Title:
DNA FRAGMENT FOR HIGHLY EXPRESSING VECTOR PLASMID
Document Type and Number:
Japanese Patent JP3877861
Kind Code:
B2
Abstract:
PROBLEM TO BE SOLVED: To obtain DNA fragments presenting in the promoter region of the glucoamylase gene glaB specifically expressed in a large amount in a solid culture and useful for constructing a system capable of expressing a homologous or heterologous gene by Aspergillus oryzae in a high productivity.
SOLUTION: It has been tried to define an important domain for high expression in a solid culture in a glaB promoter domain by a method by connecting a reporter gene in the down stream domain of a glucoamylase gene glaB promoter and bringing the activity of the reporter gene to an index of the promoter expression. The result shows that the expression of the solid culture decreases in case of lacking of a 27 base pair in (-350)-(-324), GAGAACTAAGAGAATGGCGGCACGGGC, and when a 97 base pair of (-350)-(-254) expressed by formula I and a 138 base pair of (-350)-(-213) expressed by formula II are inserted into the glaA promoter domain, expression performances in the solid culture are far advanced in both cases. Thus, the high expression promoter is constituted by using those domains.
Inventors:
Yoji Hata
Hiroki Ishida
Eiji Ichikawa
Akitsugu Kawato
Koji Suginami
Satoshi Imayasu
Hiroki Ishida
Eiji Ichikawa
Akitsugu Kawato
Koji Suginami
Satoshi Imayasu
Application Number:
JP6611498A
Publication Date:
February 07, 2007
Filing Date:
March 03, 1998
Export Citation:
Assignee:
Laurel wreath
International Classes:
C12N15/09; C12N1/00; C12N1/15; C12N1/19; C12P21/00; (IPC1-7): C12N15/09; C12N1/00; C12N1/15; //(C12N15/09; C12R1:69); (C12N1/00; C12R1:69); (C12N1/00; C12R1:69)
Domestic Patent References:
JP10084968A |
Other References:
Hata, Y., et al.,Gene,1998年 1月30日,Vol.207, No.2,p.127-134
Attorney, Agent or Firm:
Matsumoto Kuki
Toda parent man
Toda parent man