BACKGROUND OF THE INVENTION Acute myocardial infarction (AMI) is a leading cause of death in the Western world. It is commonly caused by the formation of a pathologic clot (thrombus) at a critical position which results in obstruction of blood flow to heart muscles. The use of blood clot dissolving agents is a well-established method for treating patients with AMI. Results from several large-scale clinical trials have firmly established the effectiveness of this approach in saving lives. Clinically approved blood clot dissolving agents include streptokinase, anisoylated plasminogen streptokinase activator complex (APSAC or anistreplase), tissue specific plasminogen activator (tPA) and urokinase tPA is the most commonly used. Even though tPA is fibrin specific, its short i71 vivo biological half-life and sensitivity to plasminogen activator inhibitors in circulation require the use of high doses of tPA, to achieve effective clot lysis. At these high pharmacological doses, tPA exerts only partial fibrin specificity. This results in depletion of plasma proteins such as coagulation factors V and VIII, and to a certain degree, plasminogen and fibrinogen. Approximately 57% of the patients treated with tPA can restore their blood flow to an acceptable level within 90 minutes after receiving the treatment. Within this group, 10-30% of patients show reocclusion shortly after clot dissolution. The reformed secondary clots are usually platelet-rich and show strong resistance to lysis mediated by tPA. Furthermore, a low but significant percentage of the patients also suffer from stroke.

Staphylokinase (SAK) shows promise for use as a blood clot dissolving agent [10].

Although SAK does not bind directly to fibrin, it can act indirectly on fibrin by binding plasmin (ogen) to form a 1: 1 stoichiometric SAK-plasmin (ogen) complex. The resulting complex can then function as the plasminogen activator to convert plasminogen to plasmin which will cause clot lysis. Although SAK has thrombolytic potency comparable to tPA, several multi- center clinical trials demonstrate that the SAK-plasmin complex is more specific for fibrin than is tPA [11-13]. This high specificity for fibrin is accomplished by a mechanism whereby the plasminogen activation activity of any non-fibrin bound SAK-plasmin complex is inhibited by

circulating a2-antiplasmin. In contrast, if the SAK-plasmin complex is bound to fibrin, a2- antiplasmin is unable to bind to this complex. Consequently, the SAK-plasmin complex can activate plasminogen to generate plasmin locally on the surface of the clot. Furthermore, SAK is shown to bind preferentially to clot bound plasmin (ogen) [15]. SAK also has the ability to dissolve platelet-rich plasma clots and is much more efficient than tPA and streptokinase under both in vitro conditions and in animal models [16].

In the treatment of thrombotic diseases, plasminogen activators are generally administered together with an anticoagulant substance such as heparin. This results in improved thrombolysis as compared to treatment with only a plasminogen activator (Tebbe et al. , Z. Kardiol. 80, Suppl : 3,32 (1991) ). Various clinical results indicate that, in parallel with the dissolution of clots, an increased tendency towards coagulation occurs (Szczeklik et al. , Arterioscl. Thromb. 12,548 (1992); Goto et al., Angiology 45, 273 (1994) ). It is assumed that this occurs because thrombin molecules, which are enclosed in the clot are released when the clot dissolves. Moreover, plasminogen activators may also accelerate the activation of prothrombin and thus act in opposition to thrombolysis (Brommer et al. , Thromb. Haemostas. 70,995 (1993) ). Anticoagulant substances such as heparin, hirugen, hirudin, argatroban, protein C and recombinant tick anticoagulant peptide (TAP) can counter this increased tendency towards re-occlusion during thrombolysis and can thus enhance the success of lysis therapy (Yao et al., Am. J. Physiol. 262 (Heart Circ. Physiol. 31) H 347-H 379 (1992); Schneider, Thromb. Res. 64,667 (1991); Gruber et al. in Circulation 84,2454 (1991) ; Martin et al. , J. Am. Coll. Cardiol. 22,914 (1993); Vlasuk et al., Circulation 84, Suppl. II-467 (1991).

One of the strongest thrombin inhibitors is hirudin, first isolated from the leech Hirudo medicinales. There are various isoforms of this 65 amino acid protein, which differ in regard to their amino acid sequences. All isoforms of hirudin block the binding of thrombin to a substrate, for example fibrinogen, and also block the active center of thrombin (Rydel et al. , Science 24. 9, 277 (1990) ; Bode and Huber, Molecular Aspects of Inflammation, Springer, Berlin, Heidelberg, 103-115 (1991) ; Stone and Hofsteenge, Prot. Engineering 2, 295 (1991) ; Dodt et al., Biol. Chem.

Hoppe-Seyler 366,379 (1985) ). In addition, smaller polypeptides derived from hirudin, which also act as thrombin inhibitors, are known in the art (Maraganore et al., Biochemistry 29,7095 (1990); Krstenansky et al. in J. Med. Chem. 30, 1688 (1987); Yue et al., Prot. Engineering 5,77 (1992)).

The use of hirudin in combination with a plasminogen activator for the treatment of thrombotic diseases is described in U. S. Pat. No. 4,944, 943 and U. S. Pat. No. 5,126, 134. The use of hirudin derivatives in combination with a thrombolytic agent is known from PCT International Patent Application WO 91/01142, the contents of which are incorporated herein by reference.

Hirullin is a 61 amino acid long protein which was first isolated from the leech Hirudo 7nanillensis. Hirullin is similar to hirudin in regard to its action and inhibitor strength, but differs considerably from hirudin in regard to its amino acid sequence. It is also possible to derive smaller polypeptides from hirullin, which are good thrombin inhibitors (Krstenansky et al. , Febs Lett. 269,465 (1990) ).

To equip SAK with the capability of targeting freshly formed clots and to minimize reocclusion, physical linkage of a thrombin inhibitor to SAK is desirable. Various attempts to link antithrombotic activity to SAK have been reported [24,62, 63].. However, all these reported structures are in a linear fusion format. Creation of linear fusions between these two molecules is not ideal because each component requires a free N-terminus for its function. Removal of the positive charge of the a-amino group at the N-terminus by either acetylation or addition of one extra amino acid severely reduces the inhibitory effect of hirudin to thrombin [19,32, 33]. The three-dimensional structure of the hirudin-thrombin complex and site-directed mutagenesis of hirudin illustrate that the N-terminal a-amino group of hirudin forms a hydrogen bond with Serl 95 in the catalytic site of thrombin [34,35]. For SAK, its processing by plasmin to remove the first 10 amino acids to expose the positively charged lysine residue at position 11 is essential for the activity of SAK [24,36]. Although a processed version of staphylokinase can be engineered using recombinant DNA technology, the presence of a positively charged residue at the N-tenninus of the processed staphylokinase is absolutely required [24].

Therefore, there is a need in the art for a thrombolytic agent that combines a plasminogen actuator such as staphylokinase and a thrombin inhibitor such as hirudin, such that biologic activity of each component in retained.

SUMMARY OF THE INVENTION In an effort to mitigate the shortcomings of currently available thrombolytic therapy, the Applicants have engineered a"Y"shaped heterodimer comprising a plasminogen activator and a

thrombin inhibitor which can be targeted to freshly formed thrombin-rich thrombi to initiate clot lysis and minimize clot reformation through the inhibition of thrombin.

Therefore, in one aspect the invention comprises a heterodimer including a plasminogen activator and a thrombin inhibitor, wherein each of the plasminogen activator and the thrombin inhibitor comprises a free N-terminus. In one embodiment, the plasminogen activator comprises staphylokinase and the thrombin inhibitor comprises hirudin.

The proteins used in this invention may be produced by genetic engineering. In one embodiment, synthetic oligonucleotides encoding the proteins are cloned into suitable plasmids and expressed in E. coli under the control of the trp or tac promoter. Particularly preferred is the trp promoter. Alternatively, inducible regulatory systems in B. subtilis may be used, including sucrose inducible system (sacB based promoter system with appropriate regulatory sequence), xylose induction system and gluconate induction system. In one embodiment, the expression vector system includes a constitutively expressed P43 promoter isolated from B. subtilis.

Therefore, in another aspect, this invention comprises plasmids for use in the production of the heterodimeric protein which plasmids comprise operons which comprise a constitutively expressed promoter or a regulable promoter, a synthetic structural gene for a protein according to the invention, and one or two terminators downstream of the structural gene. The plasmids according to the invention can be expressed in B. subtilis strains, particularly in extracellular protease deficient strains, for example WB600, WB700 or WB800, and secreted into the extracellular medium.

In another aspect, the invention comprises a pair of nucleic acids that encodes for a a plasminogen activator and a thrombin inhibitor that can be combined to form a heterodimer. In one embodiment, the plasminogen activator comprises staphylokinase and the thrombin inhibitor comprises hirudin. The nucleic acids may form plasmids or other vectors used to transform cells.

In yet another aspect, the invention may comprise cells transformed with plasmids of the present invention.

In another aspect, the invention comprises compositions for treating thrombotic diseases comprising the thrombolytic agents described herein as well as methods of treating subjects with thrombotic diseases with the thrombolytic agents described herein.

BRIEF DESCRIPTION OF THE DRAWINGS The invention will now be described by way of exemplary embodiments with reference to the accompanying drawings.

Fig. 1 shows the structure of a hirudin-E coil (HE) and staphylokinase-K coil (SK) heterodimer (HE-SK). Figure 1A shows a molecular model of HE-SK. E-coil and K-coil serve as the heterodimerization domains. A cysteine residue located at position"d"of the first heptad repeat in each coiled coil allows the formation of an interchain disulfide bond as illustrated in the model. SAK represents staphylokinase. Figure 1B shows a helical wheel presentation of the coiled-coil heterodimerization domain. Positions of the heptad repeat are marked from"a"to"g".

Fig. 2 shows the secretory production of hirudin-E coil (HE) and staphylokinase-K coil (SK).

Figure 2A shows a Coomassie blue stained SDS-polyacrylamide gel. Figure 2B shows a Western blot probed with hirudin specific polyclonal antibodies. Lanes 1-4 in Figures 2A and 2B are the culture supernatant from WB600 [pUB18] (negative control), WB600 [pHirudin-E coil], WB700 [pHirudin-E coil] and WB800 [pHirudin-E coil], respectively. Asterisk marks the position of the secreted hirudin-E coil. Figure 2C shows another Coomassie blue stained SDS-polyacrylamide. Figure 2D shows a Western blot probed with staphylokinase specific polyclonal antibodies. Lanes 1-5 in Figures 2C and 2D are the culture supernatant from WB600 [pUB18] (negative control), WB600 [pSAK], WB600 [pSAK-K coil], WB700 [pSAK- K coil], and WB800 [pSAK-K coil], respectively. M represents the molecular weight markers.

Fig. 3 shows SI) S-PAGE and Western blot analyses of purified hirudin-E coil, SAK-K coil and HE-SK. Figure 3A shows a Coomassie blue stained SDS-polyacrylamide gel for hirudin- E coil and SAK-K coil. Lanes 1 and 2 are the purified hirudin-E coil and SAK-K coil analyzed in the presence of reducing agent (mercaptoethanol). Lanes 4-5 are the same samples analyzed in the absence of reducing agent. Lane 3 is an empty lane without any sample loading. Its presence is to minimize the diffusion of reducing agent from lane 2 to lane 4. Figure 3B shows a Western blot probed with hirudin specific polyclonal antibodies.

Lanes 1 and 2 are purified hirudin-E coil (before and after the disulfide-bond reshuffling

treatment) analyzed in the absence of reducing agent. Lane 3 is an empty lane. Lane 4 is the purified hirudin-E coil analyzed in the presence of reducing agent. Figure 3C shows a Coomassie blue stained SDS-polyacrylamide gel for purified HE-SK. Lanes 2 and 3 are purified HE-SK (before and after disulfide-bond reshuffling) analyzed in the absence of reducing agent. M represents the molecular weight markers.

Fig. 4 shows a characterization of purified HE-SK. Figure 4A shows a Coomassie blue stained SDS-polyacrylamide gel for purified HE-SK. Failure to see the hirudin-E coil band in lane 1 is because of the poor staining of this protein with Coomassie blue. Figure 4B shows a Western blot probed with staphylokinase specific polyclonal antibodies. Figure 4C shows a Western blot probed with hirudin specific polyclonal antibodies. Lanes 1 and 3 are purified HE-SK analyzed in the presence and absence of reducing agent, respectively. Figure 4D shows a molecular mass determination of purified HE-SK by MALDI-TOF mass spectrometry. Peaks corresponding to various protonated HE-SK species are marked. The two peaks with the molecular weights of 12,092 and 21, 043 represent the mono-protonated HE and SK species, respectively. This indicates the presence of low levels of non-crosslinked HE-SK in the purified HE-SK preparation.

Fig. 5 shows the biological activities of purified HE-SK. Figure 5A shows a staphylokinase activity determination. Plasminogen (1 u. M) and SAK (5 nM) or HE-SK (5 nM) were incubated at 37°C. At different time points, samples were collected and assayed for plasmin activity. Closed square and open circle represent the plasminogen activation activities of SAK and HE-SK, respectively. Figure 5B shows a hirudin activity determination as reflected by the inhibition of thrombin activity. Thrombin activity was determined in the presence of increasing concentration of hirudin [open circle with a solid line] or HE in HE-SK (before [closed triangle with a dash line] and after [closed square with a dash line] the disulfide bond reshuffling). The data in both panels A and B represent the mean values ( SD) of three independent experiments.

Fig. 6 shows a quantification and inhibition of clot-bound thrombin activity. Fibrin clots were formed by adding increasing amounts (expressed in terms of thrombin concentration in the clot formation process) of thrombin. Figure 6A shows the activity of clot-bound thrombin. The clots were either washed extensively with HBS (open circle) or remained

unwashed (closed circle). Thrombin activity was then determined. Figure 6B shows the inhibition of clot-bound thrombin activities. Clot-bound thrombin activities from washed clots were determined in the presence of hirudin (closed triangle), HE-SK (closed square) or in the presence of HBS (control, open circle). Figure 6C shows the correlation between the amounts of thrombin activities inhibited by either hirudin (open triangle) or HE-SK (closed square) and the amounts of thrombin used in the clot formation process. The data presented in each panel represent the mean value ( SD) of three independent experiments.

Fig. 7 shows the correlation between the clot lysis effect mediated by HE-SK and the thrombin concentrations used in the clot formation process. Clot lysis was mediated by either 75 nM SAK (closed square) or 75 nM HE-SK (closed circle).

Fig. 8 shows a fibrin-clot lysis mediated by various thrombolytic agents. SAK alone, SAK with hirudin (S+H) and HE-SK were used in this study in the absence (Figure 8A) and presence (Figure 8B) of fibrinogen (4 mg/ml). The concentration of both the thrombolytic agents and hirudin is 75 nM.

Fig. 9 demonstrates plasma-clot lysis mediated by various thrombolytic agents. Stability of the plasma clot (closed diamond) was monitored with the addition of plasma in the absence of any externally added thromoblytic agents. Other plasma clots are lysed in the presence of 7,200 nM SAK alone (open triangle), 600nM HE-SK (open circle), 1,200 nM SAK with 600 nM hirudin (closed square). A set of representative results out of three independent experiments is presented here.

DETAILED DESCRIPTION OF THE INVENTION The present invention provides for an engineered thrombolytic agent comprising a combination of an N-terminus dependent plasminogen activator and an N-terminus dependent thrombin inhibitor. The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, microbiology, recombinant DNA, and immunology. Such techniques are explained fully in the literature. See, for example, Molecular Cloning A Laboratory Manual, 2nd Ed. , ed. by Sambrook, J. et al. (Cold Spring Harbor Laboratory Press (1989) ); DNA Cloning, Volumes I and II (D. N. Glover ed.,

1985); Oligonucleotide Synthesis (M. J. Gait ed. (1984) ) ; Mullis et al U. S. Pat. No. 4,683, 195; Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. (1984) ) ; Bacillus subtilis and Other Gram-Positive Bacteria: Biochemistry, Physiology and Molecular Genetics (Sonenshein, A et al. , American Society for Microbiology, Washington, D. C. (1993) ) ; Genetic Manipulation of Streptomyces : a Laboratory Manual (Hopwood, D. et al. , Eds. , John hmes Foundation, Norwich, England (1985) ) ; the treatise, Methods In Enzymology (Academic Press, Inc. , N. Y. ) ; hnmunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds. , Academic Press, London (1987) ) ; and Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds. (1986)).

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those herein can be used in the practice or testing of the present invention, the preferred methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated by reference. In addition, the materials, methods and examples are illustrative only and not intended to be limiting.

The term"plasminogen activator"means a naturally occurring, recombinant or synthetic protein which converts plasminogen to plasmin, either by an enzymatic mode of action or by formation of a complex with plasminogen.

The term"thrombin inhibitor"means a naturally occurring, recombinant or synthetic protein which prevents clot formation by inhibiting the activity of the serine protease thrombin.

The term"anticoagulant"includes thrombin inhibitors but may also include proteins which prevent clot formation through another mode of action.

The term"staphylokinase"or"SAK"means a protein having a sequence of 136 amino acids which is secreted by numerous strains of ap/nococcM aureus, and its variants or derivatives. It converts plasminogen (Pg), the inactive proenzyme of the fibrinolytic system, into its proteolytic form plasmin, which causes liquefaction of fibrin and dissolution or lysis of a thrombus (blood clot). Unlike the two mammalian plasminogen activators, tPA and urokinase, staphylokinase does not act as an enzyme but instead converts plasminogen by formation of a stoichiometric complex. This mode of action is shared with another bacterial plasminogen

activator, streptokinase. However, staphylokinase is a much smaller molecule than is streptokinase (136 amino acids versus 414 amino acids). "Recombinant SAK" (rSAK) as used herein refers to SAK that is isolated as expressed from a recombinant cell, e. g. , a microbial cell, e. g., a B. subtilis cell, or in a eukaryotic cell such as a yeast or an insect cell, which cell is transformed with a vector bearing a gene that encodes, for example, an SAK or SAK variant protein.

The term"hirudin"means an anticoagulant peptide that occurs naturally in the salivary glands of the medical leech Hirudo mediciraalis, and its variants. Its anticoagulant activity comes from the chemical ability to inhibit thrombin. As used herein, "hirudin"may refer to both natural and recombinant forms of the peptide.

The term"thrombus"means a clot formed in the circulation of the cardiovascular system from blood constituents which contains fibrin, and includes without limitation a clot located in any tissue or organ such as heart, brain, vein, artery, and lung.

The term"fibrin"means the product of fibrinogen produced by action of thrombin during the clotting or coagulation of blood, and found in blood clots.

The phrase"dissolution"or"lysis"or"dissolving"of a thrombus refers to a reduction in size of a thrombus, or its elimination from a subject.

The term"subject"means an animal in need of therapy for, or susceptible to, a condition of thrombosis or its sequelae such as myocardial infarction, which condition is remediable or alleviated through dissolution or lysis of a thrombus. Preferably, the animal is a mammal, such as a human or a non-human mammal such as a dog, cat, pig, cow, sheep, goat, horse, rat, or mouse. Most preferably, the animal is a human. The term"subject"does not exclude an individual that is normal in all respects. The subject may be a candidate for future treatment by clot lysis, having formerly been treated surgically or by therapy with an agent that dissolves clots, and may be under treatment with such an agent.

The term"patient"means a human subject who has presented at a clinical setting with a particular symptom or symptoms suggesting the need for treatment with a thrombolytic agent.

The term includes a human subject whose symptoms can be indicative of thrombotic conditions (in at least one anatomical site), such as myocardial infarction (heart), venous thrombosis (vein),

pulmonary embolism (lung), cerebral thrombosis (brain), graft thrombosis (implanted graft), and arterial thrombosis (artery), e. g. coronary thrombosis (coronary artery). The term includes a human subject whose diagnosis alters during the course of disease progression, such as by development of further disease symptoms, or remission of the disease, either spontaneously or during the course of a therapeutic regimen or treatment.

The term"variant"means a protein or nucleic acid molecule that is substantially similar in structure and biological activity to another protein or nucleic acid, and may substitute for the molecule of which it is a variant. Thus, provided that the molecule possesses an activity common with the other and may substitute for the other, it is considered a variant even if the composition or secondary, tertiary or quaternary structure of the molecule is not identical to that of the other, or if the amino acid or nucleotide sequence is not identical to that of the other.

The term"fragment"refers to a portion of a native or variant bacterial protein, such as the SAK protein or the nucleotide sequence encoding that protein. The term"fragment"includes a chemically synthesized protein or nucleic acid fragment, for example, of SAK or the gene encoding SAK.

The tenn"effective dose"means that amount of a composition including a plaminogen activator and an anticoagulant that is provided to achieve a therapeutic effect, such as dissolution of a thrombus or reduction in size of a thrombus.

The terms"protein","polypeptide"and"peptide"are used interchangeably herein.

In one embodiment, the present invention combines staphylolcinase and hirudin as a heterodimer with a dimerization domain fused to the C-terminal end of each component. Staphylokinase is a representative of plasminogen activators which require a free N-terminus for biological activity.

Hirudin is representative of anticoagulants which require a free N-terminus for biological activity. Whether a particular plasminogen activator or a particular anticoagulant requires a free N-terminus for biological activity may be known in the art. If not, it may be determined by fusing a peptide to the N-terminal end of the molecule and assaying for biological activity by means of plasminogen activation assays, thrombin inhibition assays or clot lysis assays described herein and in Szarka et al. (24). A"free N-terminus"includes the amino terminal end of the

native protein or one that is created by a natural process or a directed process.

Fibrinolysis is the process of degrading a thrombus or clot through proteolytic cleavage of its fibrin meshwork. The key activity of a proteolytic enzyme on a protease precursor (zymogen) in this process is that of Pg conversion to plasmin (Pn), whose function is specifically modulated by protein-protein interactions with inhibitors, e. g., a2-antiplasmin, and activators, e. g. , the endogenous tissue Pg activator (t-PA), the bacterial agents SAK or streptokinase and others. In normal physiology, the biologically and medically important interaction is that between Pg-Pn and the indirect Pg activator SAK. SAK converts Pg (without cleavage) into a catalytically efficient Pg activator. At least three functional steps in this process are known: SAK forms a tight stable activator complex with Pg or Pn ; SAK generates or unmasks the latent active site in Pg creating a'virgin enzyme' (Pg*) ; and SAK modifies the substrate specificity of* or Pn so that the complex can cleave Pg molecules.

The Applicants have previously demonstrated that fusion of proteins to the C-terminal end of staphylokinase does not affect the staphylokinase activity [24]. The C-terminal region of hirudin is known to bind to the thrombin cleft (also known as the anion-binding exosite) mainly through electrostatic interactions. With the presence of a flexible linker sequence, the addition of a dimerization domain to hirudin at the C-terminal end should have a minimal effect on hirudin activity. C-terminal hirudin fusions have been constructed in the prior art and all are known to retain biological activity [33,37].

The dimerization domain may comprise engineered coiled coil sequences (also commonly known as a leucine zipper) which are described in the literature [20] and may include any coiled coil sequence that can form a heterodimeric structure. In one embodiment, the Applicants have created modified coil sequences to serve as the dimerization domain. These coil sequences are designated herein as"K coil"and"E coil".

K coil and E coil each comprise heptad repeats. The seven residues occupy positions"a'9 to"g"in a helical coiled coil sequence, as shown in Figure 1B. Preferably, at least three heptad repeats are used, which should result in successful dimerization. More preferably, at least five heptad repeats are used, for the formation of stable dimers [38]. The amino acids in the heptad repeats are chosen for their ability to form a coiled coil and for their ability to heterodimerize.

Dimerization may be facilitated by choosing oppositely charged amino acids for each coiled coil.

For example, one coil may include positively charged residues such as lysine or arginine, while the other coil may include negatively charged residues such as glutamate or aspartate. In one embodiment, the heptad repeats comprise a bulky hydrophobic amino acid in positions"a"and "d", such as valine, leucine, isoleucine, phenylalanine, tryptophan or methionine. In a preferred embodiment, the heptad repeats have the sequence VSALKQK (SEQ ID NO: 1) for K coil and VSALEQE (SEQ ID NO: 2) for E coil. In this embodiment, position"f'of each coil is occupied by glutamine (Q), which is a polar amino acid and has a strong preference towards forming an a- helical structure. In the case of K coil, lysine residues are at the adjacent positions"e"and"g" (Fig. 1B). In E coil, glutamate residues occupy the equivalent positions. With this arrangement, the E coil sequence is negatively charged with a calculated pI of 3.29 and the K coil sequence is positively charged with a theoretical pI of 10. 61. Since the pI for SAK and hirudin are 7. 74 and 4.04, respectively, SAK in combination with K coil will be positively charged and hirudin in combination with E coil will be negatively charged at physiological pH. These engineered molecules can be purified using ion-exchange chromatography, as is known in the art. In one embodiment, once the proper heterodimer is formed, it can be locked in the heterodimeric state via formation of a covalent disulfide bond. To this end, it is preferred that one heptad repeat in each of K coil and E coil include a cysteine residue in an appropriate position. In one embodiment, position"d"in the first helical turn of each coiled coil is occupied by cysteine.

To ensure that each protein domain can fold independently, a hydrophilic, flexible linker of 20 amino acids ([GSTSG] 3SGSPG) (SEQ ID NO: 3) is inserted between staphylokinase andK coil (Fig. 1A). Since hirudin is much smaller than staphylokinase, a shorter 15 amino-acid linker ( [STSGG12STSPG) (SEQ ID NO: 4) may be inserted between hirudin and E coil.

As is apparent, proteins other than the proteins described above and in the Examples, which comprise a plasminogen activator, a linker and a dimerization domain, can be made.

Likewise9 proteins other than the proteins described above and in the Examples, which comprise thrombin inhibitor, a linker and a dimerization domain, can be made. These other proteins are intended to be included herein.

Genes, Nucleic Acids, and Expression Vectors

Homologs of SAK proteins can be generated by mutagenesis, for example, by a point mutation causing a substitution or a deletion. For instance, a mutation can give rise to a homolog which retains substantially the same biological activity of the SAK from which it was derived. A protein is considered to be an SAK homolog if it has SAK biological activity (if it can bind and activate Pg).

"Homology"refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each of two sequences, which may be aligned for purposes of comparison. When a position in the compared sequences is occupied by the same base or amino acid, then the molecules are homologous or identical at that position. The degree of homology between sequences is a function of the number of matching or identical positions shared by the sequences.

In one embodiment, the invention includes nucleic acids which encode first and second peptides wherein the first peptide comprises staphylokinase and a first dimerization domain and the second peptide comprises hirudin and a second dimerization domain. In one embodiment, the first dimerization domain comprises K coil as described above and the second dimerization domain comprises E coil as described above. The first peptide may have the amino acid sequence of amino acids 30-221 of SEQ ID NO : 14. The second peptide may have the amino acid sequence of amino acids 30-144 of SEQ ID NO : 16.

Preferred nucleic acids encode a protein comprising an amino acid sequence at least 60% homologous, more preferably 70% homologous and most preferably 80%, 90%, or 95% homologous with the amino acid sequences referred to above. Nucleic acids which encode polypeptides having an activity of subject SAK and hirudin proteins and having at least about 90%, more preferably at least about 95%, and most preferably at least about 98% homology with the amino acid sequences referred to above are within the scope of the invention.

The term"vector"as used herein refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. The term"expression vector"includes any vector, (e. g., a plasmid, cosmid or phage chromosome) containing a gene construct in a form suitable for expression by a cell (e. g. , linked to a promoter). Expression vectors are capable of directing the expression of genes to which they are operatively linked. Expression vectors for expression of a gene and capable of replication in a cell of a bacterium, such as an Escherichia, a Bacillus, a

Streptomyces, a Streptococcus, or in a cell of a simple eukaryotic organism such as the yeast Saccharomyces or Pichia, or in a cell of a eukaryotic multicellular organism such as an insect, a bird, a mammal, or a plant, are within the preferred embodiments of the present invention. Such vectors may carry functional replication-specifying sequences (replicons) both for a host for expression, for example a Streptomyces, and for a host, for example, E. coli, for genetic manipulations and vector construction. See e. g. U. S. Pat. No. 4,745, 056. Suitable vectors for a variety of organisms are described in Ausubel, F. et al., Short Protocols in Molecular Biology, Wiley, New York (1995), and for example, for Pichia, can be obtained from Invitrogen (Carlsbad, Calif.).

Useful expression control sequences, include, for example, the early and late promoters of SV40, adenovirus or cytomegalovirus immediate early promoter, the lac system, the trp system, the TAC or TRC system, T7 promoter whose expression is directed by T7 RNA polymerase, the major operator and promoter regions of phage lambda, the control regions for fd coat protein, the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase, e. g., Pho5, the promoters of the yeast. a-mating factors, the polyhedron promoter of the baculovirus system, sucrose inducible system (sacB based promoter system with appropriate regulatory sequence), xylose induction system and gluconate induction system, and the constitutively expressed promoter system P43 isolated from B. subtilis, and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof. A useful translational enhancer sequence is described in U. S. Pat.

No. 4,820, 639.

It should be understood that the design of the expression vector may depend on such factors as the choice of the host cell to be transformed and/or the type of protein desired to be expressed. hi one embodiment, the expression vector includes a recombinant gene encoding a peptide as described above.

Such expression vectors can be used to transfect cells and thereby produce proteins or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein. These procedures are well known to those skilled in the art.

Pharmaceutical Compositions and Dosages

As used herein, "pharmaceutically acceptable carrier"includes any and all solvents, dispersion media, e. g. , human albumin or cross-linked gelatin polypeptides, coatings, antibacterial and antifungal agents, isotonic, e. g. , sodium chloride or sodium glutamate, and absorption delaying agents, and the like that are physiologically compatible. The use of such media and agents for pharmaceutically active substances is well known in the art. Preferably, the carrier is suitable for oral, intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e. g. , by injection or infusion). Depending on the route of administration, the active compound can be coated in a material to protect the compound from the action of acids and other natural conditions that can inactivate the compound.

The phrases"parenteral administration"and"administered parenterally"as used herein mean modes of administration other than oral and topical administration, usually by bolus injection or infusion, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion.

Dosage regimens are adjusted to provide the optimum desired response, e. g. , a therapeutic response, such as dissolution of a clot. For example, a single bolus can be administered, several divided doses can be administered over time or the dose can be proportionally reduced and administered over a time period by infusion, or increased, as indicated by the exigencies of the therapeutic situation.

One of ordinary skill in the art can determine and prescribe the effective amount of the pharmaceutical composition required. For example, one could start doses at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. In general, a suitable daily dose of a composition of the invention will be that amount of the composition which is the lowest dose effective to produce a therapeutic effect. Such an effective dose will generally depend upon the factors described above.

It is preferred that administration be intravenous, intracoronary, intramuscular, intraperitoneal, or subcutaneous.

The thrombolytic agent of the present invention may be modified to reduce the immunogenicity

of the agent. Polyethylene glycol-derivatized variants of SAK have been constructed and shown to reduce their clearance from plasma as a result of lowered immunogenicity (Collen, D. et al., Circulation, 2000 Oct. 10; 102 (15): 1766-72). Such modified agents are within the scope of the claimed invention.

The invention is further illustrated by the following examples, which should not be construed as further limiting the claimed invention.

EXAMPLES Assembly of K coil and E coil sequences The structural genes encoding both K coil and E coil sequences were assembled by using several long synthetic oligonucleotides (Primers 1-4 for K coil and primers 5-8 for E coil) with a PCR-based strategy [22, 23]. For the K coil sequence, portions of the primer 2 sequence are complementary to primers 1 and 3, respectively, and part of the primer 4 sequence is complementary to primer 3. The sequences of primers 1-4 are listed as follows: Primer 1: 5'GGGGATCCCCTGGACAGAAAGTTTCTGCTTGCAAA C AG 3' [SEQ ID NO : 5]; Primer 2: 5'CTTTTTGTTTTAAAGCGCTCACTTTCTGTTTAAGCGCGCTAACT TTCTGTTTGCAAGCAGAAAC 3' [SEQ ID NO: 6]; Primer 3: 5'GTGAGCGCTTTAAAACAAAAAGTGTCAGCACTTAAGCAAAA AGTCTCTGCGCTGAAACAGTAATG 3' [SEQ ID NO : 7]; Primer 4: 5'GGGCATGCGTTAACATTACTGTTTCAGCGCAG 3' [SEQ ID NO: 8].

The assembled sequence encodes a portion of a linker sequence and the entire K coil sequence with a Ba7wlHI site at the 5'end and an HpaI site at the 39 end. This sequence was ligated to HincII digested pUCl9 as a blunt-end fragment to generate pUC19-K coil. The E coil sequence was assembled with a similar approach using four primers to generate a DNA fragment with a SpeI site at the 5'end and a SphI site at the 3'end. The fragment was ligated to HincH cut pUC19 to generate pUC19-E coli via a blunt-end ligation. Sequences of the primers 5-8 are listed as followed.

Primer5: 5'GGACTAGTCCTGGACAGGAAGTTTCTGCTTGCGAA CAG 3' [SEQ ID NO: 9] ; Primer6: 5'CTTCTTGTTCAAGTGCTGAAACTTCTTGTTCTAATGCGCTCACT TCCTGTTCGCAAGCAGAAAC 3' [SEQ ID NO : 10]; Primer7: 5'CAGCACTTGAACAAGAAGTTAGCGCGCTTGAACAAGAAGT GAGCGCATTAGAACAGTAATC 3' [SEQ ID NO : 11] ; Primer 8 : 5'CCGCATGCCCGGGATTACTGTTCTAATGCG3' [SEQ ID NO: 12].

Nucleotide sequences of both the K coil and E coil sequences in pUCl9-K coil and pUCl9-E coil were determined and confirmed to be free of PCR errors.

Construction of B. subtilis expression vectors for SAK-KS coil (St) and Hirudi7l-E coil (HE) production Plasmid pSAK-K coil is the B. subtilis vector for secretory production of staphylokinase-K coil (SK). It is a derivative of the pUB18-SAK-K1 vector [24] which encodes a staphylokinase fusion carrying the kringle 1 domain from human plasminogen. pSAK-K coil was generated by replacing the BamHIlHpaI fragment encoding a portion of the linker sequence and the kringle 1 domain sequence in pUB18-SAK-Kl with the synthetic BamHI/HpaI K coil sequence from pUCl9-K coil.

Plasmid pSAK-K coil comprises the following artificial nucleotide sequence encoding staphylokinase-K coil sequence. The first 87 nucleotides encode the Bacillus subtilis levansucrase signal peptide sequence. Nucleotides 88-495 encode mature staphylokinase.

Nucleotides 496-555 encode the flexible linker sequence. Nucleotides 556-663 encode the synthetic K coil sequence which is an engineered coiled coil sequence rich in lysine.

Nucleotides 664-666 are the translation termination codon.

1 atgaacatca aaaagtttgc aaaacaagca acagtattaa cctttactac cgcactgctg 61 gcaggaggcg caactcaagc ttttgcctcg agctcattcg acaaaggaaa atataaaaaa 121 ggcgatgacg cgagttattt tgaaccaaca ggcccgtatt tgatggtaaa tgtgactgga 181 gttgatggta aaagaaatga attgctatcc cctcgttatg tcgagtttcc tattaaacct 241 gggactacac ttacaaaaga aaaaattgaa tactatgtcg aatgggcatt agatgcgaca 301 gcatataaag agtttagagt agttgaatta gatccaagcg caaagatcga agtcacttat 361 tatgataaga ataagaaaaa agaagaaacg aagtctttcc ctataacaga aaaaggtttt 421 gttgtcccag atttatcaga gcatattaaa aaccctggat tcaacttaat tacaaaggtt 481 gttatagaaa agaaaggaag tacttctggt gggtcgacaa gtggtggatc tactagtggc

541 tctggatccc ctggacagaa agtttctgct tgcaaacaga aagttagcgc gcttaaacag 601 aaagtgagcg ctttaaaaca aaaagtgtca gcacttaagc aaaaagtctc tgcgctgaaa 661 cagtaa [SEQ ID NO: 13] The nucleotide sequence SEQ ID NO: 13 codes for a polypeptide having the following amino acid sequence: 1 MNIKKFAKQA TVLTFTTALL AGGATQAFAS SSFDKGKYKK 41 GDDASYFEPT GPYLMVNVTG VDGKRNELLS PRYVEFPIKP 81 GTTLTKEKIE YYVEWALDAT AYKEFRVVEL DPSAKIEVTY 121 YDKNKKKEET KSFPITEKGF VVPDLSEHIK NPGFNLITKV 161 VIEKKGSTSG GSTSGGSTSG SGSPGQKVSA CKQKVSALKQ 201 KVSALKQKVS ALKQKVSALK Q [SEQ ID NO: 14] Plasmid pHirudin-E coil is the B. subtilis vector for secretory production of hirudin-E coil (HE) and is a derivative of pUB18-Hirudin-SAK [24] which produces a hirudin fusion with SAK at the C-tenninal end. To construct pHirudin-E coil, the sak sequence (as a SpeIlSphI fragment) in pUB 18-Hirudin-SAK was replaced by a SpeIlSphI fragment encoding a portion of the linker sequence and the entire E coil sequence.

Plasmid pHirudin-Ecoil comprises the following synthetic construct nucleotide sequence which is a 451-nucleotide BsaBl/SphI fragment.

1 gatgaacatc aaaaagtttg caaaacaagc aacagtatta acctttacta ccgcactgct 61 ggcaggaggc gcaactcaag cttttgccgt tgtatacacc gactgtactg aatccggaca 121 aaacctgtgt ttgtgtgagg gttctaacgt ctgtggtcag ggtaacaaat gcatcctggg 181 ttccgacggt gaaaagaacc aatgtgtcac tggtgaaggt accccaaagc cgcagtccca 241 caacgatgga gatttcgaag aaatcccaga agaatatctg cagagtactt ctggtgggtc 301 gacaagtggt ggatctacta gtcctggaca ggaagtttct gcttgcgaac aggaagtgag 361 cgcattagaa caagaagttt cagcacttga acaagaagtt agcgcgcttg aacaagaagt 421 gagcgcatta gaacagtaat cccgggcatg c [SEQ ID NO: 15] Nucleotides 2-88 encode the Bacillus subtilis levansucrase signal peptide sequence (amino acids 1-29). Nucleotides 89-283 encode hirudin (amino acids 30-94). Nucleotides 284-328 encode the flexible linkage (amino acids 95-109). Nucleotides 329-436 encode the synthetic E-coil sequence. Nucelotides 437-439 are the translation termination codon.

The nucleotide sequence SEQ ID NO: 15 codes for a polypeptide having the following amino acid sequence: 1 MNIKKFAKQA TVLTFTTALL AGGATQAFAV VYTDCTESGQ 41 NLCLCEGSNV CGQGNKCILG SDGEKNQCVT GEGTPKPQSH

81 NDGDFEEIPE EYLQSTSGGS TSGGSTSPGQ EVSACEQEVS 121 ALEQEVSALE QEVSALEQEVS ALEQ [SEQ ID NO: 16] Expression in B. subtilis Each of the pSAK-K coil and pHirudin-E coil plasmids was transformed into three extracellular protease deficient B. subtilis strains for expression studies. WB600 [25], WB700 [26] and WB800 [27] are strains deficient in 6,7 and 8 extracellular proteases, respectively.

Transformed cells were cultivated in superrich medium (without glucose) (28) containing 10 ug/ml kanamycin at 37°C and samples were collected at different time points. After normalization for cell density, culture supernatants were analyzed by SDS-PAGE under reducing or non-reducing conditions. Since all the expression vectors in this study are derivatives of pUB18 (29), WB600 [pUB18] was used as the negative control.

Purification of HE, SK and HE-SK For HE purification, 50 ml of WB800 [pHirudin-E-coil] culture supernatant was collected by centrifugation and dialyzed against 4 liters of 17 mM potassium phosphate buffer (pH 6.0) at 4°C overnight. The dialyzed sample was applied to a DE52 (Whatman, England) column (15x1. 5 cm) equilibrated with the same buffer. After washing the column until the absorbance at 280 nm was less than 0.02, HE was eluted using a 150 ml linear gradient (0-0.7 M NaCl) in the same buffer. The HE-containing fractions (0.25-0. 35 M NaCI) were combined and dialyzed. The sample was concentrated in 0. 1M NaHC03 buffer (pH8.3) containing 0.05 M NaCI to a final volume of 200-300 RI using a Centricon unit. The concentrated sample was then loaded onto a Bio-Prep SE 100/17 column and eluted with 12 ml 0. 1M NaHCO3 buffer (pH 8.3) containing 0.05 M NaCl buffer at a flow rate of 0.4 ml/min. Fractions containing HE were pooled and concentrated by ultrafiltration.

To purify HE-SK, 50 ml of culture supernatant was collected, dialyzed and applied to a DE52 column. HE-SK was separated with a linear salt gradient of 0-0.5 M NaCI (in 150 ml) and the HE-SK containing fractions (0.1-0. 15 M NaCI) were further purified by gel filtration.

For SK purification, 50 ml of culture supernatant was collected, dialyzed against 4 liters of 17 mM potassium phosphate buffer (pH 7.0) at 4°C overnight and applied to a Macro-Prep High S column (Bio-Rad, 5x1. 5 cm) previously equilibrated with the same buffer. After washing

the column until A280 was less than 0. 1, SK was eluted from the column with a linear salt gradient (0-1.0 M NaCI in 100 ml of the same buffer). SK monomer-containing fractions (0.4-0. 5 M of NaCl) were further purified by gel filtration as described above in 0.1 M sodium phosphate buffer (pH 5.8) containing 0.1 M NaCl.

Purified HE, SK and HE-SK were quantified spectrophotometrically at 280 nm using molar extinction coefficients of 3,400 M-1cm-1, 17, 330 M~lom~and 20,730 M-lcrri (30), respectively.

Disulfide-bond reshuffling The disulfide-bond reshuffling of HE or HE-SK was performed using the method described by Chang [21] with modification. Briefly, each protein sample was dialyzed and concentrated to a final concentration of 50-70 u, M in 0.1 M NaHCO3 buffer (pH 8.3) in the absence of any extra salt, to minimize dimer formation. The reshuffling process proceeded at 4°C overnight in a microcentrifuge tube by adding cysteine (cys) and cystine (cys-cys) to final concentrations of 4 mM and 2 mM, respectively. The efficiency of the reshuffling process was determined by non-reducing SDS-PAGE and Western blotting. <BR> <BR> <BR> <BR> <BR> <BR> <P>Matrix-assisted laser desorption ionization-time of fliglzt (MALDI-TOF) rrzass spectrometry Protein mass spectrometry analyses were performed at the Southern Alberta Mass Spectrometry (SAMS) Proteomics Research Centre, University of Calgary. Purified and concentrated samples were applied to a Voyager-DE STR MALDI-TOF mass spectrometer (ABI) using sinapic acid as the matrix. Whole protein spectra were recorded in a linear mode and bovine serum albumin was used as the calibration marker.

Quantification of clot-bound thrombin Cross-linlced fibrin clots were prepared by adding human thrombin (Sigma Canada, Oakville, Ontario) at final concentrations from 0.1 to 2 NTH units/ml to 4 mg/ml human fibrinogen (Sigma) in HEPES-buffered saline (HBS, 0.02 M HEPES, 0.13 M NaCl ; pH 7.4) containing 20 mM CaCl2 at room temperature. Immediately after mixing, 100 ul of the polymerizing solution was transferred to a microtiter plate (Falcon 35-3912, Becton Dickinson, N. J. ). The clots were formed at room temperature for 2 hours. Two sets of clots were formed. The first set of fibrin clots was washed with 100 ul of HBS followed by careful removal of the

washing buffer. This step was repeated 5 times until no thrombin activity in the wash buffer was detected. The second set of clots was unwashed and used as the control to determine the ratio of thrombin incorporated into the fibrin clot. 100 Ill of 560 pM thrombin specific chromogenic substrate (N-p-Tosyl-Gly-Pro-Arg p-nitroanilide, Sigma) was then added to each well and the color development was monitored over a 1 0-min period at 37°C in the kinetic mode at 405 nm using a Ceres model UV900 plate reader (Bio-Tek instruments Inc., Winooski, VT). Thrombin activity (Fig. 6A) was expressed as the initial rate of color development (mOD/min).

Throfnbin inhibition assays These assays were performed under two different conditions with hirudin and its derivatives (HE and HE-SK) as the inhibitors. The first series was performed with thrombin freely in solution while the second series was determined with clot-bound thrombin. For assays under the first condition (Fig 5B), increasing amounts of hirudin and its derivatives (final concentrations from 0 to 30 nM) were incubated with thrombin (final concentration: 1 NIH unit/ml) at room temperature in HBS containing 0.2 mg/ml BSA. The reaction was started by the addition of 50 ul of 560 I1M thrombin specific chromogenic substrate to the thrombin/hirudin mixture (50 p1). Thrombin activity was determined as described above. IC50 values of hirudin and its derivatives were then determined (Fig. 5B). To monitor the inhibition of the clot-bound thrombin activity by hirudin and its derivatives, each washed fibrin clot was incubated with 100 1 of either HBS or inhibitors (75 nM). After incubation at room temperature for 1 hr, liquid was carefully removed without disturbing the clot, and the clot was then washed with HBS to remove any unbound inhibitors. Finally, chromogenic substrate was added to each clot and the rate of color development (at 405 nm) was measured.

The activity of the non-inhibited clot-bound thrombin was plotted over the thrombin concentrations used to form the clot (Fig. 6B). The amount of clot-bound thrombin inhibited by the inhibitor was determined as the differences of thrombin activities between the clots treated with the inhibitor and the clots treated with HBS (Fig. 6C).

Clot lysis assays

In a first clot lysis assay, washed fibrin clots with different amounts of clot-bound thrombin were prepared according to the above-mentioned conditions. Each clot was treated with 100 111 of 75 nM SAK or HE-SK for 1 hr. The solution was then removed by pipetting. Each clot was washed once with HBS to remove any unbound thrombolytic agent. Clot lysis was initiated by the addition of 100 ul of 1 aM plasminogen in HBS. The lysis process was monitored using the microtiter plate reader until the turbidity of the clot reached the minimal value. The extent of clot lysis expressed as the percentage of the original clot turbidity was plotted over the lysis time (minutes). Tso% for clot lysis, which represented the time required to achieve a 50% lysis of the fibrin clot, was obtained from the graphs. The Tso% values for the clots with different amounts of thrombin incorporated inside were then plotted over the thrombin concentration used in forming the clot to determine the thrombin effects on the clot lysis mediated by HE-SK (Fig. 7).

In the second and third assays, fibrin clots (formed in the presence of 0. 8 NIH unit/ml of thrombin) were generated as described above and the assays were all performed at room temperature. In the second clot lysis assays, clot lysis was initiated by the addition of 100 of a freshly prepared thrombolytic solution (75 nM SAK or HE-SK + 1 uM plasminogen).

The clot lysis process was monitored for 1 hr. After this incubation, liquid (~ 100 Ill) was carefully removed, and 100 ul of a 1 uM plasminogen solution was layered on each clot.

Upon returning the microtiter plate to the reader, the subsequent clot lysis process was monitored. The third fibrin clot lysis assays were identical to the second one except that all the plasminogen containing solution used in this set of assays also contained 4 mg/ml fibrinogen.

Plasnza clot 1)) sis assays Cross-linked plasma clots were prepared using freshly prepared, citrated platelet-poor human plasma pooled from healthy donors. Once prepared, plasma was aliquote and stored at- 20°C until use. Clotting was initiated by adding human thrombin to 0. 8 NIH unit/ml (final concentration) and CaCl2 to 20 mM (final concentration) at room temperature. Immediately after mixing, 50 pl of the polymerizing plasma was transferred to microtiter plate. The clots were formed at room temperature for 2 hours. Clot lysis was performed by adding 50 ul of

plasma containing freshly added thrombolytic agent (600 nM HE-SK, 7,200 nM SAK or 1,200 nM SAK plus 600 nM hirudin) on each clot. The clot lysis process was monitored.

After 1-hour incubation, liquid (plasma with unbound thrombolytic agent and thrombin) on top of the clot was removed and the same amount of plasma was added to the clot. One plasma clot was incubated with 50 ul of plasma as the control to monitor the stability of the plasma clot during the assay period. The T50% values were used to compare the clot lysis potencies of each agent.

Other Methods Purification of plasminogen and specific activity determination of SAK, SK and HE-SK were performed as described by Szarka et al. [24]. Properties of both staphylokinase and hirudin specific polyclonal antibodies used in this study were also described by Szarka et al. [24].

Recombinant protein production yield was measured using the quantitative Western blot method as described previously [31]. DNA sequencing was performed at the DNA Sequencing laboratory, University Core DNA & Protein Services, University of Calgary. In the fibrin-clot lysis studies with different thrombolytic agents (i. e. SAK vs HE-SK), the T50% values were subject to the Student's t-test for statistical significance analysis. A probability value of 5% was regarded as being significant. <BR> <BR> <BR> <BR> <BR> <BR> <P>Effects of different protease deficient strains on. SAK-K coil and Hirudin-E coil production Secretion of both SAK-K coil and hirudin-E coil are directed by the B. subtilis levansucrase signal peptide sequence. A strong and constitutively expressed promoter P43 is used to drive transcription. Analyses of culture supernatants from six (WB600), seven (WB700) and eight (WB800) extracellular-protease deficient strains harboring either pSAK-K coil or pHirudin-E coil indicated that SAK-K coil and hirudin-E coil could be produced via secretion (Fig. 2).

The identity of each fusion was confirmed by Western blot studies with SAK and hirudin specific polyclonal antibodies, respectively. Production of both SAK-K coil and hirudin-E coil reached peak levels in a time window of 6 to 8 hours after inoculation (data not shown).

The calculated molecular weight of hirudin-E coil is 12, 080 and a diffused protein band which was not present in the negative control WB600 [pUB 18] was observed in the culture supernatant of WB600, WB700 and WB800 carrying the pHirudin-E coil plasmid (Figs. 2A

and 2B). This band showed an apparent molecular weight of 21,500. Since engineered proteins carrying flexible linkers (such as single-chain antibody fragments) always show larger apparent molecular weights from SDS-PAGE, the apparent molecular weight of hirudin-E coil in the range of 21,500 is not unexpected. All three protease deficient strains could produce hirudin-E coil with the same apparent molecular weight and with comparable production yields (Figs. 2A and 2B). In contrast, SAK-K coil produced from WB600 [pSAK- K coil] and WB700 [pSAK-K coil] showed an apparent molecular weight (20,000) that was different from the one (28,000) produced from WB800 [pSAK-K coil] (Figs. 2C and 2D).

Although the calculated molecular weight for SAK-K coil is 21,029, our data suggest that SAK-K coil with an apparent molecular weight of 28,000 from WB800 [pSAK-K coil] is the intact form of SAK-K coil. Western blot studies support this suggestion since the presence of multiple bands of SAK-K coil in the range from 20-28 kDa was observed only from the culture supernatants of WB600 [pSAK-K coil] and WB700 [pSAK-K coil] (Fig. 2D). Our data illustrate the importance of using WB800 for the production of intact SAK-K coil. Since WB800 differs from WB700 by the inactivation of a wall bound protease, WprA [27,39], this protease, either directly or indirectly, accounts for the observed degradation of SAK-K coil.

Staphylokinase by itself is resistant to the residual proteases from WB600 and WB700 [40].

Judging from the observed ladder of degraded SAK-K coil and their molecular masses, the major cleavage sites are mainly located within the K coil sequence. Since the K coil sequence is almost identical to the E coil sequence with the exception that lysine rather than glutamate is located at positions"e"and"g"of the coiled coil sequence, the residual protease (s) in WB600 and WB700 that mediate (s) the cleavage is (are) suggested to have a preference to cut after a lysine residue.

Purificatioiz, quantification and mass spectrometry of hirudin-E coil and staphylokinase-K coil Hirudm-E coil was purified to homogeneity from the culture supernatant of WB800 [pHirudin-E coil] using a two-step purification scheme : a DE-52 cellulose column and a BioRad Bio-Prep SE 100/17 gel filtration column (Fig. 3A, lane 1). Staphylokinase-K coil was also purified to homogeneity (Fig. 3A, lane 2) using a similar approach (a MacroS column and a BioRad Bio-Prep SE100/17 column). Interestingly, staphylokinase-K coil was found to be well resolved into two peaks in the cation exchange column. One was eluted at a lower salt concentration (0. 4-0. 5M NaCl) and the other was at a higher salt concentration

(0.6-0. 7M NaCI). Analysis of these samples by SDS-PAGE under reducing and non-reducing conditions demonstrated that the form which eluted under the lower salt condition was the monomeric staphylokinase-K coil while the other form was the homodimer of staphylokinase-K coil (data not shown). Although the purified hirudin-E coil sample seemed to be relatively pure in a Coomassie blue stained SDS-polyacrylamide gel, the presence of homodimeric hirudin-E coil in this sample could only be observed via the Western blot study (Fig. 3B). In fact, hirudin-E coil stained very poorly in SDS-polyacrylamide gel. Since Coomassie blue is reported to bind preferentially to arginine and aromatic residues in proteins [41], the low content of these residues in hirudin-E coil provides an explanation for this observation. By using known amounts of purified hirudin-E coil and SAK-K coil to generate standard curves for these proteins in quantitative Western blot studies, the production yields of hirudin-E coil and SAK-K coil in the culture supernatant before purification were estimated to be 20 mg/liter (1.66 I1M) and 99 mg/liter (4. 7 uM), respectively. Since there is a significant discrepancy between the calculated and the apparent molecular masses of hirudin- E coil and SAK-K coil, purified samples were analyzed by MALDI-TOF mass spectrometry.

By using BSA as the reference, monomeric hirudin-E coil and SAK-K coil showed molecular weights of 12,083 and 21,046, respectively (data not shown, also see Fig. 4D). These values matched closely with the predicted values (12,080 for hirudin-E coil and 21,029 for SAK-K coil).

Production, purification and mass spectrometry of heterodifrzeric hirudin-E coil and SAK-K coil (HE-SK) Complicated by the presence of homodimers, a co-cultivation method was developed to produce heterodimeric HE-SK by adjusting the initial inoculation density of WB800 [pHirudin-E coil] and WB800 [pSAK-K coil] at different ratios (1: 1,2 : 1 and 5: 1).

The best production yield of HE-SK heterodimer could be accomplished using the 2: 1 ratio (data not shown). This observation was consistent with the measurement that HE and SK were individually produced at a level of 1.66 and 4. 7 mus respectively. Since HE-SK has a calculated pI of 5.15, this protein was purified to homogeneity using a two-step purification scheme (a DE52-cellulose column and a gel filtration column). The secretory production yield of HE-SK under the co-cultivation condition was estimated to be 50 mg/liter (1.51 1M).

Although the apparent molecular mass of HE-SK in SDS-PAGE was 43 kDa (Fig. 4A), mass spectrometric analysis (MALDI-TOF) showed that the mono-protonated HE-SK molecule

had a molecular weight of 33,122 (Fig. 4D) which agreed very well with the theoretical prediction (33,091). The result also supported the idea that a disulfide bridge was formed between the heterodimeric coiled coil sequences to make HE-SK a single entity. Low levels of heterodimeric HE-SK that did not form the disulfide bond in the coiled-coil region were also observed from the MALTI-TOF mass spectrogram.

Biological activities of SK and HE Using purified monomeric SK for the plasminogen activation assay, the data confirmed that indeed staphylokinase-K coil showed identical specific activity as the free staphylokinase (Fig. 5A). Incontrast, theICso of hirudin-E coil (13.5 nM) for thrombin inhibition is 2.5 times higher than that (5.2 nM) of hirudin. Therefore, the thrombin inhibitory effect of hirudin in hirudin-E coil is lower than that of non-fused hirudin (Fig. 5B).

Reshuffling of disuylde bonds in hirudin-E coil and HE-SK B. subtilis has been shown to produce biologically active secretory proteins with disulfide bonds such as TEM-B-lactamase and single-chain antibody fragments [27,31, 42]. These proteins have either one or two pairs of disulfide bonds and the cysteine residues involved in disulfide bond formation are arranged in a sequential manner (i. e. the first cysteine in the sequence pairs with the second and the third cysteine pairs with the fourth). In the case of hirudin, there are three pairs of disulfide bonds and the cysteine residues that form the disulfide bonds are not arranged in a sequential manner (i. e. Cys6-Cysl4, Cysl6-Cys28, Cys22-Cys39). When the purified hirudin-E coil sample was analyzed by Western blotting (Fig. 3B), three bands were observed under the non-reducing condition for SDS-PAGE. The 40-kDa band corresponded to the homodimer of hirudin-E coil while the two bands with the molecular masses of 21 and 23 kDa were the monomeric hirudin-E coil (Fig. 3B, lane 1). In contrast, under the reducing condition, all forms of hirudin-E coil migrated as a single band with the apparent molecular mass of 24-kDa (Fig. 3B, lane 4) using molecular weight markers for Western blotting as the reference. These data indicated that not all the hirudin-E coil molecules produced from B. subtilis had the correct pairing of disulfide bridges. The fast migrating 21-kDa band was likely to be the properly folded form as it had the most compact structure reflected by its fast migration. The slower migrating band corresponded to hirudin- E coil with either partial disulfide bond formation or incorrectly paired disulfide bonds.

Hirudin-E coil without any disulfide bond formation (under the reducing condition) migrated

slowest since it was in a fully-extended configuration. Since staphylokinase-K coil does not contain any intramolecular disulfide bonds, it showed the same mobility in SDS-PAGE under both reducing and non-reducing conditions (Fig. 3A, lane 2 vs lane 5). To overcome the problem associated with the mispairing of disulfide bonds in hirudin-E coil, purified hirudin- E coil was allowed to reshuffle its disulfide bonds in the presence of 4 mM cysteine and 2 mM cystine. After this treatment, both the monomeric and dimeric hirudin-E coil molecules were in a more compact structure and migrated faster. As shown in Fig. 3B (lane 2), the majority of monomeric hirduin-E coil showed an apparent molecular mass of 21 kDa.

Thrombin inhibition assays (Fig. 5B) indicated that reshuffled hirudin-E coil showed an activity comparable to hirudin. The IC50 of hirudin and the reshuffled hirudin-E coil were 5.2 and 5.5 nM, respectively. Purified HE-SK also showed a faster migration after the reshuffling treatment (Fig. 3C). Before reshuffling, the ICso of hirudin in HE-SK was 22 nM (Fig. 5B). After reshuffling, the IC50 value decreased to 5.6 nM. SAK in the HE-SK heterodimer also showed activity comparable to staphylokinase (data not shown). In this study, the inefficiency of the B. subtilis expression system in producing secretory proteins with complicated disulfide bond profiles is clearly illustrated. A similar observation for the production of misfolded human pancreatic alpha-amylase which also has a complicated disulfide bond profile has also been reported [43]. However, in the present study, an in vitro disulfide bond reshuffling protocol is provided as a simple and effective solution to overcome this problem. In this protocol, no disulfide isomerase or disulfide oxido-reductase is needed.

Generation of thrombin-rich fibrin clots There is plenty of evidence supporting the idea that freshly formed blood clots are rich in thrombin [44,45]. Thrombin binds to fibrin directly through an interaction at its anion- binding exosite [46]. With time, thrombin that is bound to or trapped within blood clots will leak out and the thrombin content in an aged clot will gradually decrease. Therefore, the clot bound thrombin would potentially serve as an interesting marker to differentiate a freshly formed clot from an aged clot [47]. For AMI patients, the pathologic thrombi are freshly formed and therefore should be thrombin rich. In contrast, a physiological haemostatic plug that has been formed for a while should be thrombin poor. Consequently, HE-SK should be able to differentiate these two different types of clots. To determine whether the hirudin domain in HE-SK can serve as a targeting agent to direct HE-SK to fibrin clots in proportion to their thrombin content, one has to first determine whether fibrin clots formed in the

presence of higher levels of thrombin can trap more thrombin or not. Fibrin clots were formed in a final volume of 100 al with different levels of thrombin (the final concentration of thrombin ranged from 0.05 to 2 NIH units/ml). Two sets of fibrin clots were generated.

One set was washed with HBS to remove any unbound thrombin while the other set was not washed. Thrombin activity was then determined using a thrombin specific chromogenic substrate. Within the range tested, the amounts of thrombin trapped in washed fibrin clots were proportional to the amounts of thrombin added during the clot formation process (Fig.

6A). In comparison with the unwashed clots, thrombin activity retained in each washed clot was about 79.5 4.2% of the total input thrombin activity.

Inhibition of clot-boufzd thrombin activity by hirudin and HE-SK Washed fibrin clots formed in the presence of different amounts of thrombin were used in this study. 100 1ll of 75 nM hirudin or HE-SK was layered on top of each clot which occupied a volume of 100 ul. The mixtures were incubated for 60 min. The concentration of hirudin or HE-SK at a final concentration of 75 nM was selected in this study because the clinical doses of SAK used in thrombolysis [48] are usually 5-15 mg/patient (64-192 nM in circulation).

After several extensive washes to remove any unbound hirudin or HE-SK, thrombin activity within these fibrin clots was determined. When fibrin clots were formed with low doses of thrombin (up to 1.2 NIH units/ml), both hirudin and HE-SK were equally effective and 92% of the clot bound thrombin activity was inhibited (Fig. 6B). For fibrin clots formed in the presence of higher levels (1.3-2 NIH units/ml) of thrombin, hirudin was slightly more effective than HE-SK in inhibition of clot bound thrombin. This is probably because of the smaller size of hirudin (i. e. 6.97 kDa vs 33 kDa for HE-SK) so that it can diffuse more easily into the interior of the clot. With clots formed in the presence of thrombin at a final concentration of 2 NIH units/ml, HE-SK could still inhibit 84% of the clot bound thrombin activity. When the differences of the thrombin activities between the clots treated with the thrombin inhibitors (hirudin or lIE-SE4) and the clots treated with HBS (control) were plotted over the thrombin concentration used in forming the clot, it clearly showed a thrombin dose dependent inhibition mediated by both hirudin and HE-SK (Fig. 6C). Therefore, a fibrin clot with higher levels of clot bound thrombin would bind higher levels of HE-SK.

Lysis of thro77lbin-rich clots with HE-SK Since HE-SK can be targeted to fibrin clots depending on the level of the clot-bound

thrombin, we determined whether a fibrin clot with higher levels of clot-bound thrombin can be lysed faster. To address this question, an in vitro clot lysis assay was established. Two series of fibrin clots were formed in the presence of different amounts of thrombin. After washing to remove any unbound thrombin, one set of clots was incubated with HE-SK (100 al at a concentration of 75 nM). The second set of clots was incubated with staphylokinase (same concentration as HE-SK). After one hour of incubation, unbound thrombolytic agents (i. e. HE-SK and SAK) were removed by washing the clots with HBS. A 100-1ll plasminogen solution (1 (J. M, physiological concentration) was then added to initiate the clot lysis event.

The clot lysis process was monitored by the reduction of the clot turbidity with time. This assay was designed to examine the clot lysis effect of the clot bound HE-SK. The removal of the unbound thrombolytic agents was designed with the objective to account for the short in vivo half life (3-10 minutes) of SAK in human [49]. As shown in Fig. 7, it took SAK 250 minutes to achieve a 50% clot lysis (Tsooo) and the T5o% values remained fairly constant for the different clots formed with different thrombin concentrations. Interestingly, the T50% values for clot lysis mediated by HE-SK indeed decreased as the amounts of thrombin used in <BR> <BR> <BR> <BR> clot formation (i. e. the amounts of clot-bound thrombin) increased. T50% values reached the lowest value of-100 min and remained constant at that level when the thrombin concentrations used in clot formation was 0.8 NIH unit/ml or higher. The inability to observe a faster clot lysis when the thrombin concentration used in clot formation was higher than 0.8 NIH unit/ml was likely because of the inability of plasminogen (92 kDa) to penetrate into fibrin clots which have small pores. Various studies including electron microscopy [50,51] have demonstrated that fibrin clots formed in the presence of low concentration of thrombin consist of thick fibers with large pores. With high concentrations of thrombin, the fibrin clots have much thinner fibers and these fibers form a network with very small pores. Therefore, even though more HE-SK (33 kDa) can be trapped inside the clots in proportion to the amounts of fibrin-bound thrombin, those HE-SK molecules located in the interior of the clot would not be able to activate plasminogen. This is simply because plasminogen is too big to diffuse into the interior of the clot as illustrated by the superficial accumulation of plasminogen only on the clot surface in a confocal microscopic study [52]. Therefore, it is logical to predict that HE-SK would be able to lyse the freshly formed pathologic thrombi more efficiently than the fibrin clots formed under in vitro conditions. Pathologic thrombi are formed in the presence of plasminogen so that some plasminogen molecules will be trapped in or bound to the thrombi. In contrast, the interior of the fibrin clots formed under the in

vitro conditions with purified fibrinogen and thrombin is essentially plasminogen free. Based on this in vitro study, it is important to recognize that HE-SK indeed can promote clot lysis in proportion to the amounts of the clot-bound thrombin up to a certain level.

HE-SK lyzes thrombin-rich clots faster than SAK SAK by itself has no ability to bind to the fibrin clot directly unless it forms a SAK- plasmin (ogen) complex. Both plasmin and plasminogen have fibrin binding capability via the kringle domains within these molecules [53]. Under physiological conditions, plasminogen molecules are present in the circulation when staphylokinase is infused into the patient.

Therefore, the above-mentioned clot lysis assay may underestimate the potency of staphylokinase in clot lysis since only SAK molecules that have been physically trapped inside the clot via diffusion would be able to mediate the clot lysis event under the assay condition. To overcome this problem, a second in vitro clot lysis assay was established.

Fibrin clots were formed in the presence of thrombin at a final concentration of 0.8 NIH units/ml in an ELISA plate. These clots were then washed and incubated with either SAK or HE-SK in the presence of plasminogen for one hour. Solution containing unbound thrombolytic agents (100 1li) was removed from each well. Since these clots were quite fragile, they were not washed. Plasminogen (1 I1M, 100 jj. l) was then added to each well to continue the clot lysis event. The change in clot turbidity including the first hour incubation with thrombolytic agents in the presence of plasminogen was then monitored. Under this assay condition, the T50% values for SAK and HE-SK were 192 i 3 min and 152 A 2.3 min, respectively (Fig. 8A). This represents a 21% reduction of Tso% for HE-SK. Statistical analysis of these values by the Student's t test indicated that the difference observed for these values was significant (t =18.543, df (degree of freedom) = 4, p<0.05). The larger T50% value for HE-SK under this assay condition reflected the removal of some of the clot-bound HE-SK molecules during the washing step because of the partial clot lysis in the presence of both HE- SK and plasminogen during the first hour of pre-incubation.

Effects of clot targeting and aiiticoagulant activities ofHE-SK on clot lysis In addition to the clot targeting ability, HE-SK should have an anticoagulant effect. To examine the effect of anticoagulant activity in HE-SK, a third in vitro clot lysis assay was developed. In this assay, fibrin clots formed in the presence of 0.8 NIH units/ml of thrombin were washed to remove the unbound thrombin. Thrombolytic agents (SAK or HE-SK) in the

presence of both plasminogen and fibrinogen were added to the washed fibrin clots and incubated for one hour. Any solution containing unbound thrombolytic agents, plasminogen and fibrinogen was then removed and replaced with 100 1 of HBS containing both plasminogen (1 pM) and fibrinogen (4 mg/ml). The change in clot turbidity including the first hour incubation with thrombolytic agents was monitored. Interestingly, the preformed fibrin clot increased in size as reflected by an increase in turbidity during the initial phase of incubation with SAK, plasminogen and fibrinogen (Fig. 8B). This observation indicated that the clot formation process was even faster than the clot lysis process. In a later stage, clot lysis became dominant. In contrast, the growth of the preformed clot was not as dramatic when HE-SK was used as the thrombolytic agent. In this assay, the T50% values for SAK and HE-SK were 242 5 min and 168 i 5 min, respectively (Fig. 8B). The difference in these values was statistically significant (t =18.088, df = 4, p<0.05). The longer time required for 50% clot lysis in this assay reflected the simultaneous occurrence of both clot formation and clot lysis events. hi comparison to the T50% value of SAK, T50% for HE-SK showed a reduction by 30%. To illustrate the importance of the hirudin mediated clot targeting effect in HE-SK for improved clot lysis, a control experiment was performed by adding SAK and hirudin together with plasminogen and fibrinogen to the preformed fibrin clot during the first- hour incubation. In the presence of hirudin, the growth of the preformed fibrin clot under this condition could also be suppressed. However, without the covalent linkage of hirudin to SAK, it took a longer time (two% = 200 min) for free SAK to lyse the fibrin clot (Fig. 8B).

HE-SK Iyzed plasma clot much better tha7 SAK To examine the potency of HE-SK in clot lysis under the conditions that are more relevant to physiological conditions, a plasma clot assay was applied to monitor the effectiveness of HE- SK in clot lysis. This is important because plasma contains various factors such as plasminogen, fibrinogen, prothrombin, 2-antiplamin and other factors that may influenze both the clot formation and clot lysis events. Under this condition, thrombin (0.8 NIH unit/ml) was added to plasma to induce the clot formation. The clots were washed with HBS and then resuspended in plasma containing either SAK or HE-SK with a 1-hour incubation.

The plasma containing unbound thrombolytic-agents was then removed and replaced with 50 1 plasma. Changes in clot turbidity were monitored including the first hour of incubation with thrombolytic agents. In this assay, the concentration of each thrombolytic agent was adjusted to give a Tso% of-120 minutes. The difference in the concentration of these

thrombolytic agents required to reach such a clot lysis rate was compared. This method for comparison was used because SAK at a final concentration of 600 nM (even up to 1,200 nM) failed to show any measurable clot lysis while HE-SK worked effectively at this concentration. As shown in Fig. 9, when the washed plasma clot was placed in plasma without any added thrombolytic agent, the turbidity of the washed plasma clot increased gradually within the first 120 minutes. The growth of the clot was expected to be mediated by thrombin bound to the surface of the clot. No clot lysis was observed as expected. The addition of SAK to plasma greatly stimulated the growth of the plasma clot within the first 60-min incubation. To achieve a Tso% value of 160 minutes, SAK at a final concentration of 7,200 nM was required. The drastic growth of the plasma clot at the initial stage can be contributed by several factors. Not only thrombin bound to the surface of the clot can promote clot growth, but thrombin buried inside the clot can be re-exposed during the fibrinolytic event mediated by SAK [54]. It has been well established that with excess plasmin generation in plasma, plasmin can generate more thrombin from prothrombin via three different mechanisms [55]. Plasmin can activate factor XII to factor XIIa which can then activate kallikrein from prokallikrein [56]. Both factor XIIa and kallikrein are involved in the initial phase of the intrinsic coagulation pathway that leads to thrombin generation.

Furthermore, plasmin can also activate factor V which is one of the key components in the prothrombinase complex which mediates the conversion of prothrombin to thrombin [57].

Lastly, plasmin has been shown to increase the activity of the factor VEa/IXa complex [58].

All these mechanisms lead to more thrombin generation in plasma. With a low dose of SAK, no systemic activation of plasmin resulted. However, under the experimental conditions used in this study, 7,200 nM staphylokinase can induce systemic plasminogen activation since the physiological concentration of human plasminogen is 1-2 I1M and the a2-antiplasmin concentration is only about half of the concentration of plaminongen [59]. With more thrombin generation in plasma, thrombin can activate factor SIII which mediates the crosslinking between fibrin chains and the covalent immobilization of re2-antiplasmin to fibrin [60]. A thrombin-activatable fibrinolysis inhibitor (TAFI) which is a plasma carboxypeptidase that selectively removes C-terminal lysine residues from fibrin [61] can also be activated. This will reduce the binding of both plasmin (ogen) and SAK-plamsin (ogen) complex to fibrin since these molecules bind to fibrin via the interactions between the kringle domains of plasmin (ogen) and the C-tenninal lysine residues in fibrin generated during fiblinolysis. All these factors will make the plasma clots more resistant to fibrinolysis and

can account for the requirement of SAK at high concentration for effective plasma clot lysis within 160 minutes.

In contrast to the SAK mediated plasma clot lysis, HE-SK mediated clot lysis did not show any significant growth of the plasma clot. Furthermore, the concentration (600 nM) of HE- SK required to achieve a Two of 120 min was 12 times lower than that for SAK. These data illustrated the dramatic effect of HE-SK in preventing clot growth and promoting clot lysis.

This is the result of the combination of both the clot targeting effect and thrombin inhibition effect of hirudin. For the clot lysis event mediated by SAK in the presence of 600 nM hirudin, although no rapid growth of plasma clot could be observed, the SAK concentration required to generate a T50% of 122 minute was 1,200 nM, which is two times higher than that of HE-SK.

Various attempts to introduce antithrombotic activity to staphylokinase have been reported [24, 62,63] including our systematic generation of both staphylokinase-hirudin and hirudin- staphylokinase. However, all these reported structures are in the linear fusion format. Therefore, HE-SK described here represents the first successfully engineered bifunctional thrombolytic agent that truly possesses both fibrinolytic and antithrombotic activities that are comparable to their parent molecules. The clot targeting capability, the potential to minimize reocclusion and the efficient clot lysis make HE-SK a very promising agent for the treatment of AMI.

As will be apparent to those skilled in the art, various modifications, adaptations and variations of the foregoing specific disclosure can be made without departing from the scope of the invention claimed herein. The various features and elements of the described invention may be combined in a manner different from the combinations described or claimed herein, without departing from the scope of the invention.

REFERENCES : 1. The International Study Group (1990) Lafaeet 3369 71-75 2. Ohman, E. M., Harrington, R. A. , Cannon, C. P. , Agnelli, G., Cairns, J. A. , and Kennedy, J. W. (2001) Chest 1199 253S-277S 3. The GUSTO investigators (1993) N. Engl. JMed. 329, 673-682

4. Jang, I. K. , Gold, H. K. , Ziskind, A. A., Fallon, J. T. , Holt, R. E. , Leinbach, R. C. , May, J. W. , and Collen, D. (1989) Circulation 79,920-928 5. Eccleston, D. and Topol, E. J. (1995) Coron. Artery Dis. 6,947-955 6. Yasuda, T. , Gold, H. K. , Yaoita, H. , Leinbach, R. C. , Guerrero, J. L. , Jang, I. K. , Holt, R. , Fallon, J. T. , and Collen, D. (1990) J. Am. Coll. Cardiol. 16,714-722 7. Yasuda, T. , Gold, H. K. , Leinbach, R. C. , Saito, T. , Guerrero, J. L. , Jang, I. K. , Holt, R., Fallon, J. T. , and Collen, D. (1990) J. Am. Coll. Cardiol. 16, 1728-1735 8. ISIS-3 (Third International Study of Infarct Survival) Collaborative Group. (1992) Lancet 339,753-770 9. The GUSTO investigators (1993) N. Engl. J. Med. 329,673-682 10. Collen, D. (1998) Nat. Med. 4,279-284 11. Vanderschueren, S. , Barrios, L. , Kerdsinchai, P. , Van den Heuvel, P., Hermans, L. , Vrolix, M. , De Man, F., Benit, E., Muyldermans, L. , Collen, D. , et, and al (1995) Circulation 929 2044-2049 12. Vanderschueren, S. , Dens, J. , Kerdsinchai, P. , Desmet, W. , Vrolix, M. , De Man, F., Van den Heuvel, P. , Hermans, L. , Collen, D. , and Van de Werf, F. (1997) Am. Heart J. 134, 213-219 13. Heymans, S. , Vanderschueren, S., Verhaeghe, R. , Stockx, L. , Lacroix, H. , Nevelsteen, A. , Laroche, Y. , and Collen, D. (2000) Thromb. Haemost. 83,666-671 14. Silence, K. , Collen, D. , and Lijnen, H. R. (1993) Blood 82,1175-1183 15. Sakharov, D. V. , Lijnen, H. R. , and Rijken, D. C. (1996) J. Biol. Chem. 271,27912- 27918 16. Lijnen, H. R. , Van Hoef, B. , Vanderbossche, L. , and Collen, D. (1992) Fibrinolysis 6, 214-225 17. Dodt, J., Kohler, S. , and Baici, A. (1988) FEBS Lett. 229, 87-90 18. Witting, J. I., Brezniak, D. V., Hayes, J. R., and Fenton, J. W. (1991) Thromb. Res. 63, 473-479 19. Lazar, J. B., Winant, R. C., and Johnson9 P. H. (1991) J. Biol. Chem. 266,. 685-688 20. Tripet, B., Yu, L., Bautista, D. L., Wong9 W. Y., Irvin, R. T. , and Hodges, R. S. (1996) Protein Eng. 9, 1029-1042 21. Chang, J. Y. (1994) Biochem. J 300, 643-650 22. Sandhu, G. S. , Aleff, R. A. , and Kline, B. C. (1992) BioTechniques 12,14-16

23. Wu, S. -C., Hassan, Q. M. , and Wong, S. -L. (2002) Protein Expr. Purif. 24,348-356 24. Szarka, S. , Sihota, E. , Habibi, H. R. , and Wong, S. -L. (1999) Appl. Environ. Microbiol.

65,506-513 25. Wu, X. -C., Lee, W. , Tran, L. , and Wong, S. -L. (1991) J. Bacteriol. 173,4952-4958 26. Ye, R. , Yang, L. P., and Wong, S. -L. (1996) Proc. International symposium on Recent Advances in Bioindustry 160-169 27. Wu, S. -C., Yeung, J. C. , Duan, Y. , Ye, R. , Szarka, S. J. , Habibi, H. R. , and Wong, S.-L.

(2002) Appl. Environ. Microbiol. 68, 3261-3269 28. Halling, S. M., Sanchez-Anzaldo, F. J. , Fukuda, R., Doi, R. H. , and Meares, C. F.

(1977) Biochemistry 16,2880-2884 29. Wang, L. -F. and Doi, R. H. (1987) Mol. Gen. Genet. 207, 114-119 30. Gill, S. C. and Von Hippel, P. H. (1989) Anal. Biochem. 182, 319-326 31. Wu, S. -C., Ye, R. , Wu, X.-C., Ng, S. -C. , and Wong, S.-L. (1998) J. Bacteriol. 1$09 2830-2835 32. Wallace, A. , Dennis, S. , Hofsteenge, J. , and Stone, S. R. (1989) Biochemistry 23, 10079-10084 33. Wirsching, F., Opitz, T. , Dietrich, R. , and Schwienhorst, A. (1997) Gene 204,177-184 34. Rydel, T. J. , Tulinsky, A. , Bode, W. , and Huber, R. (1991) J. Mol. Biol. 221,583-601 35. Betz, A. , Hofsteenge, J. , and Stone, S. R. (1992) Biochemistry 31,4557-4562 36. Schlott, B. , Guhrs, K. H., Hartmann, M. , Rocker, A. , and Collen, D. (1998) J. Biol. Chem. 273,22346-22350 37. Syed, S. , Schuyler, P. D., Kulczycky, M. , and Sheffield, W. P. (1997) Blood 89, 3243- 3252 38. Hodges, R. S. (1996) Bioche7n. Cell Biol. 74, 133-154 39. Margot, P. and Karamata, D. (1996) Microbiology-Uk. 1429 3437-3444 40. Ye, R., Kim, J. H., Kim, B. G., Szarka, S., Sihota, S. , and Wong, S. -L. (1999) Biotechiiol. Bioeng. 62, 87-96 41. Compton, S. J. and Jones, C. G. (1985) Anal. Biochem. 151, 369-374 42. Wong, S.-L., Kawamura, F. , and Doi, R. H. (1986) J. Bacteriol. 16$, 1005-1009 43. Bolhuis, A. , Tjalsma, H. , Smith, H. E. , De Jong, A. , Meima, R. , Venema, G. , Bron, S., and Van Dijl, J. M. (1999) Appl. Environ. Microbiol. 65,2934-2941

44. Francis, C. W. , Markham, R. E. , Jr. , Barlow, G. H. , Florack, T. M. , Dobrzynski, D. M., and Marder, V. J. (1983) J. Lab Clirz. Med. 102,220-230 45. Kumar, R. , Beguin, S. , andHemker, H. C. (1994) Thromb. Haemost. 72,713-721 46. Fenton, J. W. , Olson, T. A. , Zabinski, M. P. , and Wilner, G. D. (1988) Biochemistry 27, 7106-7112 47. Yang, W. P. , Goldstein, J. , Procyk, R. , Matsueda, G. R. , and Shaw, S. Y. (1994) Biochemistry 33,2306-2312 48. Collen, D. and Van de Werf, F. (1993) Circulation 87, 1850-1853 49. Collen, D., Sinnaeve, P. , Demarsin, E. , Moreau, H. , De Maeyer, M. , Jespers, L., Laroche, Y. , and van de, W. F. (2000) Circulation 102,1766-1772 50. Behr, T. M. , Sharkey, R. M. , Sgouros, G. , Blumenthal, R. D. , Dunn, R. M., Kolbert, K. , Griffiths, G. L. , Siegel, J. A. , Becker, W. S. , and Goldenberg, D. M. (1997) Cancer 80, 2591-2610 51. Collet, J. P. , Park, D. , Lesty, C. , Soria, J. , Soria, C. , Montalescot, G. , and Weisel, J. W.

(2000) Arterioscler. Thromb. Vasc. Biol. 20, 1354-1361 52. Sakharov, D. V. and Rijken, D. C. (1995) Circulation 92, 1883-1890 53. Morris, J. P. and Castellino, F. J. (1983) Biochinz. Bioplzys. Acta 744,99-104 54. Rapold, H. J. , de Bono, D., Arnold, A. E., Arnout, J. , De Cock, F. , Collen, D. , and Verstraete, M. (1992) Circulation 85,928-934 55. Hoffineister, H. M. , Szabo, S. , Helber, U. , and Seipel, L. (2001) Thromb. Res. 103, S51- S55 56. Ewald, G. A. and Eisenberg, P. R. (1995) Circulation 91,28-36 57. Lee, C. D. and Mann, K. G. (1989) Blood 73,185-190 58. Eisenberg, P. R., Miletich, J. P. , and Sobel, B. E. (1991) Fibrirtolysis 5, 217-224 59. Booth, N. A. (1999) Baillieres Best. Pract. Res. Clin. Haematol. 12, 423-433 60. Lee, K. N., Lee, C. S., Tae9 W. C. , Jackson, K. W., Christiansen, V. J., and McKee, P.

A. (2001) An7z Acad. Sci. 9369 335-339 61. Bajzar, L. (2000) Arterioscler. Thromb. Tzasc. Bol. 20, 2511-2518 62. van Zyl, W. B. , Pretorius, G. H. , Lamprecht, S. , Roodt, J. P. , and Kotze, H. F. (2000) Thromb. Res. 93, 435-443 63. Wirsching, F. , Luge, C. , and Schwienhorst, A. (2002) Mol. Ge} let. Metab 75, 250-259