The invention relates to the use of the microRNA particles and microRNA antagomirs in medicine, especially in prevention and treatment of the autoimmune diseases, in particular for multiple sclerosis.

MikroRNA (miRNA) are recently described group of short, noncoding RNA particles, that play important role in regulation of the classical genes expression. So far, a little is known about the their role in the process of the autoimmune demyelination.

Multiple sclerosis (MS) is a autoimmune disease signified by the chronic inflammatory demyelination of the central nervous system (CNS). CD4+ T cell-mediated autoimmunity, with a critical role of a putative myelin autoantigen, has long been accepted as one of the most important aspects of MS pathogenesis, especially for the early initiation of disease (Sospedra M & Martin R (2005) Immunology of multiple sclerosis. Annu Rev Immunol 23:683-747). This has been particularly complemented by the research on the MS animal model, experimental autoimmune encephalomyelitis (EAE). T helper type 1 (Thl) cells, characterized by the expression of the transcription factor T-bet and production of interferon- gamma (IFNg), have been originally considered the major effector T helper cells that mediate the pathogenesis of autoimmune demyelination (Hafler DA (2004) Multiple sclerosis. J Clin Invest 113(6):788-794). More recently another subset of helper T cells, Thl 7, characterized by expression of the transcription factors retinoic acid receptor- related orphan receptor alpha and gamma t (ROR-alpha and ROR-yt) and production of interleukin (IL)-17, has been considered as pivotal for the propagation of autoimmune demyelination (Bettelli E, Korn T, Oukka M, & Kuchroo VK (2008) Induction and effector functions of T(H)17 cells. Nature 453(7198): 1051-1057). Mice with impaired numbers or function of Thl 7 cells, particularly mice deficient in the cytokines IL-6 or IL-23, are largely resistant to EAE (Eugster HP, Frei K, Kopf M, Lassmann H, & Fontana A (1998) IL-6-deficient mice resist myelin oligodendrocyte glycoprotein-induced autoimmune encephalomyelitis. Eur J Immunol 28(7):2178-2187; Bettelli E, et al. (2006) Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature 441(7090):235-238; Cua DJ, et al. (2003) Interleukin-23 rather than interleukin- 12 is the critical cytokine for autoimmune inflammation of the brain. Nature 421(6924):744-748). However, precise mechanisms governing the development and function of Thl 7 cells resulting in autoimmune demyelination are still unclear. Thus Thl7-targeting therapeutic approaches for MS have not yet been established.

MicroRNAs (miRNA) have begun to emerge as an important component in the differentiation and function of cells involved in the immune response. MiRNAs operate as non-coding RNA molecules of ~22 nucleotides in length that are processed from larger transcripts of non- classical genes by Drosha and Dicer nucleases (Xiao C & Rajewsky K (2009) MicroRNA control in the immune system: basic principles. Cell 136(l):26-36). MiRNA are incorporated along with core argonaute proteins into the RNA-induced silencing complex. Binding of this complex to the products of classical genes in mammalian cells leads to direct or indirect interference, thus resulting in lower protein expression (Jinek M & Doudna JA (2009) A three-dimensional view of the molecular machinery of RNA interference. Nature 457(7228):405-412). It has been estimated that expression of as many as one third of the classical genes may be regulated by miRNA (Selbach M, et al. (2008) Widespread changes in protein synthesis induced by microRNAs. Nature 455(7209):58-63). Recently, emerging data has documented the importance of miRNA in EAE development. MiR-326 (Du C, et al. (2009) MicroRNA miR-326 regulates TH-17 differentiation and is associated with the pathogenesis of multiple sclerosis. Nat Immunol 10(12): 1252-1259) and miR-155 (O'Connell RM, et al. (2010) MicroRNA- 155 promotes autoimmune inflammation by enhancing inflammatory T cell development. Immunity 33(4):607-619) modulate T cell and dendritic cell function, whereas miR-124 (Ponomarev ED, Veremeyko T, Barteneva N, Krichevsky AM, & Weiner HL (2010) MicroRNA- 124 promotes microglia quiescence and suppresses EAE by deactivating macrophages via the C/EBP-alpha-PU.1 pathway. Nat Med) controls quiescence of the CNS resident antigen presenting cell (APC) population, microglia. Moreover, methods for inhibiting the activity of micro-RNA in vivo are already tested. So far best studied miRNA manipulation option is the use of the chemically modified oligonucleotides, called "antagomirs", that describe anti-microRNA oligonucleotides, AMO. Antagomir is described in medical literature by plural form to describe a multitude of the microRNA targets, that could be numerous, but defining the spectrum of the action of microRNA. Antagomirs discovery has been related to the analysis of the heart diseases. They have been demonstrated to act as efficient, specific and safe in vivo and in vitro silencers of endogenous miRNAs (Krutzfeldt J, et al. (2005) Silencing of microRNAs in vivo with ^• antagomirs ^* . Nature 438(7068):685-689; Krutzfeldt J, et al. (2007) Specificity, duplex degradation and subcellular localization of antagomirs. Nucleic Acids Res 35(9):2885-2892). Thus microRNA targeted therapies have become an option for treatment of autoimmune demyelination. The use of antagomirs in the anti-cancer therapies were also mentioned in the review publication Cieplucha A. et al., Acta Haematologica Polonica 2007, 38, Nr 4, str. 425- 435.

The aim of this invention is to provide new tools, that would be suited for the use in the diagnostics, prevention and treatment of multiple sclerosis.

The object of the present invention is a microRNA particle, that contains a sequences selected from: hsa-mir-21:

UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCA GUCGAUGGGCUGUCUGACA hsa-mir-155:

CUGUUAAUGCUAAUCGUGAUAGGGGUUUUUGCCUCCAACUGACUCCUACAUAU UAGCAUUAACAG hsa-mir-301a:

ACUGCUAACGAAUGCUCUGACUUUAUUGCACUACUGUACUUUACAGCUAGCAG UGCAAUAGUAUUGUCAAAGCAUCUGAAAGCAGG mmu-miR-21:

UGUACCACCUUGUCGGAUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAU GGCAACAGCAGUCGAUGGGCUGUCUGACAUUUUGGUAUC; mmu-miR-155:

CUGUUAAUGCUAAUUGUGAUAGGGGUUUUGGCCUCUGACUGACUCCUACCUGU UAGCAUUAACAG; mmu-miR-301a:

CCUGCUAACGGCUGCUCUGACUUUAUUGCACUACUGUACUUUACAGCGAGCAG UGCAAUAGUAUUGUCAAAGCAUCCGCGAGCAGG for use in diagnostics of multiple sclerosis.

Another object of the present invention is antagomir against miRNA that enables silencing of the microRNA containing sequences selected from: hsa-mir-21: UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCA GUCGAUGGGCUGUCUGACA hsa-mir-155:

CUGUUAAUGCUAAUCGUGAUAGGGGUUUUUGCCUCCAACUGACUCCUACAUAU UAGCAUUAACAG hsa-mir-301a:

ACUGCUAACGAAUGCUCUGACUUUAUUGCACUACUGUACUUUACAGCUAGCAG UGCAAUAGUAUUGUCAAAGCAUCUGAAAGCAGG mmu-miR-21:

UGUACCACCUUGUCGGAUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAU GGCAACAGCAGUCGAUGGGCUGUCUGACAUUUUGGUAUC; mmu-miR-155:

CUGUUAAUGCUAAUUGUGAUAGGGGUUUUGGCCUCUGACUGACUCCUACCUGU UAGCAUUAACAG; mmu-miR-301a:

CCUGCUAACGGCUGCUCUGACUUUAUUGCACUACUGUACUUUACAGCGAGCAG UGCAAUAGUAUUGUCAAAGCAUCCGCGAGCAGG for use in therapy and prevention of multiple sclerosis.

For the purpose of the present invention antagomir needs to be seen as a chemically generated oligonucleotide. Antagomirs are one of the most recent therapeutic development thanks to chemical synthesis of the oligonucleotides (fragment of the RNA or DNA nucleic acids). They are generated to stimulate, silence endogenous microRNA. They are existing in the form of the small, synthetic RNA, that is perfectly complimentary to the defined microRNA, which is a target of this therapy. Usually antagomirs contain certain modifications, such as 2'metoxy and phosphotioanian groups, that increase degradation resistance.

According to the invention the used sequence should be adapted to the patient, particularly in the case of humans it is preferred to use sequences corresponding to the sequences found in the human genome.

The changes in miRNAs profile in CD4+ T cells during in vitro and in vivo myelin antigen recognition, MOG35-55, were analysed. Unexpectedly it was found, that both in vitro and in vivo, stimulation with myelin antigen led to significant upregulation of the miR-301a, miR-21 and miR-155 presence. Furthermore, these three miRNAs were overexpressed in T cells infiltrating the central nervous system (CNS) in animals with experimental autoimmune encephalomyelitis (EAE). Use of specific miRNA antagonists, antagomirs, revealed that miR- 301a contributed to the development of the T helper 17 (Thl7) subset via targeting of the interleukin 6/23 - Signal Transduced and Activator of Transcription 3 (STAT3) pathway. This appeared to be mediated by the miR-301a effect on the expression of the Protein Inhibitor of Activated STAT3 (PIAS3), a potent inhibitor of the STAT3 pathway. Manipulation of miR-301a levels or PIAS3 expression in myelin specific CD4+ T cells led to significant changes in the severity of EAE. Thus, a previously unknown role of miR-301a in regulation of the function of myelin reactive Thl7 cells has been identified, supporting a role for miR-301a and PIAS3 as candidates for therapeutic targets for controlling of autoimmune demyelination.

Furthermore changes in miRNAs in CD4+ T cells during in vitro and in vivo myelin antigen recognition have been assessed. Unexpectedly it was found that miR-301a, miR-21, and miR- 155 were significantly upregulated in T helper cells in response to myelin oligodendrocyte protein (MOG) antigen. In a series of experiments, a previously unknown role of miR-301a in regulating Thl7 differentiation, as well as its in vivo contribution to the pathogenesis of autoimmune demyelination has been found. The effect of miR-301a on Thl7 cells was mediated by inhibition of Protein Inhibitor of Activated STAT3 (PIAS3), a negative regulator of the Signal Transduced and Activator of Transcription 3 (STAT3) activation pathway.

The present invention has been illustrated by the following examples of use and figures in which:

On Fig. 1. a quantitative analysis of miRNA changes in CD4+ T cells responding to myelin antigen is presented. 3 distinct miRNA have been identified, that were most significantly increased during development of the response to myelin antigen: mmu-miR-21, mmu-miR- 155 and mmu-miR-3 Ola

On Fig. 2. an analysis of expression of miR-21, miR-155 and miR-301a in CNS during EAE is presented. An analysis of the changes in the central nervous system in mice with an animal model of MS confirmed significant increase of the presence of miR-21, miR-155 and miR- 301a during a disease.

On Fig. 3. an antagomir inhibition of miR-21, miR-155 and miR-301a effects on CD4+ T cell function is presented. An the manipulation of miR-21, miR-155 and miR-301a on the development of the autoimmune response by assessing the effect of the in vitro inhibition of these microRNA on the function of the myelin autoreactive Th cells, demonstrated clearly modification of the proinflammatory lymphocytes following microRNA inhibition.

On Fig. 4. an analysis of the role of miR-301 in Th differentiation has been presented.

On Fig. 5. miR-301 a downregulation of PIAS3 in CD4+ T cells has been presented.

On Fig. 6. analysis of in vivo function of miR-301 a and PIAS3 in myelin specific CD4+ T cells on EAE development has been presented.

On Fig. 7 an increased microRNA-301a production in T cells in MS patients following anti-

CD3 stimulation has been presented.

Examples

Example 1

miR-21, miR-155 and miR-301a in MS diagnostics

a) miR-21, miR-155 and miR-301 a are upregulated in T helper cells during the response to the myelin autoantigen.

To identify the changes in miRNA levels during the development of the response to myelin autoantigen in vivo, we immunized C57BL/6 mice with MOG peptide 35-55 (MOG35-55) in Freund's complete adiuvant (CFA). Fourteen days later inguinal and popliteal peripheral lymph nodes (PLN) cells of MOG35-55/CFA or control immunized mice were stimulated in vitro with MOG35-55. Subsequently CD4+ T cells were purified and used as a source of RNA for the microarray analysis of the miRNA expression. The results of miRNA expression profiling highlighted an upregulation in the expression of the three distinct miRNA: miR-21, miR-155 and miR-301 a in the CD4+ T cells of MOG35-55/CFA immunized mice when re- stimulated with MOG35-55 (Fig. 1A). In order to confirm the significance of the observed changes in the miRNA profiling we analyzed extensively analyzed the relative expression levels of miR-21, miR-155 and miR-301 a in PLN of the MOG35-55/CFA immunized mice in comparison to naive mice. Indeed, we saw a significant upregulation of the expression of all three miRNA in MOG35-55 re-stimulated CD4+ T cells, as early as day 4 post immunization (Fig. 1 B). Expression levels reached a maximum around day 14 post antigen challenge, followed by a decline to the initial response levels by day 32 for all of the analyzed miRNAs. The kinetics of miR-21, miR-155 and miR-301 a expression responses in CD4+ T cells following MOG35-55/CFA immunization resembled the changes in the MOG35-55 re- stimulation induced proliferative responses of peripheral lymph nodes, with miR-301 a showing the highest upregulation (Fig. IB). Furthermore, we analyzed the changes in expression in the CD4+ T cells of 2D2 mice that transgenically express TCR alpha and beta chains of a MOG35-55 reactive T cell clone (Bettelli E, et al. (2003)

Myelin oligodendrocyte glycoprotein-specific T cell receptor transgenic mice develop spontaneous autoimmune optic neuritis. J Exp Med 197(9): 1073-1081). MOG35-55-TCR CD4+ T cells displayed a strong upregulation of miR-21, miR-155 and miR-301a expression in response to increasing doses of MOG35-55 antigen (Fig. 1C). We also detected an upregulation of miR-21, miR-155 and miR-301a expressions in naive CD4+ T cell in response to anti-CD3 and anti-CD3/CD28 stimulation (Fig. ID), although this was less robust than following antigenic peptide recognition. Collectively our data indicate that miR-21, miR- 155 and miR-301a are particularly upregulated in response to in vitro TCR stimulation of CD4+ T cells.

This substantiates that miR-21, mir-155 and miR-301a represent a suitable marker for diagnostics of the immune cell reaction toward the myelin antigen recognition as seen inter alia during early stage of MS. For that reason miR-21, mir-155 and miR-301a can be used in MS diagnostics.

b) In the CNS of animals with EAE miR-301a is overexpressed by the infiltrating T cells.

To explore the in vivo significance of the observations on the miRNA changes following in vitro TCR re-stimulation, miR-21, miR-155 and miR-301a expression in animals sensitized to develop EAE was analyzed. The isolated mononuclear cells from the brains (BMN) of animals at different stages of the disease; from day 0 (control), day 12 (pre-clinical), day 27 (acute EAE) and day 60 (EAE remission). As expected, the flow cytometry profiles of the BMN cells confirmed significant increases in T cells during the course of EAE (Fig. 2A). These inflammatory changes were accompanied by a several fold upregulation of miR-21, miR-155 and miR-301a expression (Fig. 2B). The presence of all three microRNAs increased during the acute phase of the disease (up to day 27). MiR-21, miR-155 continued to be highly overexpressed during the late stage of EAE (day 60), whereas mir-301a expression declined during the remission period (Fig. 2B). Thus, miR-301a overexpression within the infiltrating cells may reflect a different role than for miR-21 and miR-155.

EAE inflammatory BMN cells can be divided into several distinct populations: T cells, microglia and active APCs (macrophages and activated microglia). To identify which population was responsible for the observed miRNAs overexpression high purity sorted fractions of each cell population were analyzed for miR-21, miR-155 and miR-301a expression during two different phases of EAE - acute (day 27) and remission (day 60) (Fig. 2 C). The greatest miR-21 and miR-155 changes occurred in the brain T cell fraction and for macrophages and activated microglia (CDl lb+CD45hi), and essentially no changes for the classical microglia (CDl lb+CD45int). MiR-301a expression changes were almost exclusively associated with the brain T cell fraction, most notably during the acute disease phase (Fig. 2C). These in vivo data support a specific upregulation of miR-301a in T cells during acute EAE.

Example 2

Antagomirs for miR-21, miR-155 and miR-301a are suitable for suppression of autoimmune reaction during MS.

a) Mir-301a inhibition downregulates Thl7 responses

To search for a role of miR-21, miR-155 and miR-301a in activated T cells, selective miRNA antagonists, antagomirs were applied. None of the antagomirs impacted the proliferative responses of T cells regardless of whether it was specifically induced by antigen or non- antigen (Fig. 3A and 3B). However, miRNA blockade resulted in significant changes in the cytokine secretion profiles following MOG35-55 stimulation (Fig. 3C-3F). Antagomirs against miR-21 and miR-155 resulted in downregulation of IFNg secretion as well as a minor upregulation of IL-4 secretion. However, most notably, transfection with antagomir against miR-301a resulted in decreased IL-17 secretion, while antagomirs against miR-21 and miR- 155 had no significant impact on this cytokine (Fig. 3 D). In addition, an antagomir against miR-301a resulted in an increase of IL-4 production. IL-10 production levels were largely unaffected by any of the three antagomirs (Fig. 3 E). These data suggest a strong influence of miR-301a on Thl7-like cytokine secretion profile.

To confirm miR-21, miR-155 and miR-301a effect on Th cell profiles, the expression pattern of gene markers of Th cell differentiation has been subsequently analyzed (Fig. 3G). In highly purified CD4+ T cells fluorescently labeled with antagomirs, inhibition of miR-155 led to an increase in Gata3 expression reminiscent of a Th2 shift described in miR-155 deficient mice (Rodriguez A, et al. (2007) Requirement of bic/microRNA-155 for normal immune function. Science 316(5824):608-611) was found. The levels of transcription for Tbx21 and Foxp3 were largely unaffected by the inhibition of any of the studied miRNAs. Most notably, the antagomir against miR-301a treatment resulted in a marked decrease in message for Rora, Rorc-gt, Ahr, IL17A and IU7F indicating a strong influence on Thl7 differentiation (Fig. 3G). The above data suggest a specific involvement of miR-301a in Thl7 cell differentiation and an absence of influence of all studied miRNAs in Thl differentiation. b) In vitro modulation of miR-301a in T cells impacts Thl7 differentiation.

In order to further confirm the relationship between miR-301a and Thl7 cells, the expression levels of this miRNA in different Th cell subsets, Thl, Th2, Thl7, and naive Th cells was compared. Ex-vivo Thl 7 cells expressed miR-301a at very high levels in comparison to the other Th subsets (Fig. 4 A).

In addition, miR-301a expression kinetics during the in vitro differentiation of Thl 7 cells was analyzed. A highly significant upregulation of miR-301a in the Thl7-polarized naive T cells as early as 3 days from the start of differentiation was observed (Fig. 4B). When the miR- 301a expression profiles of the in vitro generated various Th populations were analyzed, miR- 301a was most significantly enriched in the Thl 7 (Fig. 4C). Furthermore, the effect of miR- 301a inhibition on the in vitro development of Thl 7 cells were assessed. Inhibition of miR- 301a in naive CD4+ T cells rendered them 4 fold less sufficient for in vitro generation of Thl 7 cells (Fig. 4D). In addition expression of CCR6, a chemokine receptor linked to a Thl 7 cells phenotype (Reboldi A, et al. (2009) C-C chemokine receptor 6-regulated entry of TH-17 cells into the CNS through the choroid plexus is required for the initiation of EAE. Nat Immunol 10(5):514-523), was downregulated in stimulated naive CD4+ T cells when miR- 301a was blocked by antagomir, and accordingly upregulated by a miR-301a mimic (Fig. 4E). Thus these data strongly suggested that miR-301a promotes differentiation of the Thl 7 subset. c) miR-301a interferes with the IL-6 - STAT3 phosphorylation pathway

Since different signaling pathways contribute to Thl 7 in vitro generation, such as TGFb, IL-6 and IL-23 (3, 5, 18), which of them might be affected by miR-301a was investigated. For the TGFb pathway, in vitro differentiation of naive T cells into Treg cells in the presence of antagomir for miR-301a was investigated and no changes in generation in vitro of Treg cells were found (Fig. 4 F). In IL-6 and IL-23 induced Thl 7 development, STAT3 activation is a critical step AKT (Chen RH, Chang MC, Su YH, Tsai YT, & Kuo ML (1999) Interleukin-6 inhibits transforming growth factor-beta-induced apoptosis through the phosphatidylinositol 3-kinase/Akt and signal transducers and activators of transcription 3 pathways. J Biol Chem 274(33):23013- 23019; Heinrich PC, Behrmann I, Muller-Newen G, Schaper F, & Graeve L (1998) Interleukin-6-type cytokine signalling through the gpl30/Jak/STAT pathway. Biochem J 334 (Pt 2):297-314). STAT3 phosphorylation in CD4+ T cells, in response to either IL-6 or IL-23, was severely impaired in cells with antagomir against miR-301a (Fig. 4 G). In addition to STAT3 phosphorylation, IL-6 activation also results in signaling from two other pathways: STAT1 and phosphoinositide 3-kinase (PI3K)/AKT (21, 22). However, both STAT1 and AKT phosphorylation in CD4+ T cells, following IL-6 stimulation, was unaffected by transfection of antagomir to miR-301a (Fig. 4G). These results suggest an association between miR-301a and IL-6 function in Thl7 differentiation.

To exclude a direct effect of miR-301a on IL-6 receptors or STAT3 levels expression of these genes in CD4+ T cells transfected with antagomir to miR-301a were assessed. No changes in IL-6 receptor alpha (IL6ra) and IL-6 signal transducer, gpl30 (IL6st) or Stat3 message levels in Th cells following inhibition of miR-301a were found (Fig. 4 H). Thus it appears that miR- 301a inhibition impairs IL-6 induced signaling by selective interaction with events leading to STAT3 activation.

d) MiR-301a interferes with intracellular levels of PIAS3.

A bioinformatic databases (MIRANDA, PicTar and TargetScan), to identify possible miR- 301a target molecules in the IL-6 - STAT3 pathway were next searched. 4 recently reported potential targets of miR-301a (Nkrf (23), FoxF2, Bbc3, Pten (Lu Z, et al. (2011) miR-301a as an NF-kappa B activator in pancreatic cancer cells. EMBO J 30(l):57-67), FoxF2, Bbc3 i Pten (Shi W, et al. (2011) MicroRNA-301 mediates proliferation and invasion in human breast cancer. Cancer Res 71(8):2926-2937)) were also analyzed. Of these 13 tested putative target genes, the major increase following miR-301a inhibition was found for Pias3 (Fig. 5 A). MicroRNA target prediction software RNA hybrid (version 2.1; http://bibiserv.techfak.uni-bielefeld.de/rnahybrid/) in concert with a MIRANDA search revealed the presence of two major binding sites for miR-301a within the Pias3 RNA 3 'UTR (Fig. 5B). Thus, Pias3 RNA represents an attractive target for the action of miR-301a. In order to confirm a link between miR-301a and PIAS3 we transfected CD4+ T cells with miR-301a mimics or antagomirs and analyzed the levels of PIAS3 (Fig. 5C). PIAS3 levels were clearly diminished in cells treated with miR-301a mimics, and increased in cells with an miR-301a inhibitor. In contrast, mimics or antagomirs for miR-21 and miR-155 had no impact on PIAS3 levels (Fig. 5 C).

Next using a luciferase reporter system, it was confirmed, that miR-301a directly binds the mRNA encoding Pias3 and downregulates expression of this protein. HEK-293 cells were transfected with a construct containing the full-length Pias3 3' UTR sequence downstream of firefly luciferase. The transfected cells showed luciferase activity, which the cotransfection with miR-301a inhibited by 82% (Fig. 5D). Transfection of control oligonucleotide into the cells expressing Pias3 3' UTR modified luciferase as well as transfection of miR-301a mimic into the cells with an wild-type luciferase did not affect the luciferase activity. These data confirm that miR-301a directly targets the mRNA encoding Pias3 and reduces expression of this protein.

Since the data showed differential expression of miR-301a in different Th subsets (Figure 4A), the expression of Pias3 in the same Th populations was analyzed (Fig. 5E). Pias3 transcript was found to be nearly absent in Thl7 cells, in contrast to both Thl and Th2. This supports the notion of a negative effect of the presence of miR-301a on Pias3 expression in Thl 7 cells.

e) Modulation of miR-301a and PIAS3 directly changes in vivo encephalitogenicity of CD4+ T cells

In order to assess the in vivo relevance of miR-301a in myelin specific CD4+ T cells for the development of autoimmune demyelination, a transfer model of EAE in Rag2 knockout (KO) mice was utilized. MOG35-55-TCR transgenic CD4+ T cells (2D2) were transfected with either miR-301a mimic, miR-301a antagomir or a control scrambled oligonucleotide and grafted into Rag2 KO mice that were subsequently induced for EAE. Mice from all groups developed signs of disease with a similar day of onset (Fig. 6A). However, over the next 25 days of observation, the mice that received 2D2 CD4+ T cells expressing a mimic of miR- 301a developed a very aggressive form of EAE that resulted in the death of all tested animals. In contrast, the group that received 2D2 CD4+ T cells with an antagomir for miR-301a developed a significantly milder EAE (Fig. 6A). EAE in these mice was also less severe than disease in animals that received control transfected 2D2 CD4+ T cells. Infiltrating CD4+ T cells from the CNS of Rag2 KO mice that had received 2D2 T cells that were recovered and transfected with either mimic, or antagomir-miR-301a or with a control oligonucleotide were isolated. With the use of a fluorescein-labeled oligonucleotides for transfection we were able to detect a significant fraction of fluorescein positive CD4+ T cells in the CNS of these mice as late as 15 days post transfer (Fig. 6B). In accordance to the clinical data, the mice that were transferred with the mimic-miR-301a transfected 2D2 T cells had an increased number of CD4+ T cell in their CNS at the 15 days post transfer, whereas mice that received 2D2 T cells with antagomir-miR-301a had significantly smaller infiltrates (Fig. 6C). Furthermore CNS CD4+ T cells of the mice that received 2D2 T cells with antagomir-miR-301a produced less IL-17, whereas CNS CD4+ T cells of the mice that received 2D2 T cells with mimic-miR- 301a had an increased IL-17 generation (Fig. 6 D).

Since PIAS3 appeared to be an important intermediary of miR-301a in CD4+ T cells an effect of PIAS3 inhibition on EAE development was also tested. PIAS3 in 2D2 CD4+ T cells was inhibited using a combination of three different siRNAs to enhance the knockdown effect (Fig. 6 E). The transfer of such cells into Rag2 KO mice resulted in severe, fatal EAE, in all animals (Fig. 6F), thus resembling the disease profile induced by transfer of MOG35-55 specific CD4+ T cells with upregulated miR-301a (Fig. 6A). Taken together, these in vivo results confirmed the role of miR-301a and its target molecule, PIAS3, in the regulation of EAE.

Example 3

Peripheral blood mononuclear cells display overproduction of the miR-301a

MS patients (n=53) and controls (n=30) peripheral blood mononuclear cells (PBMCs) have been isolated by gradient centrifugation and cultured in the condition of the anti-CD3 stimulation (10 ug/ml) for 144 hours. Subsequently cells have been collected and RNA was extracted. Quantitative PCR analysis of hsa-miR-301a expression has been performed using a TaqMan assay. The miRNA expression data were normalized for the expression of small nuclear U6 RNA. The results have revealed a statistically significant, nearly 3 -fold overexpression of the hsa-miR-301a in MS PBMCs following anti-CD3 stimulation comparing to controls (p<0.015). This finding strengthens the notion on the dysregulation of the microRNA in MS confirming the need for therapeutic intervention toward diminishing miR-301a activity in autoimmune demyelination.

Summary

The presented here findings indicate that development of myelin antigen specific CD4+ T cells responses correlates with significant changes in miRNA expression profiles in peripheral and brain infiltrating T cells. Most notable upregulations were observed for miR-301a, miR- 21 and miR-155. Mechanistic studies showed that miR-301a influenced the development of Thl7 cells via inhibition of the IL-6-induced STAT3 pathway. A molecular search highlighted and validated PIAS3, a STAT3 inhibitor, as a target of miR-301a in CD4+ T cells. In vivo studies in animals with EAE, and manipulation of miR-301a levels in myelin autoreactive CD4+ T cells, demonstrated a specific role for miR-301a in regulation of EAE. Accordingly, inhibition of PIAS3, a target molecule for miR-301a, resulted in upregulation of EAE. Thus, we have confirmed a significant role for miRNA in regulation of the autoimmune demyelination and demonstrated, for the first time, a specific role of miR-301a and its target molecule PIAS3 as critical players in this process.

Many observations link changes in miRNA expression to development of autoimmunity. For example, general ablation of miRNA in T cells by conditional deletion of Dicer resulted in the spontaneous development of autoimmunity in aged mice (Cobb BS, et al. (2005) T cell lineage choice and differentiation in the absence of the R ase III enzyme Dicer. J Exp Med 201(9): 1367-1373). This phenomenon has been particularly linked to the loss of function of miR A deficient Treg cells, and mice with either a general deficiency of miRNA or selective knockdown of miR-146a in Treg cells displayed a fatal autoimmune disease (Lu LF, et al. (2010) Function of miR-146a in controlling Treg cell-mediated regulation of Thl responses. Cell 142(6):914-929; Cobb BS, et al. (2006) A role for Dicer in immune regulation. J Exp Med 203(11):2519-2527; Liston A, Lu LF, O'Carroll D, Tarakhovsky A, & Rudensky AY (2008) Dicer-dependent microRNA pathway safeguards regulatory T cell function. J Exp Med 205(9): 1993-2004; Chong MM, Rasmussen JP, Rudensky AY, & Littman DR (2008) The RNAselll enzyme Drosha is critical in T cells for preventing lethal inflammatory disease. J Exp Med 205(9):2005-2017; Zhou X, et al. (2008) Selective miRNA disruption in T reg cells leads to uncontrolled autoimmunity. J Exp Med 205(9):1983-1991). However, miRNA ablation in T cells also results in defects in NKT cell development (Zhou L, et al. (2009) Tie2cre -induced inactivation of the miRNAprocessing enzyme Dicer disrupts invariant NKT cell development. Proc Natl Acad Sci U S A 106(25): 10266- 10271, Fedeli M, et al. (2009) Dicer-dependent microRNA pathway controls invariant NKT cell development. J Immunol 183(4):2506-2512) and the differentiation of Th cells that may independently contribute to autoimmunity (25, Muljo SA, et al. (2005) Aberrant T cell differentiation in the absence of Dicer. J Exp Med 202(2):261-269).

MiR-301a, a highly evolutionary conserved miRNA, along with miR-130a, miR-130b and miR-301b, belongs to miR-130/301 family in the mouse genome ((www.mirbase.org (Griffiths-Jones S, Saini HK, van Dongen S, & Enright AJ (2008) miRBase: tools for microRNA genomics Nucleic Acids Res 36(Database issue) :D 154- 158)). MiR-301a has just recently been reported as being expressed in response to activation in CD8+ T cells, where it probably plays a role as a regulator of CD69 expression (Zhang N & Bevan MJ (2010) Dicer controls CD8+ T-cell activation, migration, and survival. Proc Natl Acad Sci U S A). MiR- 301a has also been indicated among miRNA enriched in Thl and Th2 populations Kuchen S, et al. (2010) Regulation of microRNA expression and abundance during lymphopoiesis. Immunity 32(6):828-839). Additionally miR-301a has been identified to be upregulated in response to IL-6 stimulation of malignant cholangiocytes (Braconi C, Huang N, & Patel T (2010) MicroRNA-dependent regulation of DNA methyltransferase-1 and tumor suppressor gene expression by interleukin-6 in human malignant cholangiocytes. Hepatology 51(3):881- 890). Inventors of the invention have found miR-301a to be significantly and specifically upregulated in CD4+ T cells during myelin antigen recognition. MiR-301a has also been strongly upregulated within T cells in the CNS in animals with EAE, where its upregulation was found to be monophasic and related to the clinically acute period of the disease. Although miR-301a appeared to be upregulated following TCR stimulation, the inhibition of miR-301a did not influence the proliferative responses of the CD4+ T cells. Most significantly, miR- 301a inhibition downregulated secretion of IL-17 as well as downregulated expression of the Thl7 population marker genes, like Rora, Rorc-yt, Ahr. MiR-301a expression was particularly pronounced both in vivo and in vitro in Thl7 cells. This suggested that miR-301a is operating to modulate Thl7 development. Indeed, miR-301a blockade in vitro resulted in hampered generation of Thl7 cells whilst having no effect on the capacity to generate Treg cells. Most intriguingly, signaling of IL-6 and IL-23 was substantially blocked by downregulation of miR-301a with a specific antagomir, leading to marked loss of STAT3 phosphorylation, but not STAT1 or AKT activation. The activation of the IL-6/23 induced STAT3 pathway is a critical and specific step required for the generation and maintenance of Thl7 cells (Yang XO, et al. (2007) STAT3 regulates cytokine-mediated generation of inflammatory helper T cells. J Biol Chem 282(13):9358-9363; Zhou L, et al. (2007) IL-6 programs T(H)-17 cell differentiation by promoting sequential engagement of the IL-21 and IL-23 pathways. Nat Immunol 8(9):967-974). Thus, miR-301a demonstrates a direct effect on Thl7 cell development. A subsequent search for a molecular mechanism for the action of miR-301a on Thl7 cell development demonstrated that interference with PIAS3 is likely to mediate this effect. PIAS3 is an E3 SUMO ligase that has been shown to act as both a transcriptional coactivator and corepressor, and to regulate the activity of many classes of transcription factors (Yagil Z, et al. (2010) The enigma of the role of protein inhibitor of activated STAT3 (PIAS3) in the immune response. Trends Immunol 31(5): 199-204). However, PIAS3 activity has been primarily linked to an inhibition of STAT3 (Chung CD, et al. (1997) Specific inhibition of Stat3 signal transduction by PI AS 3. Science 278(5344): 1803- 1805). So far little has been known on the role of PIAS3 in Th cell differentiation and function, and in particular in the control of Thl7 generation. In this study, we have demonstrated that whereas the PIAS3 transcript is essentially absent in Thl7 cells, it is readily detectable in both the Thl and Th2 subsets. Furthermore, a transfer of myelin specific CD4+ T cells with siRNA mediated knock down of PIAS3 resulted in severely upregulated EAE of recipient animals. Thus PIAS3 inhibition alone was sufficient to mimic the effect of miR- 301a upregulation. This observation indicates that there is an in reverse relationship between miR-301a and PIAS3, and functionally supports the notion that miR-301a downregulates PIAS3 promoting Thl7 development. Thus, we suggest here a new role for PIAS3 as a regulator of Thl7 subset development and function. In this regard, it is of interest to note that a related E3 SUMO ligase, PIAS1, has recently been demonstrated to be a critical factor involved in the regulation and accessibility of the Foxp3 locus influencing Treg development, also with a strong implication in the pathogenesis of EAE (Liu B, Tahk S, Yee KM, Fan G, & Shuai K (2010) The ligase PIAS1 restricts natural regulatory T cell differentiation by epigenetic repression. Science 330(6003):521-525).

Conducted profiling of CD4+ T cells responding to MOG35-55 identified, in addition to miR- 301a, upregulation of two other miRNAs, miR-21 and miR-155. Mir- 155 was among the first miRNAs identified to operate in T cells, and its expression has been linked to activation following a TCR stimulation (Haasch D, et al. (2002) T cell activation induces a noncoding RNA transcript sensitive to inhibition by immunosuppressant drugs and encoded by the proto- oncogene, BIC. Cell Immunol 217(l-2):78-86, Jindra PT, Bagley J, Godwin JG, & Iacomini J (2010) Costimulation-dependent expression of microRNA-214 increases the ability of T cells to proliferate by targeting Pten. J Immunol 185(2):990-997). Mice deficient in miR-155 develop an increased inflammatory remodeling of lung airways, reminiscent of autoimmune- mediated lung fibrosis and enteric inflammation (Rodriguez A, et al. (2007) Requirement of bic/microRNA-155 for normal immune function. Science 316(5824):608-611). The underlying deficit leading to autoimmunity in these mice has been associated with overproduction of Th2 cells caused by an imbalance of T cell subset differentiation. In our study, we also noted an upregulation of the Th2 marker gene, Gata3, following an inhibition of miR-155 in T cells. We also found a marked upregulation of miR-155 in T helper cells during the development of autoimmune demyelination, both in lymphocytes in the periphery and in brain infiltrating cells. Indeed, it has recently been demonstrated that miR-155 deficient mice are significantly resistant to EAE induction (O'Connell RM, et al. (2010) MicroRNA- 155 promotes autoimmune inflammation by enhancing inflammatory T cell development. Immunity 33(4):607-619). This has been largely related to the CD4+ T cell intrinsic function of miR-155, which is complemented by our findings. Additionally, elevated expression of miR-155 has also been observed in brain lesions from multiple sclerosis (MS) patients (Junker A, et al. (2009) MicroRNA profiling of multiple sclerosis lesions identifies modulators of the regulatory protein CD47. Brain 132(Pt 12):3342-3352). MiR-155 has been shown to be important for many other immune cell populations, e.g. for immunoglobulin (Ig) class switching to IgG in B cells (16, Dorsett Y, et al. (2008) MicroRNA-155 suppresses activation- induced cytidine deaminase-mediated Myc-Igh translocation. Immunity 28(5):630-638; Thai TH, et al. (2007) Regulation of the germinal center response by microRNA-155. Science 316(5824):604-608; Vigorito E, et al. (2007) microRNA-155 regulates the generation of immunoglobulin class switched plasma cells. Immunity 27(6):847-859) and for myeloid cells function and development, particularly in the context of LPS responses (Tili E, et al. (2007) Modulation of miR-155 and miR-125b levels following lipopolysaccharide/TNF-alpha stimulation and their possible roles in regulating the response to endotoxin shock. J Immunol 179(8):5082-5089; Androulidaki A, et al. (2009) The kinase Aktl controls macrophage response to lipopolysaccharide by regulating microRNAs. Immunity 31(2):220-231; O'Connell RM, Chaudhuri AA, Rao DS, & Baltimore D (2009) Inositol phosphatase SHIP1 is a primary target of miR-155. Proc Natl Acad Sci U S A 106(17):7113-7118). Notably, miR- 155 deficiency impacts dendritic cell function during EAE, contributing to the observed EAE resistance phenotype (O'Connell RM, et al. (2010) MicroRNA-155 promotes autoimmune inflammation by enhancing inflammatory T cell development. Immunity 33(4):607-619). Thus the final outcome of miR-155 activity in EAE may depend on several factors.

Another miRNA that we highlighted to be significantly associated with myelin autoreactive CD4+ T cell responses was miR-21. MiR-21 has also already been demonstrated to be overexpressed in MS lesions (Junker A, et al. (2009) MicroRNA profiling of multiple sclerosis lesions identifies modulators of the regulatory protein CD47. Brain 132(Pt 12):3342- 3352). A number of reports link miR-21 and T cell function. MiR-21 was found to be highly represented in effector and memory T cells compared to naive CD8+ T cells (Wu H, et al. (2007) miRNA profiling of naive, effector and memory CD8 T cells. PLoS One 2(10):el020). In human Tregs, miR-21 was found to act as a positive, though indirect, regulator of FOXP3 expression (Rouas R, et al. (2009) Human natural Treg microRNA signature: role of microRNA-31 and microRNA-21 in FOXP3 expression. Eur J Immunol 39(6): 1608-1618). Furthermore, miR-21 was found to be overexpressed in CD4+ T cells derived from both patients with lupus and lupus-prone MRL/lpr mice (Pan W, et al. (2010) MicroRNA-21 and microRNA- 148a contribute to DNA hypomethylation in lupus CD4+ T cells by directly and indirectly targeting DNA methyltransferase 1. J Immunol 184(12):6773-6781). However, most notably, miR-21 has been described as an OncomiR', meaning that it is overexpressed in most tumor types analyzed so far, and it is functionally involved in oncogenic processes (Volinia S, et al. (2006) A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A 103(7):2257-2261; Krichevsky AM & Gabriely G (2009) miR-21 : a small multi-faceted RNA. J Cell Mol Med 13(l):39-53). Although the changes in miR-21 expression that we observed during EAE suggest a role for this miRNA in autoimmune demyelination, we have not observed any significant changes in T cell function following miR-21 inhibition. Thus, the role of miR-21 in autoimmune demyelination will require further studies.

In summary, these findings demonstrate for the first time the role of miR-301a and its putative target, PIAS3, in the development of Thl7 cells and thus in the regulation of EAE. Recently, accumulating data suggest strongly that Thl7 cells represent a plastic and probably a transient population of Th cells. Such a scenario would require the ability to quickly repress and restore transcription of lineage master controlling genes. MiRNA, including miR-301a, would be ideally suited to perform such an action. Indeed, the effect of miR-301a upregulation in EAE was mimicked by the effect of siRNA mediated knockdown of PIAS3 in myelin reactive CD4+ T cells. Furthermore, a MS patients PBMCs were characterized by significant overproduction of miR-301a upon activation. Collectively our results suggest that miR-301a is a Thl7 subset-associated microRNA that functions in the pathogenesis of autoimmune demyelination and might represent an important target for potential therapeutic intervention.