells and inflammatory bowel disease mucosa. Gastroenterology 1995 ; 108 (1) : 40-50.

23. Grimm M, doe W. chemokines in inflammatory bowel disease mucosa: expression of RANTES, macrophage inflammatory protein (MIP)-la, MIP-lb and ginterferon inducible protein 10 by macrophages, lymphocytes, endothelial cells and granulomas. Inflamm Bowel Dis 1996; 2: 88-96.

24. McDermott RP, Sanderson IR, Reinecker HC. The central role of chemokines (chemotactic cytokines) in ther immunopathogenesis of ulcearative colitis and Crohn's disease. Inflammatory bowel diseases.

1998; 4 (1) : 54-67.

25. Terwilliger J, Shannon W, Lathrop G, et al. True and false positive peaks in genomewide scans: applications of length-biased sampling to linkage mapping. Am J Hum Genet 1997; 61 (2): 430-438.

26. Weeks DE, Lathrop GM. Polygenic disease: methods for mapping complex disease traits. Trends in Genetics 1995 ; 11 (12): 513-519.

27. Lander ES, Kruglyak L. Genetic dissection of complex traits: guidelines for interpreting and reporting linkage results. Nature Genetics 1995 ; 11 : 241-247.

28. Rioux J, Daly M, Green T, Stone V, Lander E, Hudson T. Absense of linkage between IBD and selected loci on chromosomes 3,7,12 and 16. Gastroenterology 1998; 115 (5): 1062-65.

29. Huang Y, Paxton WA, Wolinsky SM, et al. The role of a mutant CCR5 allele in HIV-1 transmission and disease progression. Nat Med 1996; 2 (11): 1240-3.

30. Zhou Y, Kurihara T, Ryseck RP, et al. Impaired macrophage function and enhanced T cell-dependent immune response in mice lacking CCR5, the mouse homologue of the major HIV-1 coreceptor. J Immunol 1998; 160 (8): 4018-25.

31. Dwinell MB, Eckmann L, Leopard JD, Varki NM, Kagnoff MF. Chemokine Receptor Expression by Human Intestinal Epithelial Cells. Gastroenterology 1999; 117 (2): 359-367.

32. Stephens JC, Reich DE, Goldstein DB, et al. Dating the origin of the CCR5-Delta32 AIDS-resistance allele by the coalescence of haplotypes. American Journal Of Human Genetics 1998; 62 (6): 1507-15.

33. Ekbom A. Epidemiology of Crohn's Disease. In: Prantera C, Korelitz B, eds. Crohn's Disease. New York: Marcel Dekker, 1996: 57-79.

34. Langman M. Epidemiological overview of inflammatory bowel disease. In: Allen R, Rhodes J,

Hanauer S, Keighley M, Alexander-Williams J, Fazio V, eds. Inflammatory bowel diseases. 3rd ed. New York: Churcill Livingstone, 1997: 35-40.

35. Mummidi S, Ahuja SS, McDaniel BL, Ahuja SK. The human CC chemokine receptor 5 (CCR5) gene. Multiple transcripts with 5'-end heterogeneity, dual promoter usage, and evidence for polymorphisms within the regulatory regions and noncoding exons. J Biol Chem 1997 ; 272 (49): 30662-71.

36. McDermott DH, Zimmerman PA, Guignard F, Kleeberger CA, Leitman SF, Murphy PM. CCR5 promoter polymorphism and HIV-1 disease progression. Multicenter AIDS Cohort Study (MACS). Lancet 1998 ; 352 (9131): 866-70.