Compositions and Methods for Inhibition of Factor XII Gene Expression CROSS REFERENCE TO RELATED APPLICATIONS

This application claims priority from United States Provisional Patent Application Serial No. 62/451,868, filed on January 30, 2017, the contents of which are incorporated herein by reference in their entirety.

FIELD OF THE INVENTION

Disclosed herein are RNA interference (RNAi) agents for inhibition of Factor XII gene expression, compositions that include FXII RNAi agents, and methods of use thereof.

BACKGROUND

Factor XII (also referred to as FXII, F12, or Hageman factor), a serine protease expressed predominantly in the liver and found in blood, has dual functions in both the intrinsic coagulation pathway and the kinin-kallikrein system. The kinin-kallikrein system plays a role in inflammation, blood pressure control, coagulation and pain. The active form of Factor XII binds and cleaves both Factor XI in the coagulation cascade and prekallikrein in the kinin-kininogen system, yielding the active forms FXI and kallikrein, respectively.

Patients with complete loss of FXII do not present with a bleeding disorder. Further, it has been shown that mice lacking FXII by gene knockout are protected from thrombosis (Renne et al JEM 2005, 202:271-281). The thrombo-protective effect of FXII depletion was also observed in FXII-inhibitory antibody treated mice, rabbits and primates (Larsson et al. Science Trans Med, 2014 6:22ral7). Current treatments for thromboembolic events target enzymes downstream in the coagulation pathway that are critical for controlling injury- related blood loss through fibrin formation, and therefore, treatment with these agents have the downside of potential life-threatening hemorrhage. Particularly where Factor Xa inhibitors are contraindicated, the administration of current anticoagulant treatments elevate the risk of major bleeding events.

Hereditary angioedema (HAE) is a rare disease characterized by recurrent episodes of severe swelling. The most common areas of the body to develop swelling are the limbs, face, intestinal tract, and airway. Episodes may be spontaneous or be induced by physical trauma or stress. Laryngeal (airway) edema can be life-threatening, as it can lead to death by asphyxiation. The majority of HAE treatment options are for administration at the time of attack, focusing on either C1INH replacement, inhibiting kallikrein, or signaling through the bradykinin 2 receptor. Currently, the only long-term prophylactic treatment is C1INH replacement therapy.

Previously discovered RNAi agents targeting FXII are described in, among others, International Patent Application Publication No. WO 2016/149331 A2, which is incorporated herein in its entirety as if fully set forth herein. Additionally, FXII iRNA compositions are disclosed in International Patent Application Publication Nos. WO 2016/179342 and WO 2017/120397. However, the sequences and modifications of the FXII RNAi agents disclosed herein differ from those previously disclosed or known in the art. The FXII RNAi agents disclosed herein provide for potent and efficient inhibition of the expression of an FXII gene.

SUMMARY

There exists a need for novel FXI I RNA interference ( RNAi ) agents (also herein termed RNAi agent, RNAi trigger, or trigger) that are able to selectively and efficiently inhibit the expression of an FXII. Further, there exists a need for compositions of novel FX 11 -specific RNAi agents. Because both thrombosis (including venous thromboembolism, VTE) and angioedema are thought to occur through overactive signaling of their respective pathways, inhibition of FXII gene expression would be useful for, among other things, being used as a prophylactic treatment to prevent thrombosis and/or angioedema.

In general, the disclosure herein features FXII RNA interference ( RNAi ) agents, compositions containing FXII RNAi agents, and methods for inhibiting expression of an FXII gene in vitro and or in vivo using the FXII RNAi agents and compositions that include FXI I RNAi agents. The FXII RNAi agents described herein can be used for treating conditions or diseases caused by over-activation of the kinin-kallikrein and intrinsic coagulation pathw ays, such as thrombosis and or HAE. The FX 11 gene-specific RNAi agents described herein are able to selectively and efficiently decrease expression of FXII. The described FXII RNAi agents can be used in methods for therapeutic treatment ( including prophylactic treatment) of diseases and conditions associated with angioedema, including but not limited to: hereditary angioedema (HAE), acquired angioedema (AAE), ACE inhibitor associated angioedema, allergic angioedema, nonhistaminergic angioedema (INAE), idiopathic angioedema, thrombosis, venous thromboembolism (VTE), thrombotic occlusive disease, and peri-operative venous occlusive disease prophylaxis. Use of the described FXII RNAi agents further provides methods for the treatment and prevention of venous occlusive disease such as deep venous thrombosis or pulmonary embolism, and treatment or prevention of arterial thromboembolic disease. Such methods include the administration of an FXII RNAi agent as described herein to a subject, e.g., a human or animal subject, by any suitable means known in the art, such as subcutaneous injection or intravenous administration. In one aspect, the disclosure features RNAi agents for inhibitin expression of the human FXII gene, wherein the RNAi agent includes a sense strand and an antisense strand. Also described herein are compositions comprising an RNAi agent capable of inhibiting the expression of an FXII gene, wherein the RNAi agent comprises a sense strand and an antisense strand, and the composition further comprises at least one pharmaceutically acceptable excipient.

Each FXII RNAi agent described herein includes a sense strand and an antisense strand. The sense strand and the antisense strand can be partially, substantially, or fully complementary to each other. The length of the RNAi agent sense and antisense strands described herein each can be 16 to 30 nucleotides in length. In some embodiments, the sense and antisense strands are independently 17 to 26 nucleotides in length. The sense and antisense strands can be either the same length or different lengths. In some embodiments, the sense and antisense strands are independently 21 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are independently 21 to 24 nucleotides in length. In some embodiments, the sense and/or antisense strands are independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. The sense and antisense strands can be either the same length or different lengths. The RNAi agents described herein, upon delivery to a cell expressing FXII, inhibit the expression of one or more FXII genes in vivo or in vitro.

An FXII RNAi agent includes a sense strand (also referred to as a passenger strand), and an antisense strand (also referred to as a guide strand). A sense strand of the FXII R Ai agents described herein includes a nucleotide sequence havin at least 85% identity to a core stretch of at least 16 consecutive nucleotides to a sequence in an FXII mRNA. In some embodiments, the sense strand core stretch having at least 85% identity to a sequence in an FXII mRNA is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core stretch having at least 85% identity to a sequence in an FXII mRNA is 19 nucleotides in length. An antisense strand of an FXII RNAi agent includes a nucleotide sequence having at least 85% complementarity over a core stretch of at least 16 consecutive nucleotides to a sequence in an FXII mRNA and the corresponding sense strand. In some embodiments, the antisense strand core stretch having at least 85% complementarity to a sequence in an FXII mRNA or the corresponding sense strand is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.

In some embodiments, the FXII RNAi agents disclosed herein target a portion of an FXII gene having the sequence of any of the sequences disclosed in Table 1. Examples of FXII RNAi agent sense strands and antisense strands that can be used in FXII RNAi agents are provided in Tables 2, 3, 4, and 6. Examples of duplexes that include FXII RNAi agent are provided in Table 5 and Table 6. Examples of 1 -nucleotide core stretch sequences that may consist of or may be included in the sense strands and antisense strands of certain FXII RNAi agents disclosed herein, are provided in Table 2.

In another aspect, the disclosure features methods for delivering FXII RNAi agents to liver cells in a subject, such as a mammal, in vivo. In some embodiments, one or more FXII RNAi agents are delivered to target cells or tissues using any oligonucleotide delivery technology known in the art. Nucleic acid delivery methods include, but are not limited to, encapsulation in liposomes, iontophoresis, or incorporation into other vehicles, such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres, proteinaceous vectors, or Dynamic Polyconjugates™ (DPCs) (see, for example WO 2000/053722, WO 2008/0022309, WO 2011/104169, and WO 2012/083185, each of which is incorporated herein by reference). In some embodiments, a delivery vehicle, such as a polymer, an amphipathic polymer, a membrane active polymer, a peptide, such as a melittin or melittin-like peptide, a reversibly modified polymer or peptide, or a lipid, can be used with the FXII RNAi agents disclosed herein.

In some embodiments, an FXII RNAi agent is delivered to target cells or tissues by covalently linking or conjugating the RNAi agent to a targeting group such as an asialoglycoprotein receptor ligand. In some embodiments, an asialoglycoprotein receptor ligand includes, consists of, or consists essentially of, a galactose or galactose derivative cluster. In some embodiments, an FXII RNAi agent is linked to a targeting ligand comprising the galactose derivative N-acetyl-galactosamine. In some embodiments, a galactose derivative cluster includes an N-acetyl-galactosamine trimer or an N-acetyl- galactosamine tetramer. In some embodiments, a galactose derivative cluster is an N-acetyl- galactosamine trimer or an N-acetyl-galactosamine tetramer. Example targeting groups useful for delivering RNAi agents are disclosed, for example, in U. S. Patent Application No. 15/452,324 and Intemational Patent Application Publication No. WO 2017/156012, which are incorporated by reference herein in their entirety.

A targeting group can be linked to the 3' or 5' end of a sense strand or an antisense strand of an FXII RNAi agent. In some embodiments, a targeting group is linked to the 3' or 5' end of the sense strand. In some embodiments, a targeting group is linked to the 5' end of the sense strand. In some embodiments, a targeting group is linked internally to a nucleotide on the sense strand and/or the antisense strand of the RNAi agent. In some embodiments, a targeting group is linked to the RNAi agent via a linker.

A targeting group, with or without a linker, can be linked to the 5' or 3' end of any of the sense and/or antisense strands disclosed in Tables 2, 3, 4, and 6. A linker, with or without a targeting group, can be attached to the 5' or 3' end of any of the sense and/or antisense strands disclosed in Tables 2, 3, 4, and 6.

In another aspect, the disclosure features compositions that include one or more FXII RNAi agents that have the duplex structures disclosed in Table 5. In another aspect, the disclosure features compositions that include one or more FXII RNAi agents that have the duplex structures disclosed in Table 6.

In some embodiments, described herein are compositions that include a combination or cocktail of at least two FXII RNAi agents having different nucleotide sequences. In some embodiments, the two or more different FXII RNAi agents are each separately and independently linked to targeting groups. In some embodiments, the two or more different FXII RNAi agents are each linked to targeting groups that include or consist of targeting ligands that include one or more moieties that target an asialoglycoprotein receptor. In some embodiments, the two or more different FXII RNAi agents are each linked to targeting groups that include or consist of targeting ligands that include one or more galactose derivatives. In some embodiments, the two or more different FXII RNAi agents are each linked to targeting groups that include or consist of targeting ligands that include one or more N-acetyl-galactosamines. In some embodiments, when two or more RNAi agents are included in a composition, each RNAi agent is independently linked to the same targeting group. In some embodiments, when two or more RNAi agents are included in a composition, each RNAi agent is independently linked to a different targeting group, such as targeting groups having different chemical structures. In some embodiments, targeting groups are linked to the FXII RNAi agents without the use of an additional linker. In some embodiments, the targeting group is designed having a linker readily present to facilitate the linkage to an FXII RNAi agent. In some embodiments, when two or more RNAi agents are included in a composition, the two or more RNAi agents may be linked to their respective targeting groups using the same linkers. In some embodiments, when two or more RNAi agents are included in a composition, the two or more RNAi agents are linked to their respective targeting groups using different linkers.

In another aspect, the disclosure features methods for inhibiting FXII gene expression in a subject, the methods including administering to the subject an amount of an FXI I RNAi agent capable of inhibiting the expression of an FXII gene, wherein the FXII RNAi agent comprises a sense strand and an antisense strand.

In some embodiments, compositions for delivering an FXII RNAi agent to a liver cell, particularly hepatocytes, in vivo are described, comprising: an FXII RNAi agent conjugated to a targeting group. In some embodiments, the targeting group is an asialoglycoprotein ligand. In some embodiments are described pharmaceutical compositions comprising one or more FXII RNAi agents. In some embodiments, an FXII RNAi agent is optionally combined with one or more additional (i.e., second, third, etc.) therapeutics. An additional therapeutic can be another FXII RNAi agent (e.g., an FXII RNAi agent which targets a different sequence within the FXII target). An additional therapeutic can also be a small molecule drug, an antibody, an antibody fragment, an aptamer, and/or a vaccine. The FXII RNAi agents, with or without the one or more additional therapeutics, can be combined with one or more excipients to form pharmaceutical compositions.

Also described are methods of treating a human subject having a pathological state (such as a condition or disease), or being at risk of developing a pathological state, that is mediated at least in part by FXII expression, the methods comprising the step of administering to the subject a therapeutically effective amount of an FXII RNAi agent and/or FXII RNAi agent- containing composition. The method of treating a subject with an FXII RNAi agent and/or FXII RNAi agent-containing composition can optionally be combined with one or more steps of administering one or more additional (i.e., second) therapeutics or treatments. The FXII RNAi agent and additional therapeutics can be administered in a single composition or they can be administered separately.

In some embodiments, disclosed herein are methods for the treatment (including prophylactic treatment) of a pathological state mediated at least in part by FXII expression, wherein the methods include administering to a subject a therapeutically effective amount of an RNAi agent that includes an antisense strand comprising the sequence of any of the sequences in Table 2 or Table 3. In some embodiments, disclosed herein are methods for inhibiting expression of an FXII gene, wherein the methods include administering to a cell an RNAi agent that includes an antisense strand comprising the sequence of any of the sequences in Table 2 or Table 3. In some embodiments, disclosed herein are methods for the treatment (including prophylactic treatment) of a pathological state (such as a condition or disease) mediated at least in part by FXII expression, wherein the methods include administering to a subject a therapeutically effective amount of an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 2 or Table 4.

In some embodiments, disclosed herein are methods for inhibiting expression of an FXII gene, wherein the methods comprise administering to a cell an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 2 or Table 4.

In some embodiments, disclosed herein are methods for the treatment (including prophylactic treatment) of a pathological state mediated at least in part by FXII expression, wherein the methods include administering to a subject a therapeutically effective amount of an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 4, and an antisense strand comprising the sequence of any of the sequences in Table 3.

In some embodiments, disclosed herein are methods for inhibiting expression of an FXII gene, wherein the methods include administering to a cell an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 4, and an antisense strand comprising the sequence of any of the sequences in Table 3.

In some embodiments, disclosed herein are methods of inhibiting expression of an FXII gene, wherein the methods include administering to a subject an FXII RNAi agent that includes a sense strand consisting of the nucleobase sequence of any of the sequences in Table 4, and the antisense strand consisting of the nucleobase sequence of any of the sequences in Table 3. In other embodiments, disclosed herein are methods of inhibiting expression of an FXII gene, wherein the methods include administering to a subject an FXII RNAi agent that includes a sense strand consisting of the modified sequence of any of the modified sequences in Table 4, and the antisense strand consisting of the modified sequence of any of the modified sequences in Table 3. In some embodiments, disclosed herein are methods for inhibiting expression of an FXII gene in a cell, wherein the methods include administering one or more FXII RNAi agents having the duplex structure set forth in Table 5. In some embodiments, disclosed herein are methods for inhibiting expression of an FXII gene in a cell, wherein the methods include administering one or more FXII RNAi agents having the duplex structure set forth in Table 6.

The FXI I RNAi agents disclosed herein are designed to target specific positions on an FXII gene (SEQ ID NO: 1). As defined herein, an antisense strand sequence is designed to target an FXII gene at a given position on the gene when the 5' terminal nucleobase of the antisense strand would be aligned with the position that is 19 nucleotides downstream (towards the 3' end) from the position on the gene when base pairing to the gene. For example, as illustrated in Tables 1 and 2 herein, an antisense strand sequence designed to target an FXII gene at position 127 requires that when base pairing to the gene, the 5' terminal nucleobase of the antisense strand is aligned with position 145 of the FXII gene. As provided herein, an FXII RNAi agent does not require that the nucleobase at position 1 (5' - 3') of the antisense strand be complementary to the gene, provided that there is at least 85% complementarity (e.g., at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) of the antisense strand and the gene across a core stretch sequence of at least 16 consecutive nucleotides. For example, for an FXII RNAi agent disclosed herein that is designed to target position 127 of an FXII gene, the 5' terminal nucleobase of the antisense strand of the of the FXII RNAi agent must be aligned with position 145 of the gene; however, the 5' terminal nucleobase of the antisense strand may be, but is not required to be, complementary to position 145 of an FXII gene, provided that there is at least 85% complementarity (e.g., at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) of the antisense strand and the gene across a core stretch sequence of at least 16 consecutive nucleotides. As shown by, among other things, the various examples disclosed herein, the specific site of binding of the gene by the antisense strand of the FXII RNAi agent (e.g., whether the FXII RNAi agent is designed to target an FXII gene at position 127, at position 91, at position 321, or at some other position) is highly important to the level of inhibition achieved by the FXII RNAi agent. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), wherein at least one or more nucleotides is a modified nucleotide. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), wherein all or substantially all of the nucleotides are modified nucleotides.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), wherein at least one or more nucleotides is a modified nucleotide. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), wherein at least one or more nucleotides is a modified nucleotide. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), wherein all or substantially all of the nucleotides are modified nucleotides.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), wherein at least one or more nucleotides is a modified nucleotide. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), wherein all or substantially all of the nucleotides are modified nucleotides.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), wherein one or more nucleotides is a modified nucleotide. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), wherein all or substantially all of the nucleotides are modified nucleotides.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), wherein one or more nucleotides is a modified nucleotide. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), wherein all or substantially all of the nucleotides are modified nucleotides.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), wherein one or more nucleotides is a modified nucleotide. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), wherein all or substantially all of the nucleotides are modified nucleotides.

In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of GCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 896), wherein one or more nucleotides is a modified nucleotide. In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of GCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 896), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827), wherein one or more nucleotides is a modified nucleotide. In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827), wherein all or substantially all of the nucleotides are modified nucleotides.

In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855), wherein one or more nucleotides is a modified nucleotide. In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855), wherein all or substantially all of the nucleotides are modified nucleotides.

In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846), wherein one or more nucleotides is a modified nucleotide. In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846), wherein all or substantially all of the nucleotides are modified nucleotides.

In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829), wherein one or more nucleotides is a modified nucleotide. In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868), wherein one or more nucleotides is a modified nucleotide. In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868), wherein all or substantially all of the nucleotides are modified nucleotides.

In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of CCAAGGAGCAUAAGUACAAUU (SEQ ID NO: 866), wherein one or more nucleotides is a modified nucleotide. In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of CCAAGGAGCAUAAGUACAAUU (SEQ ID NO: 866), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of GCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 896), wherein one or more nucleotides is a modified nucleotide, and the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), wherein one or more nucleotides is a modified nucleotide.

In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827), wherein one or more nucleotides is a modified nucleotide, and the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), wherein one or more nucleotides is a modified nucleotide. In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855), wherein one or more nucleotides is a modified nucleotide, and the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), wherein one or more nucleotides is a modified nucleotide.

In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846), wherein one or more nucleotides is a modified nucleotide, and the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), wherein one or more nucleotides is a modified nucleotide.

In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829), wherein one or more nucleotides is a modified nucleotide, and the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), wherein one or more nucleotides is a modified nucleotide.

In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868), wherein one or more nucleotides is a modified nucleotide, and the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), wherein one or more nucleotides is a modified nucleotide.

In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of CCAAGGAGCAUAAGUACAAUU (SEQ ID NO: 866), wherein one or more nucleotides is a modified nucleotide, and the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), wherein one or more nucleotides is a modified nucleotide.

In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of GCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 896), wherein all or substantially all of the nucleotides are modified nucleotides, and the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827), wherein all or substantially all of the nucleotides are modified nucleotides, and the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), wherein all or substantially all of the nucleotides are modified nucleotides.

In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855), wherein all or substantially all of the nucleotides are modified nucleotides, and the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), wherein all or substantially all of the nucleotides are modified nucleotides.

In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846), all or substantially all of the nucleotides are modified nucleotides, and the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), all or substantially all of the nucleotides are modified nucleotides.

In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829), wherein all or substantially all of the nucleotides are modified nucleotides, and the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868), wherein all or substantially all of the nucleotides are modified nucleotides, and the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), wherein all or substantially all of the nucleotides are modified nucleotides.

In some embodiments, the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of CCAAGGAGCAUAAGUACAAUU (SEQ ID NO: 866), wherein all or substantially all of the nucleotides are modified nucleotides, and the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804) differing by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides is a modified nucleotide, and the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of GCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 896) differing by 0, 1, 2, or 3 nucleotides.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751) differing by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides is a modified nucleotide, and the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827) differing by 0, 1, 2, or 3 nucleotides. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673) differing by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides is a modified nucleotide, and the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855) differing by 0, 1, 2, or 3 nucleotides.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793) differing by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides is a modified nucleotide, and the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846) differing by 0, 1, 2, or 3 nucleotides.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767) differing by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides is a modified nucleotide, and the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829) differing by 0, 1, 2, or 3 nucleotides.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805) differing by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides is a modified nucleotide, and the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868) differing by 0, 1, 2, or 3 nucleotides.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787) differing by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides is a modified nucleotide, and the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of CCAAGGAGCAUAAGUACAAUU (SEQ ID NO: 866) differing by 0, 1, 2, or 3 nucleotides.

In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD05333.

In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04131.

In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04157.

In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04254. In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04623. In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04625.

In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04627.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUGUACUUAUGCUCCUUG (SEQ ID NO: 23), wherein one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 23 is located at positions 1 to 19 (5' -> 3') of the antisense strand. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUGUACUUAUGCUCCUUG (SEQ ID NO: 23), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO 23 is located at positions 1 to 1 (5' - 3') of the antisense strand.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UGGUCUUUCACUUUCUUGG (SEQ ID NO: 51), wherein one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 51 is located at positions 1 to 19 (5' -> 3') of the antisense strand. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UGGUCUUUCACUUUCUUGG (SEQ ID NO: 51), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 51 is located at positions 1 to 19 (5' - 3') of the antisense strand. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UAAGCACUUUAUUGAGUUC (SEQ ID NO: 87), wherein one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 87 is located at positions 1 to 19 (5' - 3') of the antisense strand. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UAAGCACUUUAUUGAGUUC (SEQ ID NO: 87), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 87 is located at positions 1 to 19 (5' - 3') of the antisense strand. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUCAAAGCACUUUAUUGAG (SEQ ID NO: 90), wherein one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 90 is located at positions 1 to 19 (5' - 3') of the antisense strand. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUCAAAGCACUUUAUUGAG (SEQ ID NO: 90), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 90 is located at positions 1 to 19 (5' - 3') of the antisense strand. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUCAAAGCACUUUAUUGA (SEQ ID NO: 93), wherein one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 93 is located at positions 1 to 19 (5' - 3') of the antisense strand. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUCAAAGCACUUUAUUGA (SEQ ID NO: 93), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 93 is located at positions 1 to 19 (5' -> 3') of the antisense strand.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUGUACUUAUGCUCCUUGG (SEQ ID NO: 37), wherein one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 37 is located at positions 1 to 19 (5' - 3') of the antisense strand. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUGUACUUAUGCUCCUUGG (SEQ ID NO: 37), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 37 is located at positions 1 to 19 (5' - 3') of the antisense strand.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 804 is located at positions 1 to 21 (5' 3') of the antisense strand. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 804 is located at positions 1 to 21 (5' - 3') of the antisense strand.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 751 is located at positions 1 to 21 (5' - 3') of the antisense strand. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 751 is located at positions 1 to 21 (5' - 3') of the antisense strand.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 673 is located at positions 1 to 21 (5' -> 3') of the antisense strand. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 673 is located at positions 1 to 21 (5' -> 3') of the antisense strand.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 793 is located at positions 1 to 21 (5' -> 3') of the antisense strand. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 793 is located at positions 1 to 21 (5' - 3') of the antisense strand.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 767 is located at positions 1 to 21 (5' - 3') of the antisense strand. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 767 is located at positions 1 to 21 (5' - 3') of the antisense strand.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 805 is located at positions 1 to 21 (5' -> 3') of the antisense strand. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 805 is located at positions 1 to 21 (5' -> 3') of the antisense strand.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 787 is located at positions 1 to 21 (5' - 3') of the antisense strand. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 787 is located at positions 1 to 21 (5' - 3') of the antisense strand. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804) differing by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 804 is located at the 5' the terminal end of the antisense strand, and wherein sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of GC C AAGGAGC AU AAGUAC AAA (SEQ ID NO: 896).

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751) differing by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 751 is located at the 5' the terminal end of the antisense strand, and the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827).

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673) differing by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 673 is located at the 5' the terminal end of the antisense strand, and the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855).

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793) differing by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 793 is located at the 5' the terminal end of the antisense strand, and the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846). In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767) differing by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 767 is located at the 5' the terminal end of the antisense strand, and the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829) differing by 0, 1, 2, or 3 nucleotides.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805) differing by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 805 is located at the 5' the terminal end of the antisense strand, and the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868) differing by 0, 1 , 2, or 3 nucleotides.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787) differing by 0, 1 , 2, or 3 nucleotides, wherein at least one or more nucleotides is a modified nucleotide, and wherein SEQ ID NO: 787 is located at the 5' the terminal end of the antisense strand, and the sense strand of an FXII RNAi agent comprises or consists of the nucleobase sequence of CCAAGGAGCAUAAGUACAAUU (SEQ ID NO: 866) differing by 0, 1, 2, or 3 nucleotides.

The FX 11 RNAi agents described herein can include one or more modified nucleotides. The FXII RNAi agents described herein can also include one or more phosphorothioate intern ucleoside linkages.

The FXII RNAi agents described herein can also include one or more targeting groups or linking groups. In some embodiments, the FXII RNAi agents disclosed herein include one or more targeting groups. In some embodiments, the targeting groups are comprised of an asialoglycoprotein receptor ligand. In some embodiments, the asialoglycoprotein receptor ligand comprises a galactose or galactose-derivative cluster. In some embodiments, the galactose-derivative cluster comprises N-acetyi-galactosamme. In some embodiments, the targeting ligand comprises an N-acetyl-galactosamine trimer. In some embodiments, a targeting group is conjugated to the sense strand of the FXII RNAi agents disclosed herein. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the sequence (5' 3') usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsc (SEQ ID NO: 404), wherein a, c, g, and u are 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fiuoro adenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the sequence (5' - 3') usGfsgucuuUfcAfcUfuUfcuuggsusu (SEQ ID NO: 289), wherein a, c, g, and u are 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the sequence (5' 3') usAfsasGfcAfcUfuUfaUfuGfaGfuUfcCfsu (SEQ ID NO: 300), wherein a, c, g, and u are 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the sequence (5' 3') usUfsusCfaAfaGfcAfcUfuUfaUfuGfaGfsu (SEQ ID NO: 319), wherein a, c, g, and u are 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the sequence (5' 3') usUfscsAfaAfgCfaCfuUfuAfuUfgAfgUfsu (SEQ ID NO: 304), wherein a, c, g, and u are 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the sequence (5' 3') usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsg (SEQ ID NO: 375), wherein a, c, g, and u are 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the sequence (5' 3') usUfsgsUfaCfuUfaUfgCfuCfcUfuGfgusu (SEQ ID NO: 377), wherein a, c, g, and u are 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fiuoro adenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the sequence (5' 3') usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsc (SEQ ID NO: 404) and the sense strand of an FXII RNAi agent comprises or consists of the sequence (5' - 3') (NAG37)gsccaaggaGfCfAfuaaguacaaas(invAb) (SEQ ID NO: 643), wherein a, c, g, and u are 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; (invAb) is inverted abasic deoxyribose (invAb); and (NAG37) is the targeting ligand that includes N-acetyl-galactosamine having the structure shown in Table 7 herein.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the sequence (5' 3') usGfsgucuuUfcAfcUfuUfcuuggsusu (SEQ ID NO: 289) and the sense strand of an FXII RNAi agent comprises or consists of the sequence (5' - 3') (NAG25)sasaccaagaAfAfGfugaaagacc(invdA) (SEQ ID NO: 1277), wherein a, c, g, and u are 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; (invdA) is inverted deoxyriboadenosine (invdA); and (NAG25) is the targeting ligand that includes N-acetyl-galactosamine having the structure shown in Table 7 herein.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the sequence (5' 3') usAfsasGfcAfcUfuUfaUfuGfaGfuUfcCfsu (SEQ ID NO: 300) and the sense strand of an FXII RNAi agent comprises or consists of the sequence (5' - 3') (NAG25)sasggaacucAfAfUfaaagugcuuas(invAb) (SEQ ID NO: 519), wherein a, c, g, and u are 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; (invAb) is inverted abasic deoxyribose (invAb); and (NAG25) is the targeting ligand that includes N-acetyl-galactosamine having the structure shown in Table 7 herein. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the sequence (5' 3') usUfsusCfaAfaGfcAfcUfuUfaUfuGfaGfsu (SEQ ID NO: 319) and the sense strand of an FXII RNAi agent comprises or consists of the sequence (5' - 3') (NAG25)sascucaauaAfAfGfugcuuugaaas(invAb) (SEQ ID NO: 526), wherein a, c, g, and u are 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; (invAb) is inverted abasic deoxyribose (invAb); and (NAG25) is the targeting ligand that includes N-acetyl-galactosamine having the structure shown in Table 7 herein.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the sequence (5' 3') usUfscsAfaAfgCfaCfuUfuAfuUfgAfgUfsu (SEQ ID NO: 304) and the sense strand of an FXII RNAi agent comprises or consists of (5' - 3') (NAG37)sasacucaauAfAfAfgugcuuugaas(invAb) (SEQ ID NO: 610), wherein a, c, g, and u are 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fiuoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; (invAb) is inverted abasic deoxyribose (invAb); and (NAG37) is the targeting ligand that includes N-acetyl-galactosamine having the structure shown in Table 7 herein.

In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the sequence (5' 3') usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsg (SEQ ID NO: 375) and the sense strand of an FXII RNAi agent comprises or consists of the sequence (5' - 3') (NAG37)scsccaaggaGfCfAfuaaguacaaas(invAb) (SEQ ID NO: 611), wherein a, c, g, and u are 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; (invAb) is inverted abasic deoxyribose (invAb); and (NAG37) is the targeting ligand that includes N-acetyl-galactosamine having the structure shown in Table 7 herein. In some embodiments, the antisense strand of an FXII RNAi agent comprises or consists of the sequence (5' 3') usUfsgsUfaCfuUfaUfgCfuCfcUfuGfgusu (SEQ ID NO: 377) and the sense strand of an FXII RNAi agent comprises or consists of the sequence (5' - 3') (NAG37)s(invAb)sccaaggAfGfCfauaaguacaauus(invAb) (SEQ ID NO: 613), wherein a, c, g, and u are 2'-0-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; (invAb) is inverted abasic deoxyribose (invAb); and (NAG37) is the targeting ligand that includes N-acetyl-galactosamine having the structure shown in Table 7 herein.

In some embodiments, the FXII RNAi agents described herein can include one or more targeting groups having the structure of (PAZ), (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s, as defined herein in Table 7.

In some embodiments, the FXII RNAi agents described herein include one targeting group at the 5' end of the sense strand having the structure of (PAZ), (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s, as defined herein in Table 7.

The FXII RNAi agents disclosed herein can be incorporated into a composition comprising one or more disclosed FXII RNAi agent and at least one pharmaceutically acceptable excipient. In some embodiments, the compositions disclosed herein comprising one or more of the disclosed FXII RNAi agents and at least one pharmaceutically acceptable excipient is a pharmaceutical composition.

The pharmaceutical compositions comprising one or more FXII RNAi agents can be administered in a number of ways depending upon whether local or systemic treatment is desired. Administration can be made by any way commonly known in the art, such as, but not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (e.g., via an implanted device), and intraparenchymal administration. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection. In some embodiments, the compositions comprising one or more disclosed FXII RNAi agents and at least one pharmaceutically acceptable excipient can further comprise one or more additional therapeutics or treatments. In some embodiments, the compositions described herein comprising one or more FXII RNAi agents are packaged in a kit, container, pack, dispenser, pre-filled syringes, or vials. In some embodiments, the compositions described herein are administered parenterally.

The FXII RNAi agents and compositions comprising same disclosed herein may be administered to a subject for the treatment (including prophylactic treatment) of a pathological state (such as a condition or disease) mediated at least in part by FXII expression. The condition or disease that may be treated, prevented, and/or managed by administration of the FXII RNAi agents and compositions comprising same disclosed herein include HAE, AAE, ACE inhibitor associated angioedema, allergic angioedema, INAE, idiopathic angioedema, thrombosis, VTE, thrombotic occlusive disease, and peri-operative venous occlusive disease prophylaxis.

As used herein, the terms "oligonucleotide" and "polynucleotide" mean a polymer of linked nucleosides each of which can be independently modified or unmodified.

As used herein, an "RNAi agent" (also referred to as an "RNAi trigger") means a composition that contains an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of degrading or inhibiting translation of messenger RNA (mRNA) transcripts of a target mRNA in a sequence specific manner. As used herein, RNAi agents may operate through the RNA interference mechanism (i.e., inducing RNA interference through interaction with the RNA interference pathway machinery (RNA- induced silencing complex or RISC) of mammalian cells), or by any alternative mechanism(s) or pathway(s). While it is believed that RNAi agents, as that term is used herein, operate primarily through the RNA interference mechanism, the disclosed RNAi agents are not bound by or limited to any particular pathway or mechanism of action. RNAi agents disclosed herein are comprised of a sense strand and an antisense strand, and include, but are not limited to: short interfering RNAs (siRNAs), double-strand RNAs (dsRNA), micro RNAs (miRNAs), short hairpin RNAs (shRNA), and dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to the mRNA being targeted (e.g. FXII mRNA). RNAi agents can include one or more modified nucleotides and/or one or more non-phosphodiester linkages. As used herein, the terms "silence," "reduce," "inhibit," "down-regulate," or "knockdown" when referring to expression of a given gene, mean that the expression of the gene, as measured by the level of RNA transcribed from the gene or the level of polypeptide, protein or protein subunit translated from the mRNA in a cell, group of cells, tissue, organ, or subject in which the gene is transcribed, is reduced when the cell, group of cells, tissue, organ, or subject is treated with the RNAi agents described herein as compared to a second cell, group of cells, tissue, organ, or subject that has not or have not been so treated.

As used herein, the terms "sequence" and "nucleotide sequence" mean a succession or order of nucleobases or nucleotides, described with a succession of letters using standard nomenclature.

As used herein, a "base", "nucleotide base," or "nucleobase," is a heterocyclic pyrimidine or purine compound, which is a standard constituent of all nucleic acids, and includes the bases that form the nucleotides adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U). A nucleobase may further be modified to include, without limitation, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. As used herein, the term "nucleotide" can include a modified nucleotide (such as, for example, a nucleotide mimic, abasic residue (Ab), or a surrogate replacement moiety). As used herein, and unless otherwise indicated, the term "complementary," when used to describe a first nucleobase or nucleotide sequence (e.g., RNAi agent sense strand or targeted mRNA) in relation to a second nucleobase or nucleotide sequence (e.g., RNAi agent antisense strand or a single-stranded antisense oligonucleotide), means the ability of an oligonucleotide or polynucleotide including the first nucleotide sequence to hybridize (form base pair hydrogen bonds under mammalian physiological conditions (or similar conditions in vitro)) and form a duplex or double helical structure under certain standard conditions with an oligonucleotide or polynucleotide including the second nucleotide sequence. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are fulfilled. Sequence identity or complementarity is independent of modification. For example, a and Af, as defined herein, are complementary to U (or T) and identical to A for the purposes of determining identity or complementarity.

As used herein, "perfectly complementary" or "fully complementary" means that all (100%) of the nucleobases or nucleotides in a contiguous sequence of a first polynucleotide will hybridize with the same number of nucleobases or nucleotides in a contiguous sequence of a second polynucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.

As used herein, "partially complementary" means that in a hybridized pair of nucleobase sequences, at least 70%, but not all, of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide.

As used herein, "substantially complementary" means that in a hybridized pair of nucleobase sequences, at least 85%, but not all, of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. The terms "complementary," "fully complementary," "partially complementary," and "substantially complementary" herein are used with respect to the nucleobase or nucleotide matching between the sense strand and the antisense strand of an RNAi agent, or between the antisense strand of an RNAi agent and a sequence of an FXII mRNA.

As used herein, the term "substantially identical" or "substantially identity" as applied to nucleic acid sequence means that a nucleic acid sequence comprises a sequence that has at least about 85% sequence identity or more, e.g., at least 90%, at least 95%, or at least 99% identity, compared to a reference sequence. Percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions at which the identical nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. The inventions disclosed herein encompass nucleotide sequences substantially identical to those disclosed herein.

As used herein, the terms "treat," "treatment," and the like, mean the methods or steps taken to provide relief from or alleviation of the number, severity, and/or frequency of one or more symptoms of a disease in a subject. As used herein, "treat" and treatment" may include the prevention, management, prophylactic treatment, and/or inhibition of the number, severity, and/or frequency of one or more symptoms of a disease in a subject.

As used herein, the phrase "introducing into a cell," when referring to an RNAi agent, means functionally delivering the RNAi agent into a cell. The phrase "functional delivery," means that delivering the RNAi agent to the cell in a manner that enables the RNAi agent to have the expected biological activity, e.g., sequence-specific inhibition of gene expression.

Unless stated otherwise, use of the symbol as used herein means that any group or groups may be linked thereto that is in accordance with the scope of the inventions described herein.

As used herein, the term "isomers" refers to compounds that have identical molecular formulae, but that differ in the nature or the sequence of bonding of their atoms or in the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are termed "stereoisomers." Stereoisomers that are not mirror images of one another are termed "diastereoisomers," and stereoisomers that are non-superimposable mirror images are termed "enantiomers," or sometimes optical isomers. A carbon atom bonded to four non-identical substituents is termed a "chiral center."

As used herein, unless specifically identified in a structure as having a particular conformation, for each structure in which asymmetric centers are present and thus give rise to enantiomers, diastereomers, or other stereoisomeric configurations, each structure disclosed herein is intended to represent all such possible isomers, including their optically pure and racemic forms. For example, the structures disclosed herein are intended to cover mixtures of diastereomers as well as single stereoisomers.

As used in a claim herein, the phrase "consisting of excludes any element, step, or ingredient not specified in the claim. When used in a claim herein, the phrase "consisting essentially of limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention.

The person of ordinary skill in the art would readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state, depending upon the environment in which the compound or composition is placed. Accordingly, as used herein, the structures disclosed herein envisage that certain functional groups, such as, for example, OH, SH, or NH, may be protonated or deprotonated. The disclosure herein is intended to cover the disclosed compounds and compositions regardless of their state of protonation based on the environment (such as pH), as would be readily understood by the person of ordinary skill in the art.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

Other objects, features, aspects, and advantages of the invention will be apparent from the following detailed description, accompanying figures, and from the claims.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1. Graph showing knockdown in mice treated with a single subcutaneous dose of 3 mg/kg FXII RNAi agent AD03632 on day 1, compared to mice treated with saline. Standard error of the mean is displayed as error bars graphed above the mean.

FIG. 2. Graph showing knockdown in mice treated with (i) a single subcutaneous dose of 0.6 mg/kg FXII RNAi agent AD03632 (dashed line with triangles); (ii) a single subcutaneous dose of 2 mg/kg FXII RNAi agent AD03632 (solid line with triangles); and (iii) saline (solid line with circles). Standard deviation is displayed as error bars graphed above the mean.

FIG. 3. Graph showing knockdown in mice treated with (i) 0.6 mg/kg FXII RNAi agent AD03632 (dashed line with squares) administered subcutaneously once weekly for six consecutive weeks starting at day 1; (ii) 2 mg/kg FXII RNAi agent AD03632 (solid line with squares) administered subcutaneously once weekly for six consecutive weeks starting at day 1; and (iii) saline (solid line with circles). Standard error of the mean is displayed as error bars graphed above the mean.

FIG. 4. Plot showing FXII serum levels in rats treated with a single subcutaneous dose on day 1 of either (i) saline; (ii) heparin (1000 U/kg, dosed at cannulation); (iii) 1 mg/kg FXII RNAi agent AD03224; or (iv) 3 mg/kg FXII RNAi agent AD03224. FIG. 5. Plot showing clot weight (in mg) from arterio-venous shunt model in rats taken on day 14, after a single subcutaneous dose on day 1 of either (i) saline; (ii) heparin; (iii) 1 mg/kg FXII RNAi agent AD03224; or (iv) 3 mg/kg FXII RNAi agent AD03224.

DETAILED DESCRIPTION RNAi Agents

Described herein are RNAi agents for inhibiting expression of the Factor XII gene (referred to herein as FXII RNAi agents or FXII RNAi triggers). Each FXII RNAi agent comprises a sense strand and an antisense strand. The sense strand and antisense strand each can be 16 to 30 nucleotides in length. In some embodiments, the sense and antisense strands each can be 1 7 to 26 nucleotides in length. The sense and antisense strands can be either the same length or they can be different lengths. In some embodiments, the sense and antisense strands are each independently 17-21 nucleotides in length. In some embodiments, the sense and antisense strands are each 21 -26 nucleotides in length. In some embodiments, the sense and antisense strands are each 2 1 -24 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length while the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 2 1 nucleotides in length while the antisense strand is about 23 nucleotides in length. In some embodiments, a sense strand is 23 nucleotides in length and an antisense strand is 2 1 nucleotides in length. In some embodiments, both the sense and antisense strands are each 2 1 nucleoti des in length. In some embodiments, a sense strand is 22 nucleotides in length and an antisense strand is 2 1 nucleotides in length. In some embodi ments, a sense strand is 1 nucleotides in length and an antisense strand is 2 1 nucleotides in length. In some embodiments, the RNAi agent sense and antisense strands are each independently 1 7. 18, 19, 20, 2 1 . 22. 23. 24. 25, or 26 nucleotides in length. In some embodi ments, a double-stranded RNAi agent has a duplex length of about 16, 17, 18, 1 9, 20, 21 , 22. 23 or 24 nucleotides.

In some embodiments, the region of perfect or substantial complementarity between the sense strand and the antisense strand is 16-26 ( e.g.. 16, 17, 1 . 19, 20, 2 1 , 22. 23. 24, 25, or 26) nucleotides in length and occurs at or near the 5' end of the antisense strand ( e.g.. this region may be separated from the 5 ' end of the antisense strand by 0. I . 2. 3. or 4 nucleotides that are not perfectly or substantially complementary ). The sense strand and antisense strand each contain a core stretch sequence that is 16 to 23 nucleobases in length. An antisense strand core stretch sequence is 100% ( perfectly ) complementary or at least about 85% ( substantially ) complementary to a nucleotide sequence (someti mes referred to, e.g.. as a target sequence) present in the FXI I mRNA target. A sense strand core stretch sequence is 100% ( perfectly ) complementary or at least about 85% ( substantially ) complementary to a core stretch sequence in the antisense strand, and thus the sense strand core stretch sequence is perfectly identical or at least about 85% identical to a nucleotide sequence (target sequence) present in the FXI I mRNA target. A sense strand core stretch sequence can be the same length as a corresponding antisense core sequence or it can be a di fferent length. In some embodiments, the antisense strand core stretch sequence is 16, 1 7. 18, 19, 20, 2 1. 22. or 23 nucleotides in length. In some embodiments, the sense strand core stretch sequence is 16, 1 7. 18, 19, 20, 2 1 . 22. or 23 nucleotides in length. Examples of nucleotide sequences used in forming FX 11 RNAi agents are provided in Tables 2, 3, 4, and 6. Examples of FXII RNAi agent duplexes, that include the sense strand and antisense strand sequences in Tables 2, 3, and 4, are shown in Table 5. The FXII RNAi agent sense and antisense strands anneal to form a duplex. A sense strand and an antisense strand of an FXII RNAi agent may be partially, substantially, or fully complementary to each other. Within the complementary duplex region, the sense strand core stretch sequence is at least 85% complementary or 100% complementary to the antisense core stretch sequence. In some embodiments, the sense strand core stretch sequence contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense core stretch sequences of an FXII RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, or at least 23 nucleotides that is at least 85% base paired or 100% base paired.)

In some embodiments, the antisense strand of an FXII RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of an FXII RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2 or Table 4.

In some embodiments, the antisense strand of an FXII RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 6. In some embodiments, the sense strand of an FXII RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 6.

The sense strand and/or the antisense strand may optionally and independently contain an additional 1 , 2, 3, 4, 5, or 6 nucleotides (extension) at the 3' end, the 5' end, or both the 3' and 5' ends of the core stretch sequences. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sequence in an FXII mRNA. The sense strand additional nucleotides, if present, may or may not be identical to the corresponding sequence in an FXII mRNA. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sense strand's additional nucleotides, if present.

As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and/or 3' end of the sense strand core stretch sequence and/or antisense strand core stretch sequence. The extension nucleotides on a sense strand may or may not be complementary to nucleotides, either core stretch sequence nucleotides or extension nucleotides, in the corresponding antisense strand. Conversely, the extension nucleotides on an antisense strand may or may not be complementary to nucleotides, either core stretch nucleotides or extension nucleotides, in the corresponding sense strand. In some embodiments, both the sense strand and the antisense strand of an RNAi agent contain 3' and 5' extensions. In some embodiments, one or more of the 3' extension nucleotides of one strand base pairs with one or more 5' extension nucleotides of the other strand. In other embodiments, one or more of 3' extension nucleotides of one strand do not base pair with one or more 5' extension nucleotides of the other strand. In some embodiments, an FXII RNAi agent has an antisense strand having a 3' extension and a sense strand having a 5' extension.

In some embodiments, an FXII RNAi agent comprises an antisense strand having a 3' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, an FXII RNAi agent comprises an antisense strand having a 3' extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise uracil or thymidine nucleotides or nucleotides that are complementary to the corresponding FXII mRNA sequence. In some embodiments, a 3' antisense strand extension includes or consists of one of the following sequences, but is not limited to: AUA, UGCUU, CUG, UG, UGCC, CUGCC, CGU, CUU, UGCCUA, CUGCCU, UGCCU, UGAUU, GCCUAU, T, TT, U, UU (each listed 5' 3').

In some embodiments, the 3' end of the antisense strand can include additional abasic residues (Ab). An "abasic residue" or "abasic site" is a nucleotide or nucleoside that lacks a nucleobase at the 1 ' position of the sugar. In some embodiments, Ab or AbAb can be added to the 3' end of the antisense strand. In some embodiments, the abasic residue(s) can be added as inverted abasic residues (invAb) (see Table 7). (See, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16). In some embodiments, a FXII RNAi agent comprises a sense strand having a 3' extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises adenosine, uracil, or thymidine nucleotides, AT dinucleotide, or nucleotides that correspond to nucleotides in the FXII mRNA sequence. In some embodiments, the 3' sense strand extension includes or consists of one of the following sequences, but is not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (each listed 5' to 3').

In some embodiments, the 3' end of the sense strand may include additional abasic residues. In some embodiments, UUAb, UAb, or Ab are added to the 3' end of the sense strand. In some embodiments, the one or more abasic residues added to the 3' end of the sense strand are inverted (invAb). In some embodiments, one or more inverted abasic residues or abasic sites may be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues or abasic sites at or near the terminal end or terminal ends of the sense strand of an RNAi agent allows for enhanced activity or other desired properties of an RNAi agent.

In some embodiments, an FXII RNAi agent comprises a sense strand having a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise uracil or adenosine nucleotides or nucleotides that correspond to nucleotides in the FXII mRNA sequence. In some embodiments, the sense strand 5' extension is one of the following sequences, but is not limited to: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (each listed 5' to 3'). A sense strand can have a 3' extension and/or a 5' extension.

In some embodiments, the 5' end of the sense strand can include one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, the one or more abasic residues added to the 5' end of the sense strand can be inverted (e.g., invAb). In some embodiments, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues at or near the terminal end or terminal ends of the sense strand of an RNAi agent may allow for enhanced activity or other desired properties of an RNAi agent. In some embodiments, an abasic (deoxyribose) residue can be replaced with a ribitol (abasic ribose) residue.

In some embodiments, the 3' end of the antisense strand core stretch sequence, or the 3' end of the antisense strand sequence, may include an inverted abasic residue (invAb (see Table 7)).

Examples of sequences used in forming FXII RNAi agents are provided in Tables 2, 3, 4, and 6. In some embodiments, an FXII RNAi agent antisense strand includes a sequence of any of the sequences in Tables 2, 3, or 6. In some embodiments, an FXII RNAi agent antisense strand includes the sequence of nucleotides (from 5' end 3' end) 1-17, 2-15, 2- 17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26, or 2-26, of any of the sequences in Table 2, Table 3, or Table 4. In certain embodiments, an FXII RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 4. In some embodiments, an FXII RNAi agent sense strand includes the sequence of any of the sequences in Tables 2, 3, or 5. In some embodiments, an FXII RNAi agent sense strand includes the sequence of nucleotides (from 5' end ~> 3' end) 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1-24, 1-25, 1-26, 2- 19, 2-20, 2-21, 2-22, 2-23, 2-24, 2-25, 2-26, 3-20, 3-21, 3-22, 3-23, 3-24, 3-25, 3-26, 4-21, 4-22, 4-23, 4-24, 4-25, 4-26, 5-22, 5-23, 5-24, 5-25, 5-26, 6-23, 6-24, 6-25, 2-26, 7-24, 7- 25, or 7-26, of any of the sequences in Tables 2, 4, or 6. In certain embodiments, an FXII RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 5.

In some embodiments, the sense and antisense strands of the RNAi agents described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the sense strand 5' end and the antisense strand 3' end of an RNAi agent form a blunt end. In some embodiments, the sense strand 3' end and the antisense strand 5' end of an RNAi agent form a blunt end. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt-ended. As used herein a blunt end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form a complementary base-pair). In some embodiments, the sense strand 5' end and the antisense strand 3' end of an RNAi agent form a frayed end. In some embodiments, the sense strand 3' end and the antisense strand 5' end of an RNAi agent form a frayed end. In some embodiments, both ends of an RNAi agent form a frayed end. In some embodiments, neither end of an RNAi agent is a frayed end. As used herein a frayed end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands from a pair (i.e., do not form an overhang) but are not complementary (i.e. form a non-complementary pair). As used herein, an overhang is a stretch of one or more unpaired nucleotides at the end of one strand of a double stranded RNAi agent. The unpaired nucleotides may be on the sense strand or the antisense strand, creating either 3' or 5' overhangs. In some embodiments, the RNAi agent contains: a blunt end and a frayed end, a blunt end and 5' overhang end, a blunt end and a 3' overhang end, a frayed end and a 5' overhang end, a frayed end and a 3' overhang end, two 5' overhang ends, two 3' overhang ends, a 5' overhang end and a 3' overhang end, two frayed ends, or two blunt ends.

Modified nucleotides, when used in various polynucleotide or oligonucleotide constructs, can preserve activity of the compound in cells while at the same time increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans upon administering of the polynucleotide or oligonucleotide construct.

In some embodiments, an FXII RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. In some embodiments, an FXII RNAi agent is prepared as a sodium salt. Such forms are within the scope of the inventions disclosed herein.

Modified Nucleotides

In some embodiments, an FXII RNAi agent contains one or more modified nucleotides. As used herein, a "modified nucleotide" is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides (represented herein as Ab), 2'-modified nucleotides, 3' to 3' linkages (inverted) nucleotides (represented herein as invdN, invN, invn), modified nucleobase-comprising nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seco nucleotide mimics (unlocked nucleobase analogues, represented herein as NU A or NU A), locked nucleotides (represented herein as NLNA or NLNA), 3'-0-methoxy (2' intemucleoside linked) nucleotides (represented herein as 3'-OMen), 2'-F-Arabino nucleotides (represented herein as NfANA or WANA), 5 '-Me, 2'-fluoro nucleotide (represented herein as 5Me-Nf), mo holino nucleotides, vinyl phosphonate deoxyribonucleotides (represented herein as vpdN), vinyl phosphonate containing nucleotides, and cyclopropyl phosphonate containing nucleotides (cPrpN). 2'-modified nucleotides (i.e. a nucleotide with a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-0-methyl nucleotides (represented herein as a lower case letter 'n' in a nucleotide sequence), 2'-deoxy-2'-fluoro nucleotides (represented herein as Nf, also represented herein as 2'-fluoro nucleotide), 2'-deoxy nucleotides (represented herein as dN), 2'-methoxyethyl (2'-0-2-methoxylethyl) nucleotides (represented herein as NM or 2'- MOE), 2'-amino nucleotides, and 2'-alkyl nucleotides. It is not necessary for all positions in a given compound to be uniformly modified. Conversely, more than one modification can be incorporated in a single FXII RNAi agent or even in a single nucleotide thereof. The FXII RNAi agent sense strands and antisense strands can be synthesized and/or modified by methods known in the art. Modification at one nucleotide is independent of modification at another nucleotide.

Modified nucleobases include synthetic and natural nucleobases. such as 5-substituted pynmidines. 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, (e.g., 2-aminopropyladenine, 5-propynyl uracil, or 5-propynylcytosine), 5-methylcytosine (5-me- C), 5 -hydroxy methyl cytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2- alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyl uracil, 5-propynyl cytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, -uracil (pseudouracil), 4-thiouracil. 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, -halo (e.g., 5-bromo). 5-trifiuoro methyl, and other 5-substituted uracils and cytosines. 7-methylguanine and 7-methyladenine. 8- azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3- deazaadenine.

In some embodiments, all or substantially all of the nucleotides of an RN Ai agent are modified nucleotides. As used herein, an RNAi agent wherein substantially all of the nucleotides present are modified nucleotides is an R Ai agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand being ribonucleotides (i.e.. unmodified). As used herein, a sense strand wherein substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1 , or 2) nucleotides in the sense strand being ribonucleotides. As used herein, an antisense sense strand wherein substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e.. 0, 1, or 2) nucleotides in the sense strand bein ribonucleotides. In some embodiments, one or more nucleotides of an RNAi agent is a ribonucleotide. Modified Intemucleoside Linkages

In some embodiments, one or more nucleotides of an FXII RNAi agent are linked by nonstandard linkages or backbones (i.e., modified intemucleoside linkages or modified backbones). Modified intemucleoside linkages or backbones include, but are not limited to, 5'-phosphorothioate groups (represented herein as a lower case "s"), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl- phosphotriesters, alkyl phosphonates (e.g., methyl phosphonates or 3'-alkylene phosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-amino phosphoramidate, aminoalkylphosphoramidates, or thionophosphoramidates), thionoalkyl- phosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of boranophosphates, or boranophosphates having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3 '-5' to 5'- 3' or 2'-5' to 5'-2'. In some embodiments, a modified intemucleoside linkage or backbone lacks a phosphorus atom. Modified intemucleoside linkages lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl inter-sugar linkages, mixed heteroatom and alkyl or cycloalkyl inter-sugar linkages, or one or more short chain heteroatomic or heterocyclic inter-sugar linkages. In some embodiments, modified intemucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methylene formacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 components.

In some embodiments, a sense strand of an FXII RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, an antisense strand of an FXII RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, a sense strand of an FXII RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, an antisense strand of an FXII RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, or 4 phosphorothioate linkages. In some embodiments, an FXII RNAi agent sense strand contains at least two phosphorothioate intemucleoside linkages. In some embodiments, the at least two phosphorothioate intemucleoside linkages are between the nucleotides at positions 1-3 from the 3' end of the sense strand. In some embodiments, the at least two phosphorothioate intemucleoside linkages are between the nucleotides at positions 1-3, 2-4, 3-5, 4-6, 4-5, or 6-8 from the 5' end of the sense strand. In some embodiments, an FXII RNAi agent antisense strand contains four phosphorothioate intemucleoside linkages. In some embodiments, the four phosphorothioate intemucleoside linkages are between the nucleotides at positions 1-3 from the 5' end of the antisense strand and between the nucleotides at positions 19-21, 20- 22, 21-23, 22-24, 23-25, or 24-26 from the 5' end. In some embodiments, an FXII RNAi agent contains at least two phosphorothioate intemucleoside linkages in the sense strand and three or four phosphorothioate intemucleoside linkages in the antisense strand.

In some embodiments, an FXII RNAi agent contains one or more modified nucleotides and one or more modified intemucleoside linkages. In some embodiments, a 2'-modified nucleoside is combined with modified intemucleoside linkage.

FXII RNAi Agents

In some embodiments, the FXI I R Ai agents disclosed herein target an FXII gene at or near the positions of the FXI I sequence shown in Table 1. In some embodiments, the antisense strand of an FXII RNAi agent disclosed herein includes a core stretch sequence that is fully, substantially, or at least partially complementary to a target FXII 19-nier sequence disclosed in Table 1 .

Table 1. FXII 19-mer mRNA Target Sequences (taken from homo sapiens coagulation factor XII (F12) cDNA, GenBank NM_000505.3 (SEQ ID NO: 1)).

In some embodiments, an FXI I RNAi agent includes an antisense strand wherein position 19 of the antisense strand (5'->3') is capable of forming a base pai r with position 1 of a 19- mer target sequence disclosed in Table 1. In some embodiments, an FXII RNAi agent includes an antisense strand w herein position 1 of the antisense strand (5'- 3') is capable of forming a base pair with position 19 of the 19-mer target sequence disclosed in Table 1. In some embodiments, an FXI I RNAi agent includes an antisense strand w herein position 2 of the antisense strand (5 ' - 3 ') is capable of forming a base pair with position 18 of the 19- mer target sequence disclosed in Table 1. In some embodiments, an FXII RNAi agent includes an antisense strand wherein positions 2 through 1 of the antisense strand (5' -> 3') are capable of forming base pairs with each of the respective complementary bases located at positions 18 through 2 of the 19-mer target sequence disclosed in Table 1 .

For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5' end - 3' end) can be perfectly complementary to the FXI I gene, or can be non- complementary to the FXII gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5' end -> 3' end) is a U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5' end - 3' end) forms an A:U or U:A base pair with the sense strand.

In some embodiments, an FXII RNAi agent antisense strand comprises the sequence of nucleotides (from 5' end - 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3, or Table 6. In some embodiments, an FXII RNAi sense strand comprises the sequence of nucleotides (from 5' end -> 3' end) 1-17, 1-18, or 2-18 of any of the sense strand sequences in Table 2, Table 4, or Table 6. In some embodiments, an FXII RNAi agent is comprised of (i) an antisense strand comprising the sequence of nucleotides (from 5' end -> 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3, or Table 6, and (ii) a sense strand comprising the sequence of nucleotides (from 5' end -> 3' end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 4, or Table 6.

In some embodi ments, the FXII RNAi agents include core 1 -mer nucleotide sequences shown in the following Table 2. Table 2. Example F12 RNAi Agent Antisense Strand and Sense Strand Core Stretch Base Sequences (N=any nucleobase).

SEQ ID NO: Antisense Base Sequence SEQ ID NO: Sense Base Sequence Corresponding

(5'→3') (5'→3') Positions on

SEQ ID NO: 1

23 UUUGUACUUAUGCUCCUUG 96 CAAGGAGCAUAAGUACAAA 127-145

24 NUUGUACUUAUGCUCCUUG 97 CAAGGAGCAUAAGUACAAN 127-145

25 NUUGUACUUAUGCUCCUUN 98 NAAGGAGCAUAAGUACAAN 127-145

26 AUCGAAAGUGUUGACUCCA 99 UGGAGUCAACACUUUCGAU 90-108

27 UUCGAAAGUGUUGACUCCA 100 UGGAGUCAACACUUUCGAA 90-108

28 NUCGAAAGUGUUGACUCCA 101 UGGAGUCAACACUUUCGAN 90-108

29 NUCGAAAGUGUUGACUCCN 102 NGGAGUCAACACUUUCGAN 90-108

30 AAUCGAAAGUGUUGACUCC 103 GGAGUCAACACUUUCGAUU 91-109

31 UAUCGAAAGUGUUGACUCC 104 GGAGUCAACACUUUCGAUA 91-109

32 NAUCGAAAGUGUUGACUCC 105 GGAGUCAACACUUUCGAUN 91-109

33 NAUCGAAAGUGUUGACUCN 106 NGAGUCAACACUUUCGAUN 91-109

34 UGUACUUAUGCUCCUUGGG 107 CCCAAGGAGCAUAAGUACA 125-143

35 NGUACUUAUGCUCCUUGGG 108 CCCAAGGAGCAUAAGUACN 125-143

36 NGUACUUAUGCUCCUUGGN 109 NCCAAGGAGCAUAAGUACN 125-143

37 UUGUACUUAUGCUCCUUGG 110 CCAAGGAGCAUAAGUACAA 126-144

38 NUGUACUUAUGCUCCUUGG 111 CCAAGGAGCAUAAGUACAN 126-144

39 NUGUACUUAUGCUCCUUGN 112 NCAAGGAGCAUAAGUACAN 126-144

40 CUUUGUACUUAUGCUCCUU 113 AAGGAGCAUAAGUACAAAG 128-146

41 UUUUGUACUUAUGCUCCUU 114 AAGGAGCAUAAGUACAAAA 128-146

42 NUUUGUACUUAUGCUCCUU 115 AAGGAGCAUAAGUACAAAN 128-146

43 NUUUGUACUUAUGCUCCUN 116 NAGGAGCAUAAGUACAAAN 128-146

44 UCAGCUUUGUACUUAUGCU 117 AGCAUAAGUACAAAGCUGA 132-150

45 NCAGCUUUGUACUUAUGCU 118 AGCAUAAGUACAAAGCUGN 132-150

46 NCAGCUUUGUACUUAUGCN 119 NGCAUAAGUACAAAGCUGN 132-150

47 CUUGUGGGUACAUUUGUGG 120 CCACAAAUGUACCCACAAG 223-241

SEQ ID NO: Antisense Base Sequence SEQ ID NO: Sense Base Sequence Corresponding

(5'→3') (5'→3') Positions on

SEQ ID NO: 1

48 UUUGUGGGUACAUUUGUGG 121 CCACAAAUGUACCCACAAA 223 ■241

49 NUUGUGGGUACAUUUGUGG 122 CCACAAAUGUACCCACAAN 223 ■241

50 NUUGUGGGUACAUUUGUGN 123 NCACAAAUGUACCCACAAN 223 ■241

51 UGGUCUUUCACUUUCUUGG 124 CCAAGAAAGUGAAAGACCA 321 ■339

52 NGGUCUUUCACUUUCUUGG 125 CCAAGAAAGUGAAAGACCN 321 ■339

53 NGGUCUUUCACUUUCUUGN 126 NCAAGAAAGUGAAAGACCN 321 ■339

54 ACCUCUAGGCAGCGACCCC 127 GGGGUCGCUGCCUAGAGGU 666 ■684

55 UCCUCUAGGCAGCGACCCC 128 GGGGUCGCUGCCUAGAGGA 666 ■684

56 NCCUCUAGGCAGCGACCCC 129 GGGGUCGCUGCCUAGAGGN 666 ■684

57 NCCUCUAGGCAGCGACCCN 130 NGGGUCGCUGCCUAGAGGN 666 ■684

58 UCGUUGUCCGGGUUCCGGC 131 GCCGGAACCCGGACAACGA 846 ■864

59 NCGUUGUCCGGGUUCCGGC 132 GCCGGAACCCGGACAACGN 846 ■864

60 NCGUUGUCCGGGUUCCGGN 133 NCCGGAACCCGGACAACGN 846 ■864

61 UGUCGUUGUCCGGGUUCCG 134 CGGAACCCGGACAACGACA 848 ■866

62 NGUCGUUGUCCGGGUUCCG 135 CGGAACCCGGACAACGACN 848 ■866

63 NGUCGUUGUCCGGGUUCCN 136 NGGAACCCGGACAACGACN 848 ■866

64 AUGUCGUUGUCCGGGUUCC 137 GGAACCCGGACAACGACAU 849 ■867

65 UUGUCGUUGUCCGGGUUCC 138 GGAACCCGGACAACGACAA 849 ■867

66 NUGUCGUUGUCCGGGUUCC 139 GGAACCCGGACAACGACAN 849 ■867

67 NUGUCGUUGUCCGGGUUCN 140 NGAACCCGGACAACGACAN 849 ■867

68 AGACAGACUCUUGCGGAGC 141 GCUCCGCAAGAGUCUGUCU 1135 ■1153

69 UGACAGACUCUUGCGGAGC 142 GCUCCGCAAGAGUCUGUCA 1135 ■1153

70 NGACAGACUCUUGCGGAGC 143 GCUCCGCAAGAGUCUGUCN 1135 ■1153

71 NGACAGACUCUUGCGGAGN 144 NCUCCGCAAGAGUCUGUCN 1135 ■1153

72 UCGAAGACAGACUCUUGCG 145 CGCAAGAGUCUGUCUUCGA 1139 ■1157

73 NCGAAGACAGACUCUUGCG 146 CGCAAGAGUCUGUCUUCGN 1139 ■1157

74 NCGAAGACAGACUCUUGCN 147 NGCAAGAGUCUGUCUUCGN 1139 ■1157

SEQ ID NO: Antisense Base Sequence SEQ ID NO: Sense Base Sequence Corresponding

(5'→3') (5'→3') Positions on

SEQ ID NO: 1

75 ACGUAAGGCGACAGGAGCG 148 CGCUCCUGUCGCCUUACGU 1476 ■1494

76 UCGUAAGGCGACAGGAGCG 149 CGCUCCUGUCGCCUUACGA 1476 ■1494

77 NCGUAAGGCGACAGGAGCG 150 CGCUCCUGUCGCCUUACGN 1476 ■1494

78 NCGUAAGGCGACAGGAGCN 151 NGCUCCUGUCGCCUUACGN 1476 ■1494

79 AACGUAAGGCGACAGGAGC 152 GCUCCUGUCGCCUUACGUU 1477 ■1495

80 UACGUAAGGCGACAGGAGC 153 GCUCCUGUCGCCUUACGUA 1477 ■1495

81 NACGUAAGGCGACAGGAGC 154 GCUCCUGUCGCCUUACGUN 1477 ■1495

82 N AC GU AAGGC GAC AGGAGN 155 NCUCCUGUCGCCUUACGUN 1477 ■1495

83 UAGACGCCUGGCUUGUUGC 156 GCAACAAGCCAGGCGUCUA 1827 ■1845

84 NAGACGCCUGGCUUGUUGC 157 GCAACAAGCCAGGCGUCUN 1827 ■1845

85 NAGACGCCUGGCUUGUUGN 158 NCAACAAGCCAGGCGUCUN 1827 ■1845

86 AAAGCACUUUAUUGAGUUC 159 GAACUCAAUAAAGUGCUUU 2019 ■2037

87 UAAGCACUUUAUUGAGUUC 160 GAACUCAAUAAAGUGCUUA 2019 ■2037

88 NAAGCACUUUAUUGAGUUC 161 GAACUCAAUAAAGUGCUUN 2019 ■2037

89 NAAGCACUUUAUUGAGUUN 162 NAACUCAAUAAAGUGCUUN 2019 ■2037

90 UUCAAAGCACUUUAUUGAG 163 CUCAAUAAAGUGCUUUGAA 2022 ■2040

91 NUCAAAGCACUUUAUUGAG 164 CUCAAUAAAGUGCUUUGAN 2022 ■2040

92 NUCAAAGCACUUUAUUGAN 165 NUCAAUAAAGUGCUUUGAN 2022 ■2040

93 UUUCAAAGCACUUUAUUGA 166 UCAAUAAAGUGCUUUGAAA 2023 ■2041

94 NUUCAAAGCACUUUAUUGA 167 UCAAUAAAGUGCUUUGAAN 2023 ■2041

95 NUUCAAAGCACUUUAUUGN 168 NCAAUAAAGUGCUUUGAAN 2023 ■2041

The FX 11 RNAi agent sense strands and antisense strands that comprise or consist of the nucleotide sequences in Table 2 can be modified nucleotides or unmodified nucleotides. In some embodiments, the FX 11 RNAi agents having the sense and antisense strand sequences that comprise or consist of any of the nucleotide sequences in Table 2 are all or substantially all modified nucleotides.

In some embodiments, the antisense strand of an FX 11 RNAi agent disclosed herein differs by 0, 1. 2. or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of an FXI I RNAi agent disclosed herein di ffers by 0, I . 2. or 3 nucleotides from any of the sense strand sequences in Table 2.

As used herein, each N listed in a sequence disclosed in Table 2 may be independently selected. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is the same as the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is different from the N nucleotide at the corresponding position on the other strand.

Certain modified FXII RN Ai agent sense and antisense strands are provided in Table 3 and Table 4. Modified FX 11 RNAi agent antisense strands, as well as their underlying unmodi fied nucleobase sequences, are provided in Table 3. Modified FXI I RNAi agent sense strands, as well as their underlying unmodified sequences, are provided in Table 4. In forming FXII RNAi agents, each of the nucleotides in each of the underlying base sequences listed in Tables 3 and 4, as well as in Table 2. above, can be a modified nucleotide. The FXI I RN Ai agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 3, or Table 6, can be hybridized to any antisense strand containing a sequence listed in Table 2, Table 4, or Table 6, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.

In some embodiments, an FXI I RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2, Table 3, or Table 6.

In some embodiments, an FXII RNAi agent comprises or consists of a duplex having the nucleobase sequences of the sense strand and the antisense strand of any of the sequences in Table 2, Table 3, Table 4, or Table 6. Examples of antisense strands containing modified nucleotides are provided in Table 3. Examples of sense strands containing modified nucleotides are provided in Table 4.

As used in Tables 3 and 4, the following notations are used to indicate modified nucleotides, targeting groups, and linking groups. As the person of ordinary skill in the art would readily understand, unless otherwise indicated by the sequence, that when present in an oligonucleotide, the monomers are mutually linked by 5'-3'-phosphodiester bonds:

A = adenosine-3'-phosphate;

C = cytidine-3 '-phosphate;

G = guanosine-3 '-phosphate;

U = uridine-3'-phosphate

n = any 2'-OMe modified nucleotide

a = 2'-0-methyladenosine-3'-phosphate

as = 2'-0-methyladenosine-3'-phosphorothioate

c = 2'-0-methylcytidine-3'-phosphate

cs = 2'-0-methylcytidine-3'-phosphorothioate

g = 2'-0-methylguanosine-3 '-phosphate

gs = 2'-0-methylguanosine-3'-phosphorothioate

t = 2'-0-methyl-5-methyluridine-3'-phosphate

ts = 2'-0-methyl-5-methyluridine-3'-phosphorothioate

u = 2'-0-methyluridine-3 '-phosphate

us = 2'-0-methyluridine-3'-phosphorothioate

Nf = any 2'-fluoro modified nucleotide

Af = 2'-fluoroadenosine-3 '-phosphate

Afs = 2'-fluoroadenosine-3'-phosporothioate

Cf = 2'-fluorocytidine-3 '-phosphate

Cfs = 2'-fluorocytidine-3'-phosphorothioate Gf = 2'-fluoroguanosine-3 '-phosphate

Gfs = 2'-fluoroguanosine-3'-phosphorothioate

Tf = 2'-fluoro-5'-methyluridine-3 '-phosphate

Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate

Uf = 2'-fluorouridine-3 '-phosphate

Ufs = 2'-fluorouridine-3'-phosphorothioate

dN = any 2'-deoxyribonucleotide

dT = 2'-deoxythymidine-3'-phosphate

NUNA = 2',3'-seco nucleotide mimics (unlocked nucleobase analogs)-3'- Phosphate

NUNAS = 2',3'-seco nucleotide mimics (unlocked nucleobase analogs)-3'- phosphorothioate

UUNA = 2',3'-seco-uridine-3'-phosphate

UUNAS = 2',3'-seco-uridine-3'-phosphorothioate

a_2N = see Table 7

a_2Ns = see Table 7

pu_2N = see Table 7

pu_2Ns = see Table 7

Npu = see Table 7

Nus = see Table 7

NLNA = locked nucleotide

NfANA = 2'-F-Arabino nucleotide

NM = 2'-methoxyethyl nucleotide

AM = 2'-methoxyethyladenosine-3'-phosphate

AMs = 2'-methoxyethyladenosine-3'-phosphorothioate

TM = 2'-methoxyethylthymidine-3 '-phosphate

TMs = 2'-methoxyethylthymidine-3'-phosphorothioate

R = ribitol

(invdN) = any inverted deoxyribonucleotide (3 '-3' linked nucleotide) (invAb) = inverted (3 '-3' linked) abasic deoxyribonucleotide, see Table 7

(invAb)s = inverted (3'-3' linked) abasic deoxyribonucleotide-5'- phosphorothioate, see Table 7

(invn) = any inverted 2'-OMe nucleotide (3'-3' linked nucleotide) s = phosphorothioate linkage

vpdN = vinyl phosphonate deoxyribonucleotide

(5Me-Nf) = 5'-Me, 2'-fluoro nucleotide

cPrp = cyclopropyl phosphonate, see Table 7

epTcPr = see Table 7

epTM = see Table 7

(Chol-TEG) = see Table 7 (TEG-Biotin) = see Table 7

(PEG-C3-SS) = see Table 7

(Alk-SS-C6) = see Table 7

(C6-SS-Alk) = see Table 7

(C6-SS-Alk-Me) = see Table 7

The person of ordinary skill in the art would readily understand that the terminal nucleotide at the 3' end of a given oligonucleotide sequence would typically have a hydroxyl (-OH) group at the respective 3' position of the given monomer instead of a phosphate moiety ex vivo. Unless expressly indicated otherwise herein, such understandings of the person of ordinary skill in the art are used when describing the FX 11 RNAi agents and compositions of FX 11 RNAi agents disclosed herein.

Targeting groups and linking groups include the following, for which their chemical structures are provided below in Table 7: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. Each sense strand and/or antisense strand can have any targeting groups or linking groups listed above, as well as other targeting or linking groups, conjugated to the 5' and/or 3' end of the sequence.

Table 3. FXII RNAi Agent Antisense Strand Sequences.

Antisense Strand SEQ ID Antisense Sequence SEQ ID Underlying Antisense Base Sequence ID: NO. (Modified) NO. (5'→3')

(5'→3')

AM03157-AS 169 usGfsgucuuUfcAfcuuUfcuugggcsuscuAu 744 UGGUCUUUCACUUUCUUGGGCUCUAU

AM03844-SS 170 (NAG18)gcgaugscsccaagaAfaGfugaaagacc(invdA) 671 GCGAUGCCCAAGAAAGUGAAAGACCA

AM03965-AS 171 usGfsgucuuUfcAfcuuUfcuugggcsusc 739 UGGUCUUUCACUUUCUUGGGCUC

AM03977-AS 172 usGfsgsucuuUfcAfcuuUfcuuggusu 751 UGGUCUUUCACUUUCUUGGUU

AM04047-AS 173 usGfsgucuuUfcAfcuuUfcuugggcsasuuca 736 UGGUCUUUCACUUUCUUGGGCAUUCA

AM04048-AS 174 usGfsgucuuUfcAfcuuUfcuugggcsasucgc 735 UGGUCUUUCACUUUCUUGGGCAUCGC

AM04516-AS 175 usGfsgucuuUfcAfcuuucuugggcsuscuau 744 UGGUCUUUCACUUUCUUGGGCUCUAU

AM04568-AS 176 usGfsgucuuUfcAfcuuUfcuugggcsuscgc 743 UGGUCUUUCACUUUCUUGGGCUCGC

AM04569-AS 177 usGfsgucuuUfcAfcuuUfcuuggsgsc 724 UGGUCUUUCACUUUCUUGGGC

AM04570-AS 178 usGfsgucuuUfcAfcuuUfcuugggcsuscGc 743 UGGUCUUUCACUUUCUUGGGCUCGC

AM04571-AS 179 usGfsgucuuUfcAfcuuUfcuugggcsusuAu 747 UGGUCUUUCACUUUCUUGGGCUUAU

AM04575-AS 180 usCfsaCfcUfuCfuUfgGfgCfuCfcAfaAfcsascgc 684 UCACCUUCUUGGGCUCCAAACACGC

AM04576-AS 181 usCfsaCfcUfuCfuUfgGfgCfuCfcAfaAfcsasc 683 UCACCUUCUUGGGCUCCAAACAC

AM04577-AS 182 usCfsaCfcUfuCfuUfgGfgCfuCfcAfasasc 682 UCACCUUCUUGGGCUCCAAAC

AM04593-AS 183 usGfsgucuuUfcAfcuuUfcuugggcsusu 746 UGGUCUUUCACUUUCUUGGGCUU

AM04595-AS 184 usGfsgsUfcUfuUfcAfcUfuUfCfuuGfgGfcgusu 737 UGGUCUUUCACUUUCUUGGGCGUU

AM04601-AS 185 usGfsgsUfcUfuUfcAfcUfuUfCfuuGfgusu 751 UGGUCUUUCACUUUCUUGGUU

AM04603-AS 186 usGfsgsUfcUfuUfcAfcUfuUfCfuuGfgGfsu 748 UGGUCUUUCACUUUCUUGGGU

AM04606-AS 187 usGfsgsUfcUfuUfcAfcUfUfuCfuuGfgusu 751 UGGUCUUUCACUUUCUUGGUU

AM04607-AS 188 usGfsgsUfcUfuUfcAfcUfUfucuuGfgusu 751 UGGUCUUUCACUUUCUUGGUU

AM04619-AS 189 uusGfsgucuuUfcAfcuuUfcuugggcsuscgc 779 UUGGUCUUUCACUUUCUUGGGCUCGC

AM04620-AS 190 ususGfsgucuuUfcAfcuuUfcuugggcsuscgc 779 UUGGUCUUUCACUUUCUUGGGCUCGC

AM04841-AS 191 usGfsgucuuUfcAfcUfuUfcuugggcsasucgc 735 UGGUCUUUCACUUUCUUGGGCAUCGC

Antisense Strand SEQ ID Antisense Sequence SEQ ID Underlying Antisense Base Sequence ID: NO. (Modified) NO. (5'→3')

(5'→3')

AM04842-AS 192 usGfsgucuuUfCfacuuUfcuugggcsasucgc 735 UGGUCUUUCACUUUCUUGGGCAUCGC

AM04843-AS 193 usGfsgucuuUfCfacUfuUfcuugggcsasucgc 735 UGGUCUUUCACUUUCUUGGGCAUCGC

AM04844-AS 194 usGfsgucuuUfcAfcuuUfcuugggcsasu 733 UGGUCUUUCACUUUCUUGGGCAU

AM04903-AS 195 usCfsusUfuCfaCfuUfuCfuUfgGfgCfuCfcasauca 695 UCUUUCACUUUCUUGGGCUCCAAUCA

AM04905-AS 196 usCfsusUfuCfaCfuUfuCfuUfgGfgCfuusu 697 UCUUUCACUUUCUUGGGCUUU

AM04906-AS 197 usCfsusUfuCfaCfuUfuCfuUfgGfgCfuCfcusu 696 UCUUUCACUUUCUUGGGCUCCUU

AM04907-AS 198 usGfsusCfuUfuCfaCfuUfuCfuUfgGfgCfucscuca 760 UGUCUUUCACUUUCUUGGGCUCCUCA

AM04909-AS 199 usGfsusCfuUfuCfaCfuUfuCfuUfgGfgusu 762 UGUCUUUCACUUUCUUGGGUU

AM04910-AS 200 usGfsusCfuUfuCfaCfuUfuCfuUfgGfgCfuusu 761 UGUCUUUCACUUUCUUGGGCUUU

AM04911-AS 201 usUfsgsGfuCfuUfuCfaCfuUfuCfuUfgGfgcsuuca 780 UUGGUCUUUCACUUUCUUGGGCUUCA

AM04913-AS 202 usUfsgsGfuCfuUfuCfaCfuUfuCfuUfgusu 782 UUGGUCUUUCACUUUCUUGUU

AM04914-AS 203 usUfsgsGfuCfuUfuCfaCfuUfuCfuUfgGfgusu 781 UUGGUCUUUCACUUUCUUGGGUU

AM04915-AS 204 usGfsasAfgCfuGfaGfgCfuCfaAfaGfcAfcusuuca 706 UGAAGCUGAGGCUCAAAGCACUUUCA

AM04917-AS 205 usGfsasAfgCfuGfaGfgCfuCfaAfaGfcusu 707 UGAAGCUGAGGCUCAAAGCUU

AM04918-AS 206 usGfsasAfgCfuGfaGfgCfuCfaAfaGfcAfcusu 704 UGAAGCUGAGGCUCAAAGCACUU

AM04919-AS 207 usGfsasGfaAfgCfuGfaGfgCfuCfaAfaGfcascuca 714 UGAGAAGCUGAGGCUCAAAGCACUCA

AM04921-AS 208 usGfsasGfaAfgCfuGfaGfgCfuCfaAfausu 716 UGAGAAGCUGAGGCUCAAAUU

AM04922-AS 209 usGfsasGfaAfgCfuGfaGfgCfuCfaAfaGfcusu 715 UGAGAAGCUGAGGCUCAAAGCUU

AM04923-AS 210 usUfsusUfuCfaAfaGfcAfcUfuUfaUfuGfagsuuca 821 UUUUUCAAAGCACUUUAUUGAGUUCA

AM04925-AS 211 usUfsusUfuCfaAfaGfcAfcUfuUfaUfuusu 825 UUUUUCAAAGCACUUUAUUUU

AM04926-AS 212 usUfsusUfuCfaAfaGfcAfcUfuUfaUfuGfausu 822 UUUUUCAAAGCACUUUAUUGAUU

AM04927-AS 213 usGfsgsUfcUfuUfcAfcUfuUfcUfuGfgGfcuscuca 745 UGGUCUUUCACUUUCUUGGGCUCUCA

AM04929-AS 214 usGfsgsUfcUfuUfcAfcUfuUfcUfuGfgusu 751 UGGUCUUUCACUUUCUUGGUU

AM04930-AS 215 usGfsgsUfcUfuUfcAfcUfuUfcUfuGfgGfcusu 746 UGGUCUUUCACUUUCUUGGGCUU

Antisense Strand SEQ ID Antisense Sequence SEQ ID Underlying Antisense Base Sequence ID: NO. (Modified) NO. (5'→3')

(5'→3')

AM04932-AS 216 usGfsgsucuuUfcAfcuuUfcuugggcuscuca 745 UGGUCUUUCACUUUCUUGGGCUCUCA

AM04936-AS 217 usGfsgucuuUfcAfcuuUfcuugggcuscsuca 745 UGGUCUUUCACUUUCUUGGGCUCUCA

AM04938-AS 218 usGfsgucuuUfcAfcuuUfcuugggcsascuau 731 UGGUCUUUCACUUUCUUGGGCACUAU

AM04941-AS 219 usGf sgucuuUf c AfcuuUf cuugggcs as cuca 732 UGGUCUUUCACUUUCUUGGGCACUCA

AM04943-AS 220 usGfsgucuuUfcAfcuuUfcuugggcsasccgc 728 UGGUCUUUCACUUUCUUGGGCACCGC

AM04945-AS 221 usGfsgUfcUfuUfcAfcUfuUfcUfuGfgGfcsascuca 732 UGGUCUUUCACUUUCUUGGGCACUCA

AM04947-AS 222 usGfsgUfcUfuUfcAfcUfuUfcUfuGfgGfcsasccgc 728 UGGUCUUUCACUUUCUUGGGCACCGC

AM04949-AS 223 usGfsgUfcUfuUfcAfcUfuUfcUfuGfgGfcsascuau 731 UGGUCUUUCACUUUCUUGGGCACUAU

AM04951-AS 224 usGfsgucuuUfcAfcuuUfcuugggcsasccaa 726 UGGUCUUUCACUUUCUUGGGCACCAA

AM04953-AS 225 usGfsgucuuUfcAfcuuUfcuugggcsasccuu 730 UGGUCUUUCACUUUCUUGGGCACCUU

AM04955-AS 226 usGfsgucuuUfcAfcuuUfcuugggcsasccac 727 UGGUCUUUCACUUUCUUGGGCACCAC

AM04957-AS 227 usGfsgucuuUfcAfcuuUfcuugggcsasccuc 729 UGGUCUUUCACUUUCUUGGGCACCUC

AM04959-AS 228 usGfsgsucuuUfcAfcuuUfcuugggcusu 746 UGGUCUUUCACUUUCUUGGGCUU

AM04996-AS 229 usGfsgsUfcUfuUfcAfcUfuUfcUfuGfgGfsc 724 UGGUCUUUCACUUUCUUGGGC

AM05002-AS 230 usGfsgsUfcUfuUfcAfcUfuUfcUfuGfgGfcasuc 734 UGGUCUUUCACUUUCUUGGGCAUC

AM05003-AS 231 usGfsgsUfcUfuUfcAfcUfuUfcUfuGfgGfscauc 734 UGGUCUUUCACUUUCUUGGGCAUC

AM05005-AS 232 usGfsgsUfcUfuUfcAfcUfuUfCfuuGfgGfsuuu 749 UGGUCUUUCACUUUCUUGGGUUU

AM05006-AS 233 usGfsgsUfcUfuUfcAfcUfuUfCfuuGfgGfsa 723 UGGUCUUUCACUUUCUUGGGA

AM05038-AS 234 usGfsgsUfcUfuUfcAfcUfuUfcAfuGfgGfsu 719 UGGUCUUUCACUUUCAUGGGU

AM05040-AS 235 usGfsgsUfcUfuUfcAfcUfuUfcAfuGfggsu 719 UGGUCUUUCACUUUCAUGGGU

AM05042-AS 236 asGfsgsUfcUfuUfcAfcUfuUfcAfuGfggsu 664 AGGUCUUUCACUUUCAUGGGU

AM05043-AS 237 usGfsgsUfcUfuUfcAfcUfuUfcAfuGfgGfsuuu 720 UGGUCUUUCACUUUCAUGGGUUU

AM05066-AS 238 usGfsgsUfcUfuUfcAfcUfuUfcUfuGfgGfsu 748 UGGUCUUUCACUUUCUUGGGU

AM05093-AS 239 usCfuUfuCfaCfuUfuCfuUfgGfgCfuCfcAfasa 694 UCUUUCACUUUCUUGGGCUCCAAA

Antisense Strand SEQ ID Antisense Sequence SEQ ID Underlying Antisense Base Sequence ID: NO. (Modified) NO. (5'→3')

(5'→3')

AM05095-AS 240 usCfuUfuCfaCfuUfuCfuUfgGfgCfuCfcasa 693 UCUUUCACUUUCUUGGGCUCCAA

AM05097-AS 241 usCfuUfuCfaCfuUfuCfuUfgGfgCfuCfcsa 692 UCUUUCACUUUCUUGGGCUCCA

AM05099-AS 242 usCfuUfuCfaCfuUfuCfuUfgGfgCfucsc 691 UCUUUCACUUUCUUGGGCUCC

AM05101-AS 243 usCfuUfuCfaCfuUfuCfuUfgGfgCfusc 690 UCUUUCACUUUCUUGGGCUC

AM05103-AS 244 usCfuUfuCfaCfuUfuCfuUfgGfgcsu 689 UCUUUCACUUUCUUGGGCU

AM05105-AS 245 usGfuCfuUfuCfaCfuUfuCfuUfgGfgCfuCfcsa 759 UGUCUUUCACUUUCUUGGGCUCCA

AM05107-AS 246 usGfuCfuUfuCfaCfuUfuCfuUfgGfgCfucsc 758 UGUCUUUCACUUUCUUGGGCUCC

AM05109-AS 247 usGfuCfuUfuCfaCfuUfuCfuUfgGfgCfusc 757 UGUCUUUCACUUUCUUGGGCUC

AM05111-AS 248 usGfuCfuUfuCfaCfuUfuCfuUfgGfgcsu 756 UGUCUUUCACUUUCUUGGGCU

AM05113-AS 249 usGfuCfuUfuCfaCfuUfuCfuUfgGfgsc 755 UGUCUUUCACUUUCUUGGGC

AM05115-AS 250 usGfuCfuUfuCfaCfuUfuCfuUfggsg 754 UGUCUUUCACUUUCUUGGG

AM05117-AS 251 usGfgUfcUfuUfcAfcUfuUfcUfuGfgGfcUfcCfasa 741 UGGUCUUUCACUUUCUUGGGCUCCAA

AM05120-AS 252 usGfgUfcUfuUfcAfcUfuUfcUfuGfgGfcUfcsc 740 UGGUCUUUCACUUUCUUGGGCUCC

AM05122-AS 253 usGfgUfcUfuUfcAfcUfuUfcUfuGfgGfcUfsc 739 UGGUCUUUCACUUUCUUGGGCUC

AM05124-AS 254 usGfgUfcUfuUfcAfcUfuUfcUfuGfgGfcsu 738 UGGUCUUUCACUUUCUUGGGCU

AM05126-AS 255 usGfgUfcUfuUfcAfcUfuUfcUfuGfggsc 724 UGGUCUUUCACUUUCUUGGGC

AM05128-AS 256 usGfgUfcUfuUfcAfcUfuUfcUfuGfgsg 722 UGGUCUUUCACUUUCUUGGG

AM05130-AS 257 usGfgUfcUfuUfcAfcUfuUfcUfugsg 721 UGGUCUUUCACUUUCUUGG

AM05132-AS 258 usUfgGfuCfuUfuCfaCfuUfuCfuUfgGfgCfusc 778 UUGGUCUUUCACUUUCUUGGGCUC

AM05134-AS 259 usUfgGfuCfuUfuCfaCfuUfuCfuUfgGfgcsu 777 UUGGUCUUUCACUUUCUUGGGCU

AM05136-AS 260 usUfgGfuCfuUfuCfaCfuUfuCfuUfgGfgsc 776 UUGGUCUUUCACUUUCUUGGGC

AM05138-AS 261 usUfgGfuCfuUfuCfaCfuUfuCfuUfggsg 775 UUGGUCUUUCACUUUCUUGGG

AM05140-AS 262 usUfgGfuCfuUfuCfaCfuUfuCfuUfgsg 774 UUGGUCUUUCACUUUCUUGG

AM05142-AS 263 usUfgGfuCfuUfuCfaCfuUfuCfuusg 773 UUGGUCUUUCACUUUCUUG

Antisense Strand SEQ ID Antisense Sequence SEQ ID Underlying Antisense Base Sequence ID: NO. (Modified) NO. (5'→3')

(5'→3')

AM05144-AS 264 usGfaAfgCfuGfaGfgCfuCfaAfaGfcAfcUfusc 705 UGAAGCUGAGGCUCAAAGCACUUC

AM05146-AS 265 usGfaAfgCfuGfaGfgCfuCfaAfaGfcAfcusu 704 UGAAGCUGAGGCUCAAAGCACUU

AM05148-AS 266 usGfaAfgCfuGfaGfgCfuCfaAfaGfcAfcsu 703 UGAAGCUGAGGCUCAAAGCACU

AM05150-AS 267 usGfaAfgCfuGfaGfgCfuCfaAfaGfcasc 702 UGAAGCUGAGGCUCAAAGCAC

AM05152-AS 268 usGfaAfgCfuGfaGfgCfuCfaAfaGfcsa 701 UGAAGCUGAGGCUCAAAGCA

AM05154-AS 269 usGfaAfgCfuGfaGfgCfuCfaAfagsc 700 UGAAGCUGAGGCUCAAAGC

AM05156-AS 270 usGfaGfaAfgCfuGfaGfgCfuCfaAfaGfcAfcsu 713 UGAGAAGCUGAGGCUCAAAGCACU

AM05158-AS 271 usGfaGfaAfgCfuGfaGfgCfuCfaAfaGfcasc 712 UGAGAAGCUGAGGCUCAAAGCAC

AM05160-AS 272 usGfaGfaAfgCfuGfaGfgCfuCfaAfaGfcsa 711 UGAGAAGCUGAGGCUCAAAGCA

AM05162-AS 273 usGfaGfaAfgCfuGfaGfgCfuCfaAfagsc 710 UGAGAAGCUGAGGCUCAAAGC

AM05164-AS 274 usGfaGfaAfgCfuGfaGfgCfuCfaAfasg 709 UGAGAAGCUGAGGCUCAAAG

AM05166-AS 275 usGfaGfaAfgCfuGfaGfgCfuCfaasa 708 UGAGAAGCUGAGGCUCAAA

AM05168-AS 276 usUfuUfuCfaAfaGfcAfcUfuUfaUfuGfaGfusu 819 UUUUUCAAAGCACUUUAUUGAGUU

AM05170-AS 277 usUfuUfuCfaAfaGfcAfcUfuUfaUfuGfagsu 818 UUUUUCAAAGCACUUUAUUGAGU

AM05172-AS 278 usUfuUfuCfaAfaGfcAfcUfuUfaUfuGfasg 817 UUUUUCAAAGCACUUUAUUGAG

AM05174-AS 279 usUfuUfuCfaAfaGfcAfcUfuUfaUfugsa 816 UUUUUCAAAGCACUUUAUUGA

AM05176-AS 280 usUfuUfuCfaAfaGfcAfcUfuUfaUfusg 815 UUUUUCAAAGCACUUUAUUG

AM05178-AS 281 usUfuUfuCfaAfaGfcAfcUfuUfausu 814 UUUUUCAAAGCACUUUAUU

AM05231-AS 282 cPrspusGfsgsUfcUfuUfcAfcUfuUfcUfuGfgGfcasuc 734 UGGUCUUUCACUUUCUUGGGCAUC

AM05232-AS 283 cPrspusGfsgsUfcUfuUfcAfcUfuUfcAfuGfgGfsu 719 UGGUCUUUCACUUUCAUGGGU

AM05246-AS 284 usGfsgucuuUfcAfcUfuUfcuugggcsusc 739 UGGUCUUUCACUUUCUUGGGCUC

AM05247-AS 285 usGfsgUfcUfuUfcAfcUfuUfcUfuGfgGfcsusc 739 UGGUCUUUCACUUUCUUGGGCUC

AM05248-AS 286 usGfsgUfcUfuUfcAfcUfuUfcUfuGfgsGfsc 724 UGGUCUUUCACUUUCUUGGGC

AM05256-AS 287 usGfsgucuuUfcAfcUfuUfcuugggcsusccgc 742 UGGUCUUUCACUUUCUUGGGCUCCGC

Antisense Strand SEQ ID Antisense Sequence SEQ ID Underlying Antisense Base Sequence ID: NO. (Modified) NO. (5'→3')

(5'→3')

AM05257-AS 288 usGfsgucuuUfcAfcUfuUfcuugggcsusu 746 UGGUCUUUCACUUUCUUGGGCUU

AM05261-AS 289 usGfsgucuuUfcAfcUfuUfcuuggsusu 751 UGGUCUUUCACUUUCUUGGUU

AM05262-AS 290 usGfsgucuuUfcAfcUfuUfcuuggsgsc 724 UGGUCUUUCACUUUCUUGGGC

AM05265-AS 291 usUfsusuuCfaaaGfcAfcUfuUfauugagsuuca 821 UUUUUCAAAGCACUUUAUUGAGUUCA

AM05266-AS 292 ususUfsUfuCfaAfaGfcAfcUfuUfaUfuGfagsuuca 821 UUUUUCAAAGCACUUUAUUGAGUUCA

AM05268-AS 293 asUfsusUfuCfaAfaGfcAfcUfuUfaUfuGfagsuuca 670 AUUUUCAAAGCACUUUAUUGAGUUCA

AM05270-AS 294 usUfsusUfuCfaAfaGfcAfcUfuUfaUfuGfagsu 818 UUUUUCAAAGCACUUUAUUGAGU

AM05274-AS 295 usUfsusUfuCfaAfaGfcAfcUfuUfaUfugsa 816 UUUUUCAAAGCACUUUAUUGA

AM05276-AS 296 usUfsusUfuCfaAfaGfcAfcUfuUfaUfugsc 823 UUUUUCAAAGCACUUUAUUGC

AM05278-AS 297 usUfsusUfuCfaAfaGfcAfcUfuUfaUfcgsa 813 UUUUUCAAAGCACUUUAUCGA

AM05279-AS 298 usGfsasagCfuGfaGfgCfuCfaaagcusu 707 UGAAGCUGAGGCUCAAAGCUU

AM05289-AS 299 usGfsasAfgCfuGfaGfgCfuCfaAfaGfcasc 702 UGAAGCUGAGGCUCAAAGCAC

AM05327-AS 300 usAfsasGfcAfcUfuUfaUfuGfaGfuUfcCfsu 673 UAAGCACUUUAUUGAGUUCCU

AM05328-AS 301 usAfsasGfcAfcUfuUfaUfuGfaGfuUfcCfusu 675 UAAGCACUUUAUUGAGUUCCUU

AM05329-AS 302 usCfsasAfaGfcAfcUfuUfaUfuGfaGfuUfsc 680 UCAAAGCACUUUAUUGAGUUC

AM05330-AS 303 usCfsasAfaGfcAfcUfuUfaUfuGfaGfuUfcsu 681 UCAAAGCACUUUAUUGAGUUCU

AM05331-AS 304 usUfscsAfaAfgCfaCfuUfuAfuUfgAfgUfsu 767 UUCAAAGCACUUUAUUGAGUU

AM05332-AS 305 usUfscsAfaAfgCfaCfuUfuAfuUfgAfgUfusc 768 UUCAAAGCACUUUAUUGAGUUC

AM05333-AS 306 usUfscsAfaAfgCfaCfuUfuAfuUfgAfgUfuCfsu 771 UUCAAAGCACUUUAUUGAGUUCU

AM05334-AS 307 usUfsusCfaAfaGfcAfcUfaUfaUfuGfaGfsu 788 UUUCAAAGCACUAUAUUGAGU

AM05335-AS 308 asUfsusCfaAfaGfcAfcUfaUfaUfuGfaGfsu 667 AUUCAAAGCACUAUAUUGAGU

AM05336-AS 309 usUfsusCfaAfaGfcAfcUfaUfaUfuGfaGfuUfsc 789 UUUCAAAGCACUAUAUUGAGUUC

AM05355-AS 310 usUfsuUfuCfaAfaGfcAfcUfuUfaUfuGfasgsuuAu 820 UUUUUCAAAGCACUUUAUUGAGUUAU

AM05358-AS 311 usGfsgsUfcUfuUfcAfcUfuUfCfuuGfgGfsc 724 UGGUCUUUCACUUUCUUGGGC

Antisense Strand SEQ ID Antisense Sequence SEQ ID Underlying Antisense Base Sequence ID: NO. (Modified) NO. (5'→3')

(5'→3')

AM05360-AS 312 usGfsgsUfcUfuUfcAfcUfuUfCfuuGfgGfcsa 725 UGGUCUUUCACUUUCUUGGGCA

AM05367-AS 313 usAfsasGfcAfcUfuUfaUfuGfAfguUfcCfsu 673 UAAGCACUUUAUUGAGUUCCU

AM05370-AS 314 usCfsasAfaGfcAfcUfuUfaUfUfgaGfuUfsc 680 UCAAAGCACUUUAUUGAGUUC

AM05373-AS 315 usUfscsAfaAfgCfaCfuUfuAfUfugAfgUfsu 767 UUCAAAGCACUUUAUUGAGUU

AM05376-AS 316 usUfsusCfaAfaGfcAfcUfaUfAfuuGfaGfsu 788 UUUCAAAGCACUAUAUUGAGU

AM05379-AS 317 usUfsusUfuCfaAfaGfcAfcUfuUfaUfuGfsu 824 UUUUUCAAAGCACUUUAUUGU

AM05382-AS 318 usUfsusUfuCfaAfaGfcAfcUfUfuaUfuGfsu 824 UUUUUCAAAGCACUUUAUUGU

AM05478-AS 319 usUfsusCfaAfaGfcAfcUfuUfaUfuGfaGfsu 793 UUUCAAAGCACUUUAUUGAGU

AM05479-AS 320 asUfsusCfaAfaGfcAfcUfuUfaUfuGfaGfsu 668 AUUCAAAGCACUUUAUUGAGU

AM05480-AS 321 usUfsusCfaAfaGfcAfcUfuUfaUfuGfaGfuUfsc 797 UUUCAAAGCACUUUAUUGAGUUC

AM05482-AS 322 usUfsusCfaAfaGfcAfcUfuUfAfuuGfaGfsu 793 UUUCAAAGCACUUUAUUGAGU

AM05590-AS 323 usGfsgucuuUfcAfcUfuUfcuugggscsu 738 UGGUCUUUCACUUUCUUGGGCU

AM05591-AS 324 usGfsgsucuuUfcAfcUfuUfcuugggcusu 746 UGGUCUUUCACUUUCUUGGGCUU

AM05596-AS 325 usGfsgucuuUfcAfcUfuUfcuuggsusc 750 UGGUCUUUCACUUUCUUGGUC

AM05597-AS 326 usGfsgsucuuUfcAfcUfuUfcuuggusu 751 UGGUCUUUCACUUUCUUGGUU

AM05641-AS 327 cP usUfsusCfaAfaGfcAfcUfuUfaUfuGfaGfsu 793 UUUCAAAGCACUUUAUUGAGU

AM05679-AS 328 usUfsusCfaAfaGfcAfcUfuUfaUfuGfaGfsc 790 UUUCAAAGCACUUUAUUGAGC

AM05681-AS 329 usUfscsAfaAfgCfaCfuUfuAfuUfgAfgUfsc 765 UUCAAAGCACUUUAUUGAGUC

AM05683-AS 330 usUfscsAfaAfgCfaCfuUfuAfuUfgAfgCfsu 764 UUCAAAGCACUUUAUUGAGCU

AM05685-AS 331 usUfscsAfaAfgCfaCfuUfuAfuUfgAfgCfsc 763 UUCAAAGCACUUUAUUGAGCC

AM05686-AS 332 usUfscsAfaAfgcacuUfuAfuUfgAfgUfsu 767 UUCAAAGCACUUUAUUGAGUU

AM05687-AS 333 usUfscsAfaAfgcAfcuUfuAfuUfgAfgUfsu 767 UUCAAAGCACUUUAUUGAGUU

AM05689-AS 334 usUfscsAfaAfgCfaCfuUfuAfuUfgAfgUfcsc 766 UUCAAAGCACUUUAUUGAGUCC

AM05691-AS 335 usUfscsAfaAfgCfaCfuUfuAfuUfgAfgusu 767 UUCAAAGCACUUUAUUGAGUU

Antisense Strand SEQ ID Antisense Sequence SEQ ID Underlying Antisense Base Sequence ID: NO. (Modified) NO. (5'→3')

(5'→3')

AM05692-AS 336 usUfscsAfaAfgCfaCfuUfuAfuUfgAfgcsc 763 UUCAAAGCACUUUAUUGAGCC

AM05695-AS 337 usUfscsAfaAfgCfAfCfuUfuAfuUfgAfgusu 767 UUCAAAGCACUUUAUUGAGUU

AM05696-AS 338 usUfsuscaAfagcAfcUfuUfaUfuGfaGfsu 793 UUUCAAAGCACUUUAUUGAGU

AM05698-AS 339 usUfsusCfaAfaGfcAfcUfuUfaUfuGfaGfusu 796 UUUCAAAGCACUUUAUUGAGUU

AM05700-AS 340 usUfsusCfaAfaGfcAfcUfuUfaUfuGfaGfcsu 792 UUUCAAAGCACUUUAUUGAGCU

AM05702-AS 341 usUfsusCfaAfaGfcAfcUfuUfaUfuGfaGfusc 794 UUUCAAAGCACUUUAUUGAGUC

AM05704-AS 342 usUfsusCfaAfaGfcAfcUfuUfaUfuGfaGfuCfsc 795 UUUCAAAGCACUUUAUUGAGUCC

AM05705-AS 343 usUfsusCfaAfaGfcAfcUfuUfaUfuGfaGfuusc 797 UUUCAAAGCACUUUAUUGAGUUC

AM05707-AS 344 usUfsusCfaAfaGfcAfcUfuUfaUfuGfagsu 793 UUUCAAAGCACUUUAUUGAGU

AM05708-AS 345 usUfsusCfaAfaGfcAfcUfuUfaUfuGfausu 798 UUUCAAAGCACUUUAUUGAUU

AM05711-AS 346 usUfsusCfaAfaGfcAfcUfuUfaUfuGfaGfcsc 791 UUUCAAAGCACUUUAUUGAGCC

AM05713-AS 347 usUfsusCfaAfaGfCfAfcUfuUfaUfuGfagsu 793 UUUCAAAGCACUUUAUUGAGU

AM05718-AS 348 usUfsusCfaAfaGfCfAfcUfuUfaUfuGfausu 798 UUUCAAAGCACUUUAUUGAUU

AM05720-AS 349 usUfsusCfaAfaGfcAfcUfuUfaUfUfgaGfsu 793 UUUCAAAGCACUUUAUUGAGU

AM05722-AS 350 usUfsusCfaAfaGfcAfcUfuUfaUfUfgaGfuUfsc 797 UUUCAAAGCACUUUAUUGAGUUC

AM05726-AS 351 usAfsasGfcAfcUfuUfaUfuGfaGfuUfcCfsc 672 UAAGCACUUUAUUGAGUUCCC

AM05728-AS 352 asAfsasGfcAfcUfuUfaUfuGfaGfuUfcCfsu 662 AAAGCACUUUAUUGAGUUCCU

AM05729-AS 353 usAfsasgcAfcUfuUfaUfuGfaGfuUfcCfsu 673 UAAGCACUUUAUUGAGUUCCU

AM05731-AS 354 usAfsasGfcAfcUfuUfaUfuGfaGfuUfcCfusg 674 UAAGCACUUUAUUGAGUUCCUG

AM05733-AS 355 usAfsasGfcAfcUfuUfaUfuGfaGfuUfccsu 673 UAAGCACUUUAUUGAGUUCCU

AM05736-AS 356 usAfsasgcAfcUfuUfaUfuGfaGfuUfccsu 673 UAAGCACUUUAUUGAGUUCCU

AM05742-AS 357 usAfsasGfCfaCfUfuUfaUfuGfaGfUfucCfsu 673 UAAGCACUUUAUUGAGUUCCU

AM05750-AS 358 usUfscsAfAfaGfCfaCfuUfuAfuUfGfagUfsu 767 UUCAAAGCACUUUAUUGAGUU

AM05753-AS 359 usUfscsAfAfaGfCfaCfuUfuAfuUfGfagUfusc 768 UUCAAAGCACUUUAUUGAGUUC

Antisense Strand SEQ ID Antisense Sequence SEQ ID Underlying Antisense Base Sequence ID: NO. (Modified) NO. (5'→3')

(5'→3')

AM05818-AS 360 cP usGfsgucuuUfcAfcUfuUfcuugggcsusc 739 UGGUCUUUCACUUUCUUGGGCUC

AM05819-AS 361 usGfsgucUfuUfCfacuuUfcUfugggcsusc 739 UGGUCUUUCACUUUCUUGGGCUC

AM05820-AS 362 usGfsgUfcUfuucacUfuUfcUfuGfgGfcsusc 739 UGGUCUUUCACUUUCUUGGGCUC

AM05823-AS 363 usUfscsAfaAfgCfaCfuUfuAfuUfgAfgUfucsc 769 UUCAAAGCACUUUAUUGAGUUCC

AM05824-AS 364 cP usUfscsAfaAfgCfaCfuUfuAfuUfgAfgUfucsc 770 UUCAAAGCACUUUAUUGAGUUCC

AM05825-AS 365 usUfscsAfaAfgcacuUfuAfuUfgAfgUfucsc 770 UUCAAAGCACUUUAUUGAGUUCC

AM05826-AS 366 us Uf s cs aaAf gC f Af cuuu Af uUf gaguucs c 770 UUCAAAGCACUUUAUUGAGUUCC

AM05836-AS 367 usUfsusCfaCfuUfuCfuUfgGfgCfuCfcAfaasc 800 UUUCACUUUCUUGGGCUCCAAAC

AM05837-AS 368 usUfsusCfaCfuuucuUfgGfgCfuCfcAfaasc 800 UUUCACUUUCUUGGGCUCCAAAC

AM05838-AS 369 usUfsuscaCfuUfUfcuUfgGfgCfuccaaasc 800 UUUCACUUUCUUGGGCUCCAAAC

AM05839-AS 370 usUfsuscaCfuuucuUfgGfgCfuCfcAfaasc 800 UUUCACUUUCUUGGGCUCCAAAC

AM05840-AS 371 usUfsusCfaCfuuucuUfgGfgCfuCfcAfsa 799 UUUCACUUUCUUGGGCUCCAA

AM05841-AS 372 usUfsusCfaCfuuucuUfgGfgCfuCfcasa 799 UUUCACUUUCUUGGGCUCCAA

AM05842-AS 373 usUfsusCfaCfuuucuUfgGfgCfuCfcusu 801 UUUCACUUUCUUGGGCUCCUU

AM05902-AS 374 cPrpusUfscsAfaAfgCfaCfuUfuAfuUfgAfgUfsu 767 UUCAAAGCACUUUAUUGAGUU

AM05903-AS 375 usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsg 805 UUUGUACUUAUGCUCCUUGGG

AM05904-AS 376 usAfsusCfgAfaAfgUfgUfuGfaCfuCfcAfsa 676 UAUCGAAAGUGUUGACUCCAA

AM05905-AS 377 usUfsgsUfaCfuUfaUfgCfuCfcUfuGfgusu 787 UUGUACUUAUGCUCCUUGGUU

AM05906-AS 378 usCfsgsAfaGfaCfaGfaCfuCfuUfgCfgusu 688 UCGAAGACAGACUCUUGCGUU

AM05950-AS 379 cP dUsUfscsAfaAfgCfaCfuUfuAfuUfgAfgUfsu 767 UUCAAAGCACUUUAUUGAGUU

AM06060-AS 380 usUfscsAfaAfgcacuUfuAfuUfgAfgUfucsu 771 UUCAAAGCACUUUAUUGAGUUCU

AM06061-AS 381 usUfscsAfaAfgcacuUfuAfuUfgAfgUfucusu 772 UUCAAAGCACUUUAUUGAGUUCUU

AM06062-AS 382 usUfscsAfaAfgcacuUfuAfuUfgAfgusu 767 UUCAAAGCACUUUAUUGAGUU

AM06093-AS 383 usAfsusCfgAfaAfgUfgUfuGfaCfuCfcusu 679 UAUCGAAAGUGUUGACUCCUU

Antisense Strand SEQ ID Antisense Sequence SEQ ID Underlying Antisense Base Sequence ID: NO. (Modified) NO. (5'→3')

(5'→3')

AM06094-AS 384 cP usAfsusCfgAfaAfgUfgUfuGfaCfuCfcusu 679 UAUCGAAAGUGUUGACUCCUU

AM06095-AS 385 usAfsusCfgAfaAfgUfgUfuGfaCfuCfcAfasg 677 UAUCGAAAGUGUUGACUCCAAG

AM06096-AS 386 usUfsgsUfaCfuUfaUfgCfuCfcUfuGfggsg 784 UUGUACUUAUGCUCCUUGGGG

AM06097-AS 387 usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfgusu 808 UUUGUACUUAUGCUCCUUGGGUU

AM06103-AS 388 cPrpusUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsg 805 UUUGUACUUAUGCUCCUUGGG

AM06104-AS 389 usUfsusGfuAfcUfuAfuGfcUfcCfuUfgusu 811 UUUGUACUUAUGCUCCUUGUU

AM06106-AS 390 usUfsusGfuAfcuuauGfcUfcCfuUfgGfsg 805 UUUGUACUUAUGCUCCUUGGG

AM06107-AS 391 usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfgsg 806 UUUGUACUUAUGCUCCUUGGGG

AM06108-AS 392 usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfggsu 807 UUUGUACUUAUGCUCCUUGGGGU

AM06113-AS 393 usUfsgsUfaCfuuaugCfuCfcUfuGfgGfsg 784 UUGUACUUAUGCUCCUUGGGG

AM06114-AS 394 usUfsgsUfaCfuUfaUfgCfuCfcUfuGfgGfusu 786 UUGUACUUAUGCUCCUUGGGUU

AM06117-AS 395 usAfsusCfgAfaAfgUfgUfuGfaCfuCfcAfagsc 678 UAUCGAAAGUGUUGACUCCAAGC

AM06334-AS 396 usUfsusGfuAfcUfuAfuGfcUfcCfuUfggsg 805 UUUGUACUUAUGCUCCUUGGG

AM06335-AS 397 usUfuGfuacUfuAfuGfcUfccuuggsg 805 UUUGUACUUAUGCUCCUUGGG

AM06336-AS 398 usUfsusGfuAfcUfuAfuGfcUfcCfuUfggsu 809 UUUGUACUUAUGCUCCUUGGU

AM06337-AS 399 usUfsusGfuAfcUfuAfuGfcUfcCfuUfgsg 803 UUUGUACUUAUGCUCCUUGG

AM06338-AS 400 cP dUsUfsusGfuAfcUfuAfuGfcUfcCfuUfgusu 811 UUUGUACUUAUGCUCCUUGUU

AM06339-AS 401 cP dUUfuGfuAfcUfuAfuGfcUfcCfuUfgu(invAb) 810 UUUGUACUUAUGCUCCUUGU

AM06343-AS 402 usUfsusGfuAfcUfuAfuGfcUfcCfuUfsg 802 UUUGUACUUAUGCUCCUUG

AM06344-AS 403 asUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsg 669 AUUGUACUUAUGCUCCUUGGG

AM07041-AS 404 usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsc 804 UUUGUACUUAUGCUCCUUGGC

AM07043-AS 405 usUfsusGfuAfCuNAUfuAfuGfcUfcCfuUfgGfsc 804 UUUGUACUUAUGCUCCUUGGC

AM07046-AS 406 usUfsgsUfaCfuUfaUfgCfuCfcUfuGfggsc 783 UUGUACUUAUGCUCCUUGGGC

AM07048-AS 407 usGfsusAfcUfuAfuGfcUfcCfuUfgGfgGfsc 753 UGUACUUAUGCUCCUUGGGGC

Antisense Strand SEQ ID Antisense Sequence SEQ ID Underlying Antisense Base Sequence ID: NO. (Modified) NO. (5'→3')

(5'→3')

AM07050-AS 408 usUfsusUfgUfaCfuUfaUfgCfuCfcUfuGfsc 812 UUUUGUACUUAUGCUCCUUGC

AM07052-AS 409 usCfsusUfuGfuAfcUfuAfuGfcUfcCfucsg 699 UCUUUGUACUUAUGCUCCUCG

AM07054-AS 410 usCfsusUfuGfuAfcUfuAfuGfcUfcCfucsc 698 UCUUUGUACUUAUGCUCCUCC

AM07056-AS 411 usCfsasGfcUfuUfgUfaCfuUfaUfgCfuCfsc 685 UCAGCUUUGUACUUAUGCUCC

AM07058-AS 412 usGfsgsUfaCfaUfuUfgUfgGfuAfcAfgCfsu 718 UGGUACAUUUGUGGUACAGCU

AM07249-AS 413 usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsu 809 UUUGUACUUAUGCUCCUUGGU

AM07253-AS 414 asUfscsGfaAfaguguUfgAfcUfcCfaAfsg 665 AUCGAAAGUGUUGACUCCAAG

AM07255-AS 415 asUfscsGfaAfaguguUfgAfcUfcCfaGfsc 666 AUCGAAAGUGUUGACUCCAGC

AM07257-AS 416 asAfsusCfgAfaagugUfuGfaCfuCfcAfsc 663 AAUCGAAAGUGUUGACUCCAC

AM07259-AS 417 usGfsgsAfaUfcgaaaGfuGfuUfgAfcUfsc 717 UGGAAUCGAAAGUGUUGACUC

AM07261-AS 418 usGfsusAfcAfuuuguGfgUfaCfaGfcUfsg 752 UGUACAUUUGUGGUACAGCUG

AM07263-AS 419 usCfsasGfcUfuuguaCfuUfaUfgCfuCfsg 686 UCAGCUUUGUACUUAUGCUCG

AM07265-AS 420 usCfsasGfcUfuuguaCfuUfaUfgCfuCfsu 687 UCAGCUUUGUACUUAUGCUCU

AM07267-AS 421 usUfsgsUfaCfuuaugCfuCfcUfuGfgGfsu 785 UUGUACUUAUGCUCCUUGGGU

Table 4. FXII RNAi Agent Sense Strand Sequences.

Sense Strand SEQ ID Sense Sequence SEQ Underlying Sense Base Sequence ID: NO. (Modified) ID NO. (5'→ 3 )

(5'→3')

AM04130-SS 422 (NAG25)uauaugscsccaagaAfaGfugaaagacc(invdA) 932 UAUAUGCCCAAGAAAGUGAAAGACCA

AM04554-SS 423 (N AG25 )gcgags cccaagaAfaGfugaaagacca(invd A) 902 GCGAGCCCAAGAAAGUGAAAGACCAA

AM04557-SS 424 (NAG25)gcgagscccaagaAfaGfugaaagaccas(invdA) 902 GCGAGCCCAAGAAAGUGAAAGACCAA

AM04558-SS 425 (N AG25 )gcgags cccaagaAfaGfugaaagacc AMs (invdA) 902 GCGAGCCCAAGAAAGUGAAAGACCAA

AM04559-SS 426 (NAG25)gcgagscccaagaAfaGfugaaagaccasas(invdA) 903 GCGAGCCCAAGAAAGUGAAAGACCAAA

AM04561-SS 427 (NAG25)gcgugsuuuggagCfCfCfaagaaagugAMs(invdA) 909 GC GUGUUUGGAGCC C AAGAAAGUGAA

AM04613-SS 428 (NAG25)gcgaugscsccaagaAfaGfugaaagacc(invdA) 905 GCGAUGCCCAAGAAAGUGAAAGACCA

AM04814-SS 429 (NAG25)gcgagscccaagaAfaGfugaaagacc(invdA) 901 GCGAGCCCAAGAAAGUGAAAGACCA

AM04815-SS 430 (NAG25)gcgugsuuuggagCfCfCfaagaaagug(invdA) 908 GCGUGUUUGGAGCCCAAGAAAGUGA

AM04836-SS 431 (NAG25)gcgaugscccaagaAfaGfugaaagacc(invdA) 905 GCGAUGCCCAAGAAAGUGAAAGACCA

AM04837-SS 432 (NAG25)gcgaugscccaagaAfaGfugaaagacc(invdT) 906 GCGAUGCCCAAGAAAGUGAAAGACCT

AM04838-SS 433 (NAG25)gcgaugscccaagaAfaGfugaaagacca 905 GCGAUGCCCAAGAAAGUGAAAGACCA

AM04839-SS 434 (N AG25 )gcgaugscccaagaAf aGfugaaagaccs a 905 GCGAUGCCCAAGAAAGUGAAAGACCA

AM04840-SS 435 (NAG25)gcgaugscccaagaAfAfGfugaaagacc(invdA) 905 GCGAUGCCCAAGAAAGUGAAAGACCA

AM04845-SS 436 (NAG25)gcgaugscccaagaAfaGfugaaagacc(invAb) 904 GCGAUGCCCAAGAAAGUGAAAGACC

AM04847-SS 437 (NAG25)gcgaugscccaagaAfaGfugaaagacc(inva) 905 GCGAUGCCCAAGAAAGUGAAAGACCA

AM04881-SS 438 (NAG25)gcgaugscccaagaAfaGfugaaagaccas(invAb) 905 GCGAUGCCCAAGAAAGUGAAAGACCA

AM04882-SS 439 (NAG25)sugauuggagcccaAfGfAfaagugaaags(invdA) 947 UGAUUGGAGCCCAAGAAAGUGAAAGA

AM04883-SS 440 (NAG25)sagcccaAfGfAfaagugaaagauus(invAb) 851 AGCCCAAGAAAGUGAAAGAUU

AM04884-SS 441 (NAG25)saaggagcccaAfGfAfaagugaaagauus(invAb) 836 AAGGAGCCCAAGAAAGUGAAAGAUU

AM04885-SS 442 (NAG25)sugaggagcccaagAfAfAfgugaaagacs(invdA) 944 UGAGGAGCCCAAGAAAGUGAAAGACA

AM04886-SS 443 (NAG25)scccaagAfAfAfgugaaagacauus(invAb) 867 CCCAAGAAAGUGAAAGACAUU

AM04887-SS 444 (NAG25)saaagcccaagAfAfAfgugaaagacauus(invAb) 826 AAAGCCCAAGAAAGUGAAAGACAUU

Sense Strand SEQ ID Sense Sequence SEQ Underlying Sense Base Sequence ID: NO. (Modified) ID NO. (5'→ 3 )

(5'→3')

AM04888-SS 445 (NAG25; )sugaagcccaagaaAfGfUfgaaagaccas(invdA) 942 UGAAGCCCAAGAAAGUGAAAGACCAA

AM04889-SS 446 (NAG25; )scaagaaAfGfUfgaaagaccaauus(invAb) 859 C AAGAAAGUGAAAGAC C AAUU

AM04890-SS 447 (NAG25; )saacccaagaaAfGfUfgaaagaccaauus(invAb) 828 AAC CC A AGAAAGUGAAAGAC C AAUU

AM04891-SS 448 (NAG25; )sugaaagugcuuugAfGfCfcucagcuucs(invdA) 938 UGAAAGUGCUUUGAGCCUCAGCUUCA

AM04892-SS 449 (NAG25; )sgcuuugAfGfCfcucagcuucauus(invAb) 914 GCUUUGAGCCUCAGCUUCAUU

AM04893-SS 450 (NAG25; )saagugcuuugAfGfCfcucagcuucauus(invAb) 838 AAGUGCUUUGAGCCUCAGCUUCAUU

AM04894-SS 451 (NAG25; )sugagugcuuugagCfCfUfcagcuucucs(invdA) 946 UGAGUGCUUUGAGCCUCAGCUUCUCA

AM04895-SS 452 (NAG25; )suuugagCfCfUfcagcuucucauus(invAb) 951 UUUGAGCCUCAGCUUCUCAUU

AM04896-SS 453 (NAG25; )saagcuuugagCfCfUfcagcuucucauus(invAb) 835 AAGCUUUGAGCCUCAGCUUCUCAUU

AM04897-SS 454 (NAG25; )sugaacucaauaaaGfUfGfcuuugaaaas(invdA) 939 UGAACUCAAUAAAGUGCUUUGAAAAA

AM04898-SS 455 (NAG25; )saauaaaGfUfGfcuuugaaaaauus(invAb) 839 AAUAAAGUGCUUUGAAAAAUU

AM04899-SS 456 (NAG25; )saaucaauaaaGfUfGfcuuugaaaaauus(invAb) 840 AAUCAAUAAAGUGCUUUGAAAAAUU

AM04900-SS 457 (NAG25; )sugagagcccaagaAfAfGfugaaagaccs(invdA) 943 UGAGAGCCCAAGAAAGUGAAAGACCA

AM04901-SS 458 (NAG25; )sccaagaAfAfGfugaaagaccauus(invAb) 864 CCAAGAAAGUGAAAGACCAUU

AM04902-SS 459 (NAG25; )saagcccaagaAfAfGfugaaagaccauus(invAb) 833 AAGCCCAAGAAAGUGAAAGACCAUU

AM04931-SS 460 (NAG25; )sugagagcccaagaAfaGfugaaagaccs(invdA) 943 UGAGAGCCCAAGAAAGUGAAAGACCA

AM04933-SS 461 (NAG25; )sugagagcccaagaAfaGfugaaagacc(invdA) 943 UGAGAGCCCAAGAAAGUGAAAGACCA

AM04934-SS 462 (NAG25; )ugagagcccaagaAfaGfugaaagacc(invdA) 943 UGAGAGCCCAAGAAAGUGAAAGACCA

AM04935-SS 463 (NAG25; )ugagasgcccaagaAfaGfugaaagacc(invdA) 943 UGAGAGCCCAAGAAAGUGAAAGACCA

AM04937-SS 464 (NAG25; )uauaugscccaagaAfaGfugaaagacc(invdA) 933 UAUAUGCCCAAGAAAGUGAAAGACCA

AM04939-SS 465 (NAG25; )ugaaugscccaagaAfaGfugaaagacc(invdA) 943 UGAAUGCCCAAGAAAGUGAAAGACCA

AM04940-SS 466 (NAG25; )ugagugscccaagaAfaGfugaaagacc(invdA) 945 UGAGUGCCCAAGAAAGUGAAAGACCA

AM04942-SS 467 (NAG25; )gcggugscccaagaAfaGfugaaagacc(invdA) 907 GCGGUGCCCAAGAAAGUGAAAGACCA

AM04944-SS 468 (NAG25; )ugagugscccaagaAfAfGfugaaagacc(invdA) 945 UGAGUGCCCAAGAAAGUGAAAGACCA

Sense Strand SEQ ID Sense Sequence SEQ Underlying Sense Base Sequence ID: NO. (Modified) ID NO. (5'→ 3 )

(5'→3')

AM04946-SS 469 (NAG25; )gcggugscccaagaAfAfGfugaaagacc(invdA) 907 GCGGUGCCCAAGAAAGUGAAAGACCA

AM04948-SS 470 (NAG25; )uauaugscccaagaAfAfGfugaaagacc(invdA) 933 UAUAUGCCCAAGAAAGUGAAAGACCA

AM04950-SS 471 (NAG25 )uuggugscccaagaAfaGfugaaagacc(invdA) 950 UUGGUGCCCAAGAAAGUGAAAGACCA

AM04952-SS 472 (NAG25; )aaggugscccaagaAfaGfugaaagacc(invdA) 837 AAGGUGCCCAAGAAAGUGAAAGACCA

AM04954-SS 473 (NAG25 )guggugscccaagaAfaGfugaaagacc(invdA) 931 GUGGUGCCCAAGAAAGUGAAAGACCA

AM04956-SS 474 (NAG25; )gaggugscccaagaAfaGfugaaagacc(invdA) 892 GAGGUGCCCAAGAAAGUGAAAGACCA

AM04958-SS 475 (NAG25; )saagcccaagaAfaGfugaaagacc(invdA)uu 833 AAGCCCAAGAAAGUGAAAGACCAUU

AM04960-SS 476 (NAG25; )saagcccaagaAfaGfugaaagacc(invdA)usu 833 AAGCCCAAGAAAGUGAAAGACCAUU

AM04961-SS 477 (NAG25; )saagcccaagaAfaGfugaaagacc(invdA)usu(invAb) 833 AAGCCCAAGAAAGUGAAAGACCAUU

AM04962-SS 478 (NAG25; )saagcccaagaAfaGfugaaagacc(invdA) 832 AAGCCCAAGAAAGUGAAAGACCA

AM04963-SS 479 (NAG25; )saagcccaagaAfaGfugaaagaccs(invdA) 832 AAGCCCAAGAAAGUGAAAGACCA

AM04964-SS 480 (NAG25; )saagcccaagaAfaGfugaaagacc(invdA)(invAb) 832 AAGCCCAAGAAAGUGAAAGACCA

AM04965-SS 481 (NAG25; )saagcccaagaAfaGfugaaagacc(invdA)s(invAb) 832 AAGCCCAAGAAAGUGAAAGACCA

AM04966-SS 482 (NAG25; )saagcccaagaAfaGfugaaagaccausu(invAb) 833 AAGCCCAAGAAAGUGAAAGACCAUU

AM04967-SS 483 (NAG25; )saagcccaagaAfaGfugaaagacca(invAb) 832 AAGCCCAAGAAAGUGAAAGACCA

AM04968-SS 484 (NAG25; )saagcccaagaAfaGfugaaagaccas(invAb) 832 AAGCCCAAGAAAGUGAAAGACCA

AM04974-SS 485 (NAG25; )sccaagaAfaGfugaaagaccauus(invAb) 864 CCAAGAAAGUGAAAGACCAUU

AM04975-SS 486 (NAG25; )saagcccaagaAfaGfugaaagaccauus(invAb) 833 AAGCCCAAGAAAGUGAAAGACCAUU

AM04980-SS 487 (NAG25; )ugauusggagcccaAfGfAfaagugaaags(invdA) 947 UGAUUGGAGCCCAAGAAAGUGAAAGA

AM04981-SS 488 (NAG25; )ugaggsagcccaagAfAfAfgugaaagacs(invdA) 944 UGAGGAGCCCAAGAAAGUGAAAGACA

AM04982-SS 489 (NAG25; )ugaagscccaagaaAfGfUfgaaagaccas(invdA) 942 UGAAGCCCAAGAAAGUGAAAGACCAA

AM04983-SS 490 (NAG25; )ugaaasgugcuuugAfGfCfcucagcuucs(invdA) 938 UGAAAGUGCUUUGAGCCUCAGCUUCA

AM04984-SS 491 (NAG25; )ugagusgcuuugagCfCfUfcagcuucucs(invdA) 946 UGAGUGCUUUGAGCCUCAGCUUCUCA

AM04985-SS 492 (NAG25; )ugaacsucaauaaaGfUfGfcuuugaaaas(invdA) 939 UGAACUCAAUAAAGUGCUUUGAAAAA

Sense Strand SEQ ID Sense Sequence SEQ Underlying Sense Base Sequence ID: NO. (Modified) ID NO. (5'→ 3 )

(5'→3')

AM04986-SS 493 (NAG25 )ugagasgcccaagaAfAfGfugaaagaccs(invdA) 943 UGAGAGCCCAAGAAAGUGAAAGACCA

AM04987-SS 494 (NAG25 )ugagasgcccaagaAfaGfugaaagaccs(invdA) 943 UGAGAGCCCAAGAAAGUGAAAGACCA

AM05030-SS 495 (NAG25 )aagcccaagaAfAfGfugaaagaccauus(invAb) 833 AAGCCCAAGAAAGUGAAAGACCAUU

AM05031-SS 496 (NAG25 )aasgcccaagaAfAfGfugaaagaccauus(invAb) 833 AAGCCCAAGAAAGUGAAAGACCAUU

AM05032-SS 497 (NAG25 )saasgcccaagaAfAfGfugaaagaccauus(invAb) 833 AAGCCCAAGAAAGUGAAAGACCAUU

AM05065-SS 498 (NAG25 )s as cacaagaAfAf Gfugaaagaccas (inv Ab) 843 ACACAAGAAAGUGAAAGACCA

AM05245-SS 499 (NAG25 )gscccaagaAfAfGfugaaagacc(invdA) 898 GCCCAAGAAAGUGAAAGACCA

AM05249-SS 500 (NAG25 )gcggagscccaagaAfAfGfugaaagacc(invdA) 907 GCGGAGCCCAAGAAAGUGAAAGACCA

AM05251-SS 501 (NAG25 )aagscccaagaAfAfGfugaaagacc(invdA) 832 AAGCCCAAGAAAGUGAAAGACCA

AM05252-SS 502 (NAG25 )gagscccaagaAfAfGfugaaagacc(invdA) 891 GAGCCCAAGAAAGUGAAAGACCA

AM05254-SS 503 (NAG25 )sgscccaagaAfAfGfugaaagacc(invdA) 898 GCCCAAGAAAGUGAAAGACCA

AM05255-SS 504 (NAG25 )sasaccaagaAfAfGfugaaagacc(invdA) 827 AACCAAGAAAGUGAAAGACCA

AM05259-SS 505 (NAG31 )aagscccaagaAfAfGfugaaagacc(invdA) 832 AAGCCCAAGAAAGUGAAAGACCA

AM05267-SS 506 (NAG25 )ugaacsucaauaaaGfUfGfcuuugaaaas(invdT) 941 UGAACUCAAUAAAGUGCUUUGAAAAT

AM05269-SS 507 (NAG25 )csucaauaaaGfUfGfcuuugaaaas(invdA) 878 CUCAAUAAAGUGCUUUGAAAAA

AM05271-SS 508 (NAG31 )csucaauaaaGfUfGfcuuugaaaas(invdA) 878 CUCAAUAAAGUGCUUUGAAAAA

AM05272-SS 509 (NAG25 )asucaauaaaGfUfGfcuuugaaaas(invdA) 858 AUCAAUAAAGUGCUUUGAAAAA

AM05273-SS 510 (NAG25 )suscaauaaaGfUfGfcuuugaaaas(invdA) 935 UCAAUAAAGUGCUUUGAAAAA

AM05275-SS 511 (NAG25 )sgscaauaaaGfUfGfcuuugaaaas(invdA) 895 GCAAUAAAGUGCUUUGAAAAA

AM05277-SS 512 (NAG25 )suscgauaaaGfUfGfcuuugaaaas(invdA) 937 UC GAU AAAGUGCUUUGAAAAA

AM05282-SS 513 (NAG25 )sgcuuugAfGfCfcucagcuuc(invdA) 913 GCUUUGAGCCUCAGCUUCA

AM05283-SS 514 (NAG25 )s(invAb)sgcuuugAfGfCfcucagcuuc(invdA) 913 GCUUUGAGCCUCAGCUUCA

AM05284-SS 515 (NAG25 )sasagcuuugAfGfCfcucagcuuc(invdA) 834 AAGCUUUGAGCCUCAGCUUCA

AM05286-SS 516 (NAG25 )sasagcuuugAfGfCfcucagcuucas(invAb) 834 AAGCUUUGAGCCUCAGCUUCA

Sense Strand SEQ ID Sense Sequence SEQ Underlying Sense Base Sequence ID: NO. (Modified) ID NO. (5'→ 3 )

(5'→3')

AM05287-SS 517 (NAG31 )sasagcuuugAfGfCfcucagcuuc(invdA) 834 AAGCUUUGAGCCUCAGCUUCA

AM05288-SS 518 (NAG25)sgsugcuuugAfGfCfcucagcuuc(invdA) 929 GUGCUUUGAGCCUCAGCUUCA

AM05317-SS 519 (NAG25)sasggaacucAfAfUfaaagugcuuas(invAb) 855 AGGAACUCAAUAAAGUGCUUA

AM05318-SS 520 (NAG25)sgsgaacucAfAfUfaaagugcuuas(invAb) 915 GGAACUCAAUAAAGUGCUUA

AM05319-SS 521 (NAG25)sgsaacucaaUfAfAfagugcuuugas(invAb) 884 GAACUCAAUAAAGUGCUUUGA

AM05320-SS 522 (NAG25)sasgaacucaaUfAfAfagugcuuugas(invAb) 848 AGAACUCAAUAAAGUGCUUUGA

AM05321-SS 523 (N AG25 )s as acucaauAf Af Afgugcuuugaas(inv Ab) 829 AACUCAAUAAAGUGCUUUGAA

AM05322-SS 524 (NAG25)sgsaacucaauAfAfAfgugcuuugaas(invAb) 885 GAACUCAAUAAAGUGCUUUGAA

AM05323-SS 525 (NAG25)sasgaacucaauAfAfAfgugcuuugaas(invAb) 849 AGAACUCAAUAAAGUGCUUUGAA

AM05324-SS 526 (NAG25)sascucaauaAfAfGfugcuuugaaas(invAb) 846 ACUCAAUAAAGUGCUUUGAAA

AM05325-SS 527 (N AG25 )s as cucaauaAf AfGfugcuuugaaus(inv Ab) 847 ACUCAAUAAAGUGCUUUGAAU

AM05326-SS 528 (NAG25)sgsaacucaauaAfAfGfugcuuugaaas(invAb) 886 GAACUCAAUAAAGUGCUUUGAAA

AM05366-SS 529 (NAG25)sasgGfaAfCfucAfaUfaAfaGfuGfcUfuas(invAb) 855 AGGAACUCAAUAAAGUGCUUA

AM05369-SS 530 (NAG25)sgsaAfcUfCfaaUfaAfaGfuGfcUfuUfgas(invAb) 884 GAACUCAAUAAAGUGCUUUGA

AM05372-SS 531 (NAG25)sasaCfuCfAfauAfaAfgUfgCfuUfuGfaas(invAb) 829 AACUCAAUAAAGUGCUUUGAA

AM05375-SS 532 (NAG25)sascucAfAfuaAfaGfuGfcUfuUfgAfaas(invAb) 846 ACUCAAUAAAGUGCUUUGAAA

AM05378-SS 533 (NAG25)sascaauaaaGfUfGfcuuugaaaaa(invAb) 841 ACAAUAAAGUGCUUUGAAAAA

AM05380-SS 534 (NAG25)sascAfaUfAfaaGfuGfcUfuUfgAfaAfaa(invAb) 841 ACAAUAAAGUGCUUUGAAAAA

AM05384-SS 535 (NAG25)ugaacsucaauaaaGfUfGfcuuugaaaas(invdA)uu 940 UGAACUCAAUAAAGUGCUUUGAAAAAUU

AM05385-SS 536 (NAG25)sascaauaaaGfUfGfcuuugaaaa(invdA) 841 ACAAUAAAGUGCUUUGAAAAA

AM05386-SS 537 (NAG25)sascaauaaaGfUfGfcuuugaaaa(invdA)uu 842 ACAAUAAAGUGCUUUGAAAAAUU

AM05389-SS 538 (NAG25)sasggaacucAfAfUfaaagugcuu(invdA)uu 856 AGGAACUCAAUAAAGUGCUUAUU

AM05390-SS 539 (N AG25 )s as acucaauAf Af Afgugcuuuga(invdA)uu 831 AACUCAAUAAAGUGCUUUGAAUU

AM05534-SS 540 (NAG31 )aagscccaagaAf AfGfugaaagaccas(invAb) 832 AAGCCCAAGAAAGUGAAAGACCA

Sense Strand SEQ ID Sense Sequence SEQ Underlying Sense Base Sequence ID: NO. (Modified) ID NO. (5'→ 3 )

(5'→3')

AM05535-SS 541 (NAG25 )sgscccaagaAfAfGfugaaagaccas(invAb) 898 GCC C AAGAAAGUGAAAGAC C A

AM05536-SS 542 (NAG25 )s as accaagaAfAf Gfugaaagaccas (inv Ab) 827 AACCAAGAAAGUGAAAGACCA

AM05537-SS 543 (NAG25 )csucaauaaaGfUfGfcuuugaaaaas(invAb) 878 CUCAAUAAAGUGCUUUGAAAAA

AM05538-SS 544 (NAG31 )csucaauaaaGfUfGfcuuugaaaaas(invAb) 878 CUCAAUAAAGUGCUUUGAAAAA

AM05539-SS 545 (NAG25 )asucaauaaaGfUfGfcuuugaaaaas(invAb) 858 AUCAAUAAAGUGCUUUGAAAAA

AM05540-SS 546 (NAG25 )suscaauaaaGfUfGfcuuugaaaaas(invAb) 935 UCAAUAAAGUGCUUUGAAAAA

AM05541-SS 547 (NAG25 )sgscaauaaaGfUfGfcuuugaaaaas(invAb) 895 GCAAUAAAGUGCUUUGAAAAA

AM05542-SS 548 (NAG25 )sus cgauaaaGfUf Gf cuuugaaaaas (inv Ab) 937 UCGAUAAAGUGCUUUGAAAAA

AM05587-SS 549 (NAG25 )s(invAb)sgcccaagaAfAfGfugaaagaccas(invAb) 898 GCCCAAGAAAGUGAAAGACCA

AM05588-SS 550 (NAG25 )sgscccaagaAfAfGfugaaagaccAMs(invAb) 898 GC CC AAGAAAGUGAAAGAC C A

AM05589-SS 551 (NAG25 )sgscccaagaAfAfGfugaaagacmCMAMs(invAb) 898 GCCCAAGAAAGUGAAAGACCA

AM05592-SS 552 (NAG25 )s(invAb)saaccaagaAfAfGfugaaagaccas(invAb) 827 AACCAAGAAAGUGAAAGACCA

AM05593-SS 553 (NAG25 )s as accaagaAfAf GfugaaagaccAMs (inv Ab) 827 AACCAAGAAAGUGAAAGACCA

AM05594-SS 554 (NAG25 )sasaccaagaAfAfGfugaaagacmCMAMs(invAb) 827 AACCAAGAAAGUGAAAGACCA

AM05595-SS 555 (NAG25 )sgsaccaagaAfAfGfugaaagaccas(invAb) 888 GACCAAGAAAGUGAAAGACCA

AM05678-SS 556 (NAG25 )sgscucaauaAfAfGfugcuuugaaas(invAb) 910 GCUCAAUAAAGUGCUUUGAAA

AM05680-SS 557 (NAG25 )sgsacucaauAfAfAfgugcuuugaas(invAb) 889 GACUCAAUAAAGUGCUUUGAA

AM05682-SS 558 (NAG25 )sasgcucaauAfAfAfgugcuuugaas(invAb) 852 AGCUCAAUAAAGUGCUUUGAA

AM05684-SS 559 (NAG25 )sgsgcucaauAfAfAfgugcuuugaas(invAb) 926 GGCUCAAUAAAGUGCUUUGAA

AM05688-SS 560 (NAG25 )sgsgacucaauAfAfAfgugcuuugaas(invAb) 918 GGACUCAAUAAAGUGCUUUGAA

AM05690-SS 561 (NAG25 )s(invAb)scucaauAfAfAfgugcuuugaas(invAb) 877 CUCAAUAAAGUGCUUUGAA

AM05693-SS 562 (NAG25; )s(invAb)scucaauAfAfAfgugcuuugaausu(invAb) 879 CUCAAUAAAGUGCUUUGAAUU

(NAG25 )s(invAb)sCfuCfaAfuAfAfAfgUfgCfuUfuGfaausu

AM05694-SS 563 879 CUCAAUAAAGUGCUUUGAAUU

(invAb)

Sense Strand SEQ ID Sense Sequence SEQ Underlying Sense Base Sequence ID: NO. (Modified) ID NO. (5'→ 3 )

(5'→3')

AM05697-SS 564 (NAG25)sasacucaauaAfAfGfugcuuugaaas(invAb) 830 AACUCAAUAAAGUGCUUUGAAA

AM05699-SS 565 (N AG25 )s asgcucaauaAf AfGfugcuuugaaas (inv Ab) 853 AGCUCAAUAAAGUGCUUUGAAA

AM05701-SS 566 (NAG25)sgsacucaauaAfAfGfugcuuugaaas(invAb) 890 GACUCAAUAAAGUGCUUUGAAA

AM05703-SS 567 (NAG25)sgsgacucaauaAfAfGfugcuuugaaas(invAb) 919 GGACUCAAUAAAGUGCUUUGAAA

AM05706-SS 568 (NAG25)s(invAb)sucaauaAfAfGfugcuuugaaas(invAb) 934 UCAAUAAAGUGCUUUGAAA

AM05709-SS 569 (NAG25)s(invAb)sucaauaAfAfGfugcuuugaaausu(invAb) 936 UCAAUAAAGUGCUUUGAAAUU

AM05710-SS 570 (NAG25)sgsgcucaauaAfAfGfugcuuugaaas(invAb) 927 GGCUCAAUAAAGUGCUUUGAAA

(NAG25)s(invAb)sUfcAfaUfaAfAfGfuGfcUfuUfgAfaausu

AM05712-SS 571 936 UCAAUAAAGUGCUUUGAAAUU

(invAb)

AM05716-SS 572 (N AG25 )s (inv Ab)sucaauaAf AfGfugcuuugaaauus (inv Ab) 936 UCAAUAAAGUGCUUUGAAAUU

(NAG25)s(invAb)sUfcAfaUfaAfAfGfuGfcUfuUfgAfaauus

AM05717-SS 573 936 UCAAUAAAGUGCUUUGAAAUU

(invAb)

AM05719-SS 574 (NAG25)sascucaAfuaAfAfGfuGfcuuUfgAfaas(invAb) 846 ACUCAAUAAAGUGCUUUGAAA

AM05721-SS 575 (N AG25 )sgs aacucaAfuaAf AfGfuGf cuuUfg Af aas (inv Ab) 886 GAACUCAAUAAAGUGCUUUGAAA

AM05723-SS 576 (NAG31 )sascucaauaAf AfGfugcuuugaaas(invAb) 846 ACUCAAUAAAGUGCUUUGAAA

AM05724-SS 577 (NAG25)s(invAb)sacucaauaAfAfGfugcuuugaaas(invAb) 846 ACUCAAUAAAGUGCUUUGAAA

AM05725-SS 578 (NAG25)sgsggaacucAfAfUfaaagugcuuas(invAb) 928 GGGAACUCAAUAAAGUGCUUA

AM05727-SS 579 (NAG25)sasggaacucAfAfUfaaagugcuuus(invAb) 857 AGGAACUCAAUAAAGUGCUUU

AM05730-SS 580 (N AG25 )s csaggaacuc Af AfUf aaagugcuuas (inv Ab) 863 CAGGAACUCAAUAAAGUGCUUA

AM05732-SS 581 (NAG25)s(invAb)sgaacucAfAfUfaaagugcuuauus(invAb) 883 GAACUCAAUAAAGUGCUUAUU

(NAG25)s(invAb)sGfaacucAfAfUfaaagugcUfuausu(invAb

AM05734-SS 582 883 GAACUCAAUAAAGUGCUUAUU

)

(NAG25)s(invAb)sGfaAfcUfcAfAfUfaAfagugcUfuausu(in

AM05735-SS 583 883 GAACUCAAUAAAGUGCUUAUU

vAb)

AM05738-SS 584 (NAG31 )sasggaacucAf AfUfaaagugcuuas(inv Ab) 855 AGGAACUCAAUAAAGUGCUUA

Sense Strand SEQ ID Sense Sequence SEQ Underlying Sense Base Sequence ID: NO. (Modified) ID NO. (5'→ 3 )

(5'→3')

AM05739-SS 585 (NAG25)s(invAb)saggaacucAfAfUfaaagugcuuas(invAb) 855 AGGAACUCAAUAAAGUGCUUA

AM05740-SS 586 (NAG25)saggaacucAfAfUfaaagugcuuas(invAb) 855 AGGAACUCAAUAAAGUGCUUA

AM05741-SS 587 (NAG25)sasggaaCfucAfAfUfaAfaguGfcUfuas(invAb) 855 AGGAACUCAAUAAAGUGCUUA

AM05743-SS 588 (NAG25)sasgGfaacucAfAfUfaaagugcuuas(invAb) 855 AGGAACUCAAUAAAGUGCUUA

AM05748-SS 589 (NAG31 )sasacucaauAf Af Afgugcuuugaas(invAb) 829 AACUCAAUAAAGUGCUUUGAA

AM05749-SS 590 (NAG25)sasacucAfauAfAfAfgUfgcuGfuGfaas(invAb) 1027 AACUCAAUAAAGUGCUGUGAA

AM05751-SS 591 (NAG31 )sgsaacucaauAf Af Afgugcuuugaas(invAb) 885 GAACUCAAUAAAGUGCUUUGAA

AM05752-SS 592 (NAG25)sgsaacucAfauAfAfAfgUfgcuGfuGfaas(invAb) 882 GAACUCAAUAAAGUGCUGUGAA

AM05770-SS 593 (NAG25)sasacucAfauAfAfAfgUfgcuUfuGfaas(invAb) 829 AACUCAAUAAAGUGCUUUGAA

AM05771-SS 594 (NAG25)sgsaacucAfauAfAfAfgUfgcuUfuGfaas(invAb) 885 GAACUCAAUAAAGUGCUUUGAA

AM05821-SS 595 (NAG25)sgscccaaGfaAfAfGfugaaagaccas(invAb) 898 GCCCAAGAAAGUGAAAGACCA

AM05822-SS 596 (NAG25)sgscCfcaaGfaAfAfGfugaaagaccas(invAb) 898 GC CC AAGA AAGUGAAAGAC C A

AM05830-SS 597 (NAG25)saacucaauAfAfAfgugcuuugaas(invAb) 829 AACUCAAUAAAGUGCUUUGAA

AM05831-SS 598 (NAG25)saaCfuCfaauAfAfAfgugcuuugaas(invAb) 829 AACUCAAUAAAGUGCUUUGAA

AM05832-SS 599 (NAG25)saacucaAfuAfAfAfgugcuuugaas(invAb) 829 AACUCAAUAAAGUGCUUUGAA

AM05843-SS 600 (NAG25)susuggagccCfAfAfgaaagugaaas(invAb) 948 UUGGAGCCCAAGAAAGUGAAA

AM05844-SS 601 (NAG25)susuggagCfcCfAfAfgaaagugaaas(invAb) 948 UUGGAGCCCAAGAAAGUGAAA

AM05845-SS 602 (NAG25)susuGfgAfgCfcCfAfAfgaaagugaaas(invAb) 948 UUGGAGCCCAAGAAAGUGAAA

AM05846-SS 603 (NAG25)sgsgagccCfAfAfgaaagugaaas(invAb) 921 GGAGCCCAAGAAAGUGAAA

AM05847-SS 604 (NAG25)sgsgagccCfAfAfgaaagugaaauus(invAb) 922 GGAGCCCAAGAAAGUGAAAUU

AM05848-SS 605 (NAG25)(invAb)ggagccCfAfAfgaaagugaaauus(invAb) 922 GGAGCCCAAGAAAGUGAAAUU

AM05907-SS 606 (N AG25 )s cs ccaaggaGf Cf Afuaaguacaaas(inv Ab) 868 CCCAAGGAGCAUAAGUACAAA

AM05908-SS 607 (NAG25)s(invAb)suuggagucAfAfCfacuuucgauas(invAb) 949 UUGGAGUCAACACUUUCGAUA

AM05909-SS 608 (NAG25)s(invAb)sccaaggAfGfCfauaaguacaauus(invAb) 866 CCAAGGAGCAUAAGUACAAUU

Sense Strand SEQ ID Sense Sequence SEQ Underlying Sense Base Sequence ID: NO. (Modified) ID NO. (5'→ 3 )

(5'→3')

AM05910-SS 609 (NAG25)s(invAb)scgcaagAfGfUfcugucuucgauus(invAb) 876 CGCAAGAGUCUGUCUUCGAUU

AM05911-SS 610 (N AG37)s as acucaauAf Af Afgugcuuugaas(inv Ab) 829 AACUCAAUAAAGUGCUUUGAA

AM05912-SS 611 (NAG37)scsccaaggaGfCfAfuaaguacaaas(invAb) 868 CCCAAGGAGCAUAAGUACAAA

AM05913-SS 612 (NAG37)s(invAb)suuggagucAfAfCfacuuucgauas(invAb) 949 UUGGAGUCAACACUUUCGAUA

AM05914-SS 613 (NAG37)s(invAb)sccaaggAfGfCfauaaguacaauus(invAb) 866 CCAAGGAGCAUAAGUACAAUU

AM05915-SS 614 (NAG37)s(invAb)scgcaagAfGfUfcugucuucgauus(invAb) 876 CGCAAGAGUCUGUCUUCGAUU

AM05949-SS 615 (NAG38)sasacucaauAfAfAfgugcuuugaas(invAb) 829 AACUCAAUAAAGUGCUUUGAA

AM05951-SS 616 (N AG33 )s as acucaauAf AfAfgugcuuugaas(invAb) 829 AACUCAAUAAAGUGCUUUGAA

AM06063-SS 617 (NAG25)sgsgaacucaauAfAfAfgugcuuugas(invdA) 917 GGAACUCAAUAAAGUGCUUUGAA

AM06064-SS 618 (NAG25)sgsaacucaauAfAfAfgugcuuugas(invdA) 885 GAACUCAAUAAAGUGCUUUGAA

(NAG25)s(invAb)sgaacucaauAfAfAfgugcuuugaauus(invA

AM06065-SS 619 887 GAACUCAAUAAAGUGCUUUGAAUU b)

AM06066-SS 620 (NAG25)s(invAb)scucaauAfAfAfgugcuuugaauus(invAb) 879 CUCAAUAAAGUGCUUUGAAUU

AM06067-SS 621 (NAG25)sgsgaacucaauAfAfAfgugcuuugs(invdA) 916 GGAACUCAAUAAAGUGCUUUGA

AM06098-SS 622 (NAG37)s(invAb)sggagucAfAfCfacuuucgauauus(invAb) 925 GGAGUCAACACUUUCGAUAUU

AM06099-SS 623 (NAG37)s(invAb)sggagucAfAfCfacuuucgauas(invAb) 924 GGAGUCAACACUUUCGAUA

AM06100-SS 624 (NAG37)scsuuggagucAfAfCfacuuucgauas(invAb) 881 CUUGGAGUCAACACUUUCGAUA

AM06101-SS 625 (NAG37)scscccaaggAfGfCfauaaguacaas(invAb) 872 CCCCAAGGAGCAUAAGUACAA

AM06105-SS 626 (NAG37)s(invAb)scaaggaGfCfAfuaaguacaaauus(invAb) 861 CAAGGAGCAUAAGUACAAAUU

AM06110-SS 627 (NAG37)s(invAb)scccaaggaGfCfAfuaaguacaaas(invAb) 868 CCCAAGGAGCAUAAGUACAAA

AM06111-SS 628 (NAG37)s(invAb)sccccaaggaGfCfAfuaaguacaaas(invAb) 873 CCCCAAGGAGCAUAAGUACAAA

AM06112-SS 629 (NAG37)s(invAb)scccaaggaGfCfAfuaaguacaaauus(invAb) 869 CCCAAGGAGCAUAAGUACAAAUU

AM06115-SS 630 (NAG37)s(invAb)sccccaaggAfGfCfauaaguacaas(invAb) 872 CCCCAAGGAGCAUAAGUACAA

AM06116-SS 631 (NAG37)s(invAb)scccaaggAfGfCfauaaguacaauus(invAb) 871 CCCAAGGAGCAUAAGUACAAUU

Sense Strand SEQ ID Sense Sequence SEQ Underlying Sense Base Sequence ID: NO. (Modified) ID NO. (5'→ 3 )

(5'→3')

AM06118-SS 632 (NAG37)s(invAb)scuuggagucAfAfCfacuuucgauas(invAb) 881 CUUGGAGUCAACACUUUCGAUA

AM06119-SS 633 (NAG37)s(invAb)sgcuuggagucAfAfCfacuuucgauas(invAb) 912 GCUUGGAGUCAACACUUUCGAUA

AM06345-SS 634 (N AG37)s cs ccaaggaGf Cf Afuaaguacaas (invd A) 868 CCCAAGGAGCAUAAGUACAAA

AM06346-SS 635 (NAG37)cccaaggagcAfuaaguacaa(invdA) 868 CCCAAGGAGCAUAAGUACAAA

AM06347-SS 636 (NAG37)cccaaggagcauaaguacaa(invdA) 868 CCCAAGGAGCAUAAGUACAAA

AM06348-SS 637 (NAG37)s(invAb)sccaaggaGfCfAfuaaguacaas(invdA) 865 CCAAGGAGCAUAAGUACAAA

AM06349-SS 638 (NAG37)s(invAb)scaaggaGfCfAfuaaguacaas(invdA) 860 CAAGGAGCAUAAGUACAAA

AM06351-SS 639 (NAG37)scsccaaggaGfCfAfuaaguacaaus(invAb) 870 CCCAAGGAGCAUAAGUACAAU

AM06587-SS 640 (NAG37)sascucaauaAfAfGfugcuuugaaas(invAb) 846 ACUCAAUAAAGUGCUUUGAAA

AM07040-SS 641 (NAG37)s(invAb)sgccaaggaGfCfAfuaaguacaaas(invAb) 896 GC CAAGGAGCAUAAGUACAAA

AM07042-SS 642 (NAG37)s(invAb)sgccaaggaGfCfAfuaaiuacaaas(invAb) 897 GCCAAGGAGCAUAAIUACAAA

AM07044-SS 643 (NAG37)gsccaaggaGfCfAfuaaguacaaas(invAb) 896 GCCAAGGAGCAUAAGUACAAA

AM07045-SS 644 (NAG37)s(invAb)sgcccaaggAfGfCfauaaguacaas(invAb) 899 GCCCAAGGAGCAUAAGUACAA

AM07047-SS 645 (NAG37)s(invAb)sgccccaagGfAfGfcauaaguacas(invAb) 900 GCCCCAAGGAGCAUAAGUACA

AM07049-SS 646 (NAG37)s(invAb)sgcaaggagCfAfUfaaguacaaaas(invAb) 894 GCAAGGAGCAUAAGUACAAAA

AM07051-SS 647 (NAG37)s(invAb)scgaggagcAfUfAfaguacaaagas(invAb) 875 CGAGGAGCAUAAGUACAAAGA

AM07053-SS 648 (NAG37)s(invAb)sggaggagcAfUfAfaguacaaagas(invAb) 923 GGAGGAGCAUAAGUACAAAGA

AM07055-SS 649 (NAG37)s(invAb)sggagcauaAfGfUfacaaagcugas(invAb) 920 GGAGCAUAAGUACAAAGCUGA

AM07057-SS 650 (NAG37)s(invAb)sagcuguacCfAfCfaaauguaccas(invAb) 854 AGCUGUACCACAAAUGUACCA

AM07248-SS 651 (NAG37)s(invAb)saccaaggaGfCfAfuaaguacaaas(invAb) 844 ACCAAGGAGCAUAAGUACAAA

AM07250-SS 652 (NAG37)asccaaggaGfCfAfuaaguacaaas(invAb) 844 ACCAAGGAGCAUAAGUACAAA

AM07251-SS 653 (NAG37)gsccaaggaGfCfAfuAaguacaaas(invAb) 896 GCCAAGGAGCAUAAGUACAAA

AM07252-SS 654 (NAG37)s(invAb)scuuggaguCfAfAfcacuuucgaus(invAb) 880 CUUGGAGUCAACACUUUCGAU

AM07254-SS 655 (NAG37)s(invAb)sgcuggaguCfAfAfcacuuucgaus(invAb) 911 GCUGGAGUCAACACUUUCGAU

The FX 11 RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 4, or Table 6 can be hybridized to any antisense strand containing a sequence listed in Table 2, Table 3, or Table 6, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.

In some embodiments, the antisense strand of an FXII RN Ai agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 3. In some embodiments, the sense strand of an FXII RNAi agent disclosed herein differs by 0, 1 , 2, or 3 nucleotides from any of the sense strand sequences in Table 4.

In some embodiments, an FXII RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2, Table 3, or Table 6. In some embodiments, an FXII RNAi agent antisense strand comprises the sequence of nucleotides (from 5' end - 3' end) 1 -17, 2-17, 1 -18, 2-18, 1-19, 2-19, 1-20, 2-20, 1 -21, 2-21 , 1 -22, 2-22, 1-23, 2-23, 1 -24, or 2-24, 1 -25, 2-25, 1 -16, or 2-16 of any of the sequences in Table 2, Table 3, or Table 6. In certain embodi ments, an FXI I RNAi agent antisense strand comprises or consists of a modi fied sequence of any one of the modi fied sequences in Table 3. In certain embodiments, an FXII RNAi agent sense strand comprises or consists of a modi fied sequence of any one of the modi fied sequences in Table 6.

In some embodiments, an FXII RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Table 2, Table 4, or Table 6. In some embodiments, an FXII RNAi agent sense strand comprises the sequence of nucleotides (from 5' end - 3' end) 1- 17, 2-17, 3-17, 4-17, 1 -18, 2-18, 3-18, 4-18, 1 -19, 2-19, 3-19, 4-19, 1 -20, 2-20, 3-20, 4-20, 1 -21, 2-21 , 3-21, 4-21, 1 -22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1 -24, 2-24, 3-24, 4- 24, 1-25, 2-25, 3-25, 4-25, 1 -26, 2-26, 3-26, or 4-26, of any of the sequences in Table 2, Table 4. or Table 6. In certain embodiments, an FXI I RNAi agent sense strand comprises or consists of a modi fied sequence of any one of the modi fied sequences in Table 5. In certain embodi ments, an FXI I RNAi agent sense strand comprises or consists of a modi fied sequence of any one of the modi fied sequences in Table 6. For the FXII RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5' end - 3' end) can be perfectly complementary to an FXII gene, or can be non-complementary to an FXII gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5' end - 3' end) is a U, A, or dT (or a modified version of U, A or dT). In some embodiments, the nucleotide at position 1 of the antisense strand (from 5' end - 3' end) forms an A:U or U:A base pair with the sense strand.

In some embodiments, an FXII RNAi agent antisense strand comprises the sequence of nucleotides (from 5' end - 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3, or Table 6. In some embodiments, an FXII RNAi sense strand comprises the sequence of nucleotides (from 5' end - 3' end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 4, or Table 6.

In some embodiments, an FXII RNAi agent includes (i) an antisense strand comprising the sequence of nucleotides (from 5' end - 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3, or Table 6, and (ii) a sense strand comprising the sequence of nucleotides (from 5' end - 3' end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 4, or Table 6. A sense strand containing a sequence listed in Table 2, Table 4, or Table 6 can be hybridized to any antisense strand containing a sequence listed in Table 2, Table 3, or Table 6, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 1 7. 18, 19, 20, or 21 nucleotide sequence. In some embodiments, the FXII RNAi agent has a sense strand consisting of the modified sequence of any of the modified sequences in Table 4, and an antisense strand consisting of the modified sequence of any of the modified sequences in Table 3. Certain representative sequence pairings are exemplified by the Duplex ID Nos. shown in Table 5 and Table 6.

In some embodiments, an FXII RNAi agent comprises any of the duplexes represented by any of the Duplex ID Nos. presented herein. In some embodiments, an FXII RNAi agent consists of any of the duplexes represented by any of the Duplex ID Nos. presented herein. In some embodiments, an FXII RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos. presented herein. In some embodiments, an FXII RNAi agent includes the sense strand and antisense strand nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos. presented herein and a targeting group and/or linking group, wherein the targeting group and/or linking group is covalently linked (i.e., conjugated) to the sense strand or the antisense strand. In some embodiments, an FXII RNAi agent includes the sense strand and antisense strand modified nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos. presented herein. In some embodiments, an FXII RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos. presented herein and a targeting group and/or linking group, wherein the targeting group and/or linking group is covalently linked to the sense strand or the antisense strand.

In some embodiments, an FXII RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 2, Table 5, or Table 6, and comprises an asialoglycoprotein receptor ligand targeting group.

In some embodiments, an FXII RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 2, Table 5, or Table 6, and further comprises a targeting group selected from the group consisting of (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. In some embodiments, the targeting group is (NAG25) or (NAG25)s as defined in Table 7. In other embodiments, the targeting group is (NAG37) or (NAG37)s as defined in Table 7.

In some embodiments, an FXII RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequence of any of the antisense strand and/or sense strand nucleotide sequences of any of the duplexes of Table 5. In some embodiments, an FXII RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand and/or sense strand nucleotide sequences of any of the duplexes of Table 5, and comprises an asialoglycoprotein receptor ligand targeting group.

In some embodiments, an FXII RNAi agent comprises, consists of, or consists essentially of, the duplex structure of any of the duplexes in Table 5.

Table 5. FXII RNAi Agents Identi fied by Duplex I D No. with Corresponding Sense and Antisense Strands.

Antisense Sense Antisense Sense

Duplex ID Duplex ID

Strand ID Strand ID Strand ID Strand ID

AD03224 AM04048-AS AM03844-SS AD03815 AM04842-AS AM04840-SS

AD03592 AM04568-AS AM04558-SS AD03816 AM04843-AS AM04840-SS

AD03593 AM03965-AS AM04558-SS AD03817 AM04844-AS AM04836-SS

AD03594 AM04569-AS AM04558-SS AD03819 AM04048-AS AM04847-SS

AD03595 AM04570-AS AM04558-SS AD03820 AM04568-AS AM04554-SS

AD03596 AM04571-AS AM04558-SS AD03865 AM04048-AS AM04881-SS

AD03600 AM04575-AS AM04561-SS AD03866 AM04903-AS AM04882-SS

AD03601 AM04576-AS AM04561-SS AD03868 AM04905-AS AM04883-SS

AD03602 AM04577-AS AM04561-SS AD03869 AM04906-AS AM04884-SS

AD03632 AM04048-AS AM04613-SS AD03870 AM04907-AS AM04885-SS

AD03635 AM03157-AS AM04130-SS AD03872 AM04909-AS AM04886-SS

AD03637 AM04619-AS AM04558-SS AD03873 AM04910-AS AM04887-SS

AD03638 AM04620-AS AM04558-SS AD03874 AM04911-AS AM04888-SS

AD03773 AM04619-AS AM04554-SS AD03876 AM04913-AS AM04889-SS

AD03774 AM04620-AS AM04554-SS AD03877 AM04914-AS AM04890-SS

AD03782 AM04568-AS AM04814-SS AD03878 AM04915-AS AM04891-SS

AD03783 AM03965-AS AM04814-SS AD03879 AM04916-AS AM04891-SS

AD03784 AM04569-AS AM04814-SS AD03880 AM04917-AS AM04892-SS

AD03785 AM04570-AS AM04814-SS AD03881 AM04918-AS AM04893-SS

AD03786 AM04571-AS AM04814-SS AD03882 AM04919-AS AM04894-SS

AD03790 AM04575-AS AM04815-SS AD03884 AM04921-AS AM04895-SS

AD03791 AM04576-AS AM04815-SS AD03885 AM04922-AS AM04896-SS

AD03792 AM04577-AS AM04815-SS AD03886 AM04923-AS AM04897-SS

AD03807 AM04048-AS AM04836-SS AD03888 AM04925-AS AM04898-SS

AD03808 AM04048-AS AM04837-SS AD03889 AM04926-AS AM04899-SS

AD03809 AM04048-AS AM04845-SS AD03890 AM04927-AS AM04900-SS

AD03810 AM04048-AS AM04838-SS AD03892 AM04929-AS AM04901-SS

AD03811 AM04048-AS AM04839-SS AD03893 AM04930-AS AM04902-SS

AD03812 AM04048-AS AM04840-SS AD03894 AM04932-AS AM04931-SS

AD03813 AM04841-AS AM04840-SS AD03895 AM04932-AS AM04933-SS

AD03814 AM04842-AS AM04836-SS AD03896 AM04932-AS AM04934-SS Antisense Sense Antisense Sense

Duplex 1 Li Du lex ID

Strand ID Strand ID Strand ID Strand ID

AD03897 AM04932-AS AM04935-SS AD04135 AM05265-AS AM04985-SS

AD03898 AM04936-AS AM04935-SS AD04136 AM05266-AS AM04985-SS

AD03899 AM04938-AS AM04937-SS AD04137 AM05268-AS AM05267-SS

AD03900 AM04047-AS AM04939-SS AD04138 AM05270-AS AM05269-SS

AD03901 AM04941-AS AM04940-SS AD04139 AM05270-AS AM05271-SS

AD03902 AM04943-AS AM04942-SS AD04140 AM04926-AS AM05272-SS

AD03903 AM04945-AS AM04944-SS AD04141 AM05274-AS AM05273-SS

AD03904 AM04947-AS AM04946-SS AD04142 AM05276-AS AM05275-SS

AD03905 AM04949-AS AM04948-SS AD04143 AM05278-AS AM05277-SS

AD03906 AM04951-AS AM04950-SS AD04144 AM05279-AS AM04892-SS

AD03907 AM04953-AS AM04952-SS AD04147 AM04917-AS AM05282-SS

AD03908 AM04955-AS AM04954-SS AD04148 AM04917-AS AM05283-SS

AD03909 AM04957-AS AM04956-SS AD04149 AM04917-AS AM05284-SS

AD03910 AM04959-AS AM04958-SS AD04151 AM04917-AS AM05286-SS

AD03911 AM04959-AS AM04960-SS AD04152 AM04917-AS AM05287-SS

AD03912 AM04959-AS AM04961-SS AD04153 AM05289-AS AM05288-SS

AD03913 AM04959-AS AM04962-SS AD04157 AM05327-AS AM05317-SS

AD03914 AM04959-AS AM04963-SS AD04158 AM05327-AS AM05318-SS

AD03915 AM04959-AS AM04964-SS AD04159 AM05328-AS AM05318-SS

AD03916 AM04959-AS AM04965-SS AD04160 AM05329-AS AM05319-SS

AD03917 AM04959-AS AM04966-SS AD04161 AM05330-AS AM05320-SS

AD03918 AM04959-AS AM04967-SS AD04162 AM05331-AS AM05321-SS

AD03919 AM04959-AS AM04968-SS AD04163 AM05332-AS AM05322-SS

AD03927 AM03977-AS AM04974-SS AD04164 AM05333-AS AM05323-SS

AD03928 AM04959-AS AM04975-SS AD04165 AM05334-AS AM05324-SS

AD03934 AM04903-AS AM04980-SS AD04166 AM05335-AS AM05325-SS

AD03936 AM04907-AS AM04981-SS AD04167 AM05336-AS AM05326-SS

AD03938 AM04911-AS AM04982-SS AD04191 AM05367-AS AM05366-SS

AD03940 AM04915-AS AM04983-SS AD04193 AM05370-AS AM05369-SS

AD03942 AM04919-AS AM04984-SS AD04195 AM05373-AS AM05372-SS

AD03944 AM04923-AS AM04985-SS AD04197 AM05376-AS AM05375-SS

AD03946 AM04927-AS AM04986-SS AD04199 AM05379-AS AM05378-SS

AD03948 AM04932-AS AM04987-SS AD04200 AM05382-AS AM05380-SS

AD03989 AM04930-AS AM05031-SS AD04203 AM04923-AS AM05384-SS

AD03990 AM04930-AS AM05032-SS AD04204 AM05379-AS AM05385-SS

AD04014 AM05066-AS AM05065-SS AD04205 AM05379-AS AM05386-SS

AD04120 AM05248-AS AM05245-SS AD04208 AM05327-AS AM05389-SS

AD04121 AM05256-AS AM05249-SS AD04209 AM05331-AS AM05390-SS

AD04124 AM05257-AS AM05251-SS AD04254 AM05478-AS AM05324-SS

AD04125 AM05257-AS AM05259-SS AD04255 AM05479-AS AM05325-SS

AD04126 AM05246-AS AM05252-SS AD04256 AM05480-AS AM05326-SS

AD04127 AM05246-AS AM05253-SS AD04258 AM05482-AS AM05375-SS

AD04130 AM05246-AS AM05254-SS AD04321 AM05257-AS AM05534-SS

AD04131 AM05261-AS AM05255-SS AD04324 AM05257-AS AM05535-SS

AD04132 AM05262-AS AM05254-SS AD04327 AM05246-AS AM05535-SS Antisense Sense Antisense Sense

Duplex 1 Li Du lex ID

Strand ID Strand ID Strand ID Strand ID

AD04330 AM05261-AS AM05536-SS AD04484 AM05708-AS AM05706-SS

AD04333 AM05270-AS AM05537-SS AD04485 AM05707-AS AM05709-SS

AD04336 AM05270-AS AM05538-SS AD04486 AM05708-AS AM05709-SS

AD04339 AM04926-AS AM05539-SS AD04487 AM05711-AS AM05710-SS

AD04342 AM05274-AS AM05540-SS AD04488 AM05713-AS AM05712-SS

AD04345 AM05276-AS AM05541-SS AD04489 AM05708-AS AM05716-SS

AD04348 AM05278-AS AM05542-SS AD04490 AM05718-AS AM05717-SS

AD04351 AM05274-AS AM05543-SS AD04491 AM05720-AS AM05719-SS

AD04352 AM05274-AS AM05544-SS AD04492 AM05722-AS AM05721-SS

AD04353 AM05274-AS AM05545-SS AD04493 AM05478-AS AM05723-SS

AD04354 AM05274-AS AM05546-SS AD04494 AM05478-AS AM05724-SS

AD04355 AM05274-AS AM05547-SS AD04495 AM05726-AS AM05725-SS

AD04356 AM05274-AS AM05548-SS AD04496 AM05728-AS AM05727-SS

AD04357 AM05274-AS AM05549-SS AD04497 AM05729-AS AM05317-SS

AD04358 AM05274-AS AM05550-SS AD04498 AM05731-AS AM05730-SS

AD04395 AM05246-AS AM05587-SS AD04499 AM05733-AS AM05732-SS

AD04396 AM05246-AS AM05588-SS AD04500 AM05327-AS AM05743-SS

AD04397 AM05246-AS AM05589-SS AD04501 AM05733-AS AM05734-SS

AD04398 AM05590-AS AM05535-SS AD04502 AM05733-AS AM05735-SS

AD04399 AM05591-AS AM05535-SS AD04503 AM05736-AS AM05735-SS

AD04400 AM05261-AS AM05592-SS AD04505 AM05327-AS AM05738-SS

AD04401 AM05261-AS AM05593-SS AD04506 AM05327-AS AM05739-SS

AD04402 AM05261-AS AM05594-SS AD04507 AM05327-AS AM05740-SS

AD04403 AM05596-AS AM05595-SS AD04508 AM05742-AS AM05741-SS

AD04404 AM05597-AS AM05536-SS AD04512 AM05331-AS AM05748-SS

AD04443 AM05641-AS AM05324-SS AD04513 AM05750-AS AM05749-SS

AD04465 AM05681-AS AM05680-SS AD04514 AM05332-AS AM05751-SS

AD04466 AM05683-AS AM05682-SS AD04515 AM05753-AS AM05752-SS

AD04467 AM05685-AS AM05684-SS AD04524 AM05750-AS AM05770-SS

AD04468 AM05686-AS AM05321-SS AD04525 AM05753-AS AM05771-SS

AD04469 AM05687-AS AM05321-SS AD04547 AM05818-AS AM05535-SS

AD04470 AM05689-AS AM05688-SS AD04548 AM05818-AS AM05254-SS

AD04471 AM05691-AS AM05690-SS AD04549 AM05819-AS AM05821-SS

AD04472 AM05692-AS AM05690-SS AD04550 AM05247-AS AM05535-SS

AD04473 AM05691-AS AM05693-SS AD04551 AM05247-AS AM05822-SS

AD04474 AM05692-AS AM05693-SS AD04552 AM05820-AS AM05535-SS

AD04475 AM05695-AS AM05694-SS AD04553 AM05820-AS AM05822-SS

AD04476 AM05679-AS AM05678-SS AD04554 AM05823-AS AM05321-SS

AD04477 AM05696-AS AM05324-SS AD04555 AM05824-AS AM05321-SS

AD04478 AM05698-AS AM05697-SS AD04556 AM05825-AS AM05830-SS

AD04479 AM05700-AS AM05699-SS AD04557 AM05825-AS AM05831-SS

AD04480 AM05702-AS AM05701-SS AD04558 AM05826-AS AM05832-SS

AD04481 AM05704-AS AM05703-SS AD04559 AM05836-AS AM05843-SS

AD04482 AM05705-AS AM05324-SS AD04560 AM05837-AS AM05843-SS

AD04483 AM05707-AS AM05706-SS AD04561 AM05838-AS AM05844-SS Antisense Sense Antisense Sense

Duplex 1 Li Du lex ID

Strand ID Strand ID Strand ID Strand ID

AD04562 AM05837-AS AM05845-SS AD04755 AM06097-AS AM06112-SS

AD04563 AM05839-AS AM05843-SS AD04757 AM06113-AS AM06115-SS

AD04564 AM05837-AS AM05844-SS AD04758 AM06114-AS AM06116-SS

AD04565 AM05840-AS AM05843-SS AD04759 AM06095-AS AM06118-SS

AD04566 AM05841-AS AM05846-SS AD04760 AM06117-AS AM06119-SS

AD04567 AM05841-AS AM05847-SS AD04899 AM06334-AS AM06345-SS

AD04568 AM05842-AS AM05847-SS AD04900 AM06335-AS AM06345-SS

AD04569 AM05842-AS AM05848-SS AD04901 AM06334-AS AM06346-SS

AD04618 AM05902-AS AM05321-SS AD04902 AM06334-AS AM06347-SS

AD04619 AM05903-AS AM05907-SS AD04903 AM06336-AS AM06348-SS

AD04620 AM05904-AS AM05908-SS AD04904 AM06337-AS AM06348-SS

AD04621 AM05905-AS AM05909-SS AD04905 AM06104-AS AM06349-SS

AD04622 AM05906-AS AM05910-SS AD04906 AM06338-AS AM06349-SS

AD04623 AM05331-AS AM05911-SS AD04907 AM06339-AS AM06350-SS

AD04624 AM05902-AS AM05911-SS AD04911 AM06343-AS AM06349-SS

AD04625 AM05903-AS AM05912-SS AD04912 AM06344-AS AM06351-SS

AD04626 AM05904-AS AM05913-SS AD05055 AM05478-AS AM06587-SS

AD04627 AM05905-AS AM05914-SS AD05330 AM07041-AS AM07040-SS

AD04628 AM05906-AS AM05915-SS AD05331 AM07041-AS AM07042-SS

AD04649 AM05950-AS AM05321-SS AD05332 AM07043-AS AM07040-SS

AD04650 AM05331-AS AM05951-SS AD05333 AM07041-AS AM07044-SS

AD04651 AM05331-AS AM05949-SS AD05334 AM07046-AS AM07045-SS

AD04722 AM05825-AS AM06063-SS AD05335 AM07048-AS AM07047-SS

AD04723 AM05825-AS AM06064-SS AD05336 AM07050-AS AM07049-SS

AD04724 AM06060-AS AM06064-SS AD05337 AM07052-AS AM07051-SS

AD04725 AM06061-AS AM06065-SS AD05338 AM07054-AS AM07053-SS

AD04726 AM06062-AS AM06066-SS AD05339 AM07056-AS AM07055-SS

AD04727 AM05825-AS AM06067-SS AD05340 AM07058-AS AM07057-SS

AD04743 AM06093-AS AM06098-SS AD05496 AM07249-AS AM07248-SS

AD04744 AM06093-AS AM06099-SS AD05497 AM07249-AS AM07250-SS

AD04745 AM06094-AS AM06099-SS AD05498 AM07041-AS AM07251-SS

AD04746 AM06095-AS AM06100-SS AD05499 AM07253-AS AM07252-SS

AD04747 AM06096-AS AM06101-SS AD05500 AM07255-AS AM07254-SS

AD04748 AM06097-AS AM05912-SS AD05501 AM07257-AS AM07256-SS

AD04749 AM06103-AS AM05912-SS AD05502 AM07259-AS AM07258-SS

AD04750 AM06104-AS AM06105-SS AD05503 AM07261-AS AM07260-SS

AD04751 AM06097-AS AM06110-SS AD05504 AM07263-AS AM07262-SS

AD04752 AM06106-AS AM05912-SS AD05505 AM07265-AS AM07264-SS

AD04753 AM06107-AS AM06111-SS AD05506 AM07267-AS AM07266-SS

AD04754 AM06108-AS AM06111-SS Table 6. Additional Modified FXII RNAi Agent Duplexes (With Corresponding Antisense Strand and Sense Strand Sequences).

DUPLEX SEQ ID NO: SEQ ID NO: ID: Antisense Sequence (5' → 3') Sense Sequence (5' → 3')

91 2 uAfuCfgAfaAfgUfgUfuGfaCfuCfcuu 952 ggAfgUfcAfAfCfaCfuUfuCfgAfuauu 989

91 3 uAfuCfgAfaAfGfUfgUfuGfaCfuCfcuu 953 ggAfgUfcAfAfCfaCfuUfuCfgAfuauu 990

91 4 UAfuCfgAfaAfgUfgUfuGfaCfuCfcuu 954 ggAfgUfcAfAfCfacuuucgauauu 991

91 5 UAfuCfgAfaAfgUfgUfuGfaCfuCfcuu 955 ggagucAfAfCfacuuucgauauu 992

91 6 uAfuCfgAfaagugUfuGfaCfuCfcuu 955 ggagucAfAfCfacuuucgauauu 993

91 7 uAfuCfgAfaagugUfuGfaCfuCfcaa 956 ggagucAfAfCfacuuucgauauu 994

91 8 uAfucgAfaAfGfuguuGfaCfuccuu 957 ggagUfcAfAfCfacuuucgauauu 995

91 9 uAfuCfgAfaagugUfuGfaCfuCfcAfa 958 uuggagucAfAfCfacuuucgaua 996

91 10 uAfuCfgAfaagugUfuGfaCfuCfcAfacg 959 uuggagucAfAfCfacuuucgaua 997

125 2 uGfuAfcUfuAfUfGfcUfcCfuUfgGfguu 960 ccCfaAfgGfAfGfcAfuAfaGfuAfcauu 998

125 3 uGfuAfcUfuaugcUfcCfuUfgGfguu 961 cccaagGfAfGfcauaaguacauu 999

125 4 uGfuAfcUfuAfuGfcUfcCfuUfgGfguu 962 cccaagGfAfGfcauaaguacauu 1000

125 5 uGfuacUfuAfUfgcUfcCfuuggguu 963 cccaAfgGfAfGfcauaaguacauu 1001

126 2 uUfgUfaCfuUfAfUfgCfuCfcUfuGfguu 964 ccAfaGfgAfGfCfaUfaAfgUfaCfaauu 1002

126 3 uUfgUfaCfuuaugCfuCfcUfuGfguu 965 ccaaggAfGfCfauaaguacaauu 1003

126 4 uUfgUfaCfuUfaUfgCfuCfcUfuGfguu 966 ccaaggAfGfCfauaaguacaauu 1004

126 5 uUfguaCfuUfAfugcuCfcUfugguu 967 ccaaGfgAfGfCfauaaguacaauu 1005

126 6 uUfgUfaCfuuaugCfuCfcUfuGfggu 968 acccaaggAfGfCfauaaguacaa 1006

126 7 uUfgUfaCfuuaugCfuCfcUfuGfggg 969 ccccaaggAfGfCfauaaguacaa 1007

127 2 uUfuGfuAfcUfUfAfuGfcUfcCfuUfguu 970 caAfgGfaGfCfAfuAfaGfuAfcAfaauu 1008

127 3 uUfuGfuAfcuuauGfcUfcCfuUfguu 971 caaggaGfCfAfuaaguacaaauu 1009

127 4 uUfuGfuAfcUfuAfuGfcUfcCfuUfguu 972 caaggaGfCfAfuaaguacaaauu 1010

127 5 uUfuGfuAfcuuauGfcUfcCfuUfgcc 973 ggcaaggaGfCfAfuaaguacaaa 1011

127 6 uUfuGfuAfcUfuAfuGfcUfcCfuUfgcc 974 ggcaaggaGfCfAfuaaguacaaa 1012

132 2 uCfaGfcUfuUfgUfaCfuUfaUfgCfuuu 975 agcauaAfGfUfacaaagcugauu 1013

DUPLEX SEQ ID NO: SEQ ID NO: ID: Antisense Sequence (5' → 3') Sense Sequence (5' → 3')

132 3 uCfaGfcUfuUfgUfaCfuUfaUfgCfuCfc 976 ggagcauaAfGfUfacaaagcuga 1014

223 2 UUfuGfuGfgGfuAfcAfuUfuGfuGfguu 977 ccacaaAfUfGfuacccacaaauu 1015

849 2 uUfgUfcGfuUfgUfcCfgGfgUfuCfcuu 978 ggaaccCfGfGfacaacgacaauu 1016

849 3 aUfgUfcGfuUfgUfcCfgGfgUfuCfcuu 979 ggaaccCfGfGfacaacgacauuu 1017

1139 2 uCfgAfaGfaCfAfGfaCfuCfuUfgCfguu 980 CfgCfaAfgAfGfUfcUfgUfcUfuCfgauu 1018

1139 3 uCfgAfaGfacagaCfuCfuUfgCfguu 981 cgcaagAfGfUfcugucuucgauu 1019

1139 4 uCfgAfaGfaCfaGfaCfuCfuUfgCfguu 982 cgcaagAfGfUfcugucuucgauu 1020

1139 5 uCfgaaGfaCfAfgacuCfuUfgcguu 983 cgcaAfgAfGfUfcugucuucgauu 1021

1476 2 aCfgUfaAfgGfCfGfaCfaGfgAfgCfguu 984 cgCfuCfcUfGfUfcGfcCfuUfaCfguuu 1022

1476 3 uCfgUfaAfgGfCfGfaCfaGfgAfgCfguu 985 CgCfuCfcUfGfUfcGfcCfuUfaCfgauu 1023

1476 4 uCfgUfaAfggcgaCfaGfgAfgCfguu 986 cgcuccUfGfUfcgccuuacgauu 1024

1476 5 uCfgUfaAfgGfcGfaCfaGfgAfgCfguu 987 cgcuccUfGfUfcgccuuacgauu 1025

1476 6 uCfgUfaAfgGfCfgacaGfgAfgcguu 988 cgcuCfcUfGfUfcgccuuacgauu 1026

In some embodiments, an FXII RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. The RNAi agents described herein, upon delivery to a cell expressing an FXII gene, inhibit or knockdow n expression of one or more FXI I genes in vivo. Targeting Groups, Linking Groups, and Delivery Vehicles

In some embodiments, an FXII RNAi agent is conjugated to one or more non-nucleotide groups including, but not limited to, a targeting group, linking group, delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance targeting, delivery or attachment of the RNAi agent. Examples of targeting groups and linking groups are provided in Table 7. The non-nucleotide group can be covalently linked to the 3' and/or 5' end of either the sense strand and/or the antisense strand. In some embodiments, an FXII RNAi agent contains a non-nucleotide group linked to the 3' and/or 5' end of the sense strand. In some embodiments, a non-nucleotide group is linked to the 5' end of an FXII RNAi agent sense strand. A non-nucleotide group can be linked directly or indirectly to the RNAi agent via a linker/linking group. In some embodiments, a non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.

In some embodiments, a non-nucleotide group enhances the pharmacokinetic or biodistribution properties of an RNAi agent or conjugate to which it is attached to improve cell- or tissue-specific distribution and cell-specific uptake of the RNAi agent or conjugate. In some embodiments, a non-nucleotide group enhances endocytosis of the RNAi agent.

Targeting groups or targeting moieties can enhance the pharmacokinetic or biodistribution properties of a conjugate or RNAi agent to which they are attached to improve cell-specific distribution and cell-specific uptake of the conjugate or RNAi agent. A targeting group can be monovalent, divalent, trivalent, tetravalent, or have higher valency for the target to which it is directed. Representative targeting groups include, without limitation, compounds with affinity to cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity to cell surface molecules. In some embodiments, a targeting group is linked to an RNAi agent using a linker, such as a PEG linker or one, two, or three abasic and/or ribitol (abasic ribose) residues, which in some instances can serve as linkers. In some embodiments, a targeting group comprises a galactose-derivative cluster. The FXII RNAi agents described herein can be synthesized having a reactive group, such as an amine group, at the 5 '-terminus. The reactive group can be used to subsequently attach a targeting group using methods typical in the art.

In some embodiments, a targeting group comprises an asialoglycoprotein receptor ligand. In some embodiments, an asialoglycoprotein receptor ligand includes or consists of one or more galactose derivatives. As used herein, the term galactose derivative includes both galactose and derivatives of galactose having affinity for the asialoglycoprotein receptor that is equal to or greater than that of galactose. Galactose derivatives include, but are not limited to: galactose, galactosamine, N-formylgalactosamine, N-acetyl-galactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoylgalactos- amine (see for example: S.T. Iobst and K. Drickamer, J.B.C., 1996, 271, 6686). Galactose derivatives, and clusters of galactose derivatives, that are useful for in vivo targeting of oligonucleotides and other molecules to the liver are known in the art (see, for example, Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al, 1982, J. Biol. Chem, 257, 939-945).

Galactose derivatives have been used to target molecules to hepatocytes in vivo through their binding to the asialoglycoprotein receptor expressed on the surface of hepatocytes. Binding of asialoglycoprotein receptor ligands to the asialoglycoprotein receptor(s) facilitates cell-specific targeting to hepatocytes and endocytosis of the molecule into hepatocytes. Asialoglycoprotein receptor ligands can be monomelic (e.g., having a single galactose derivative) or multimeric (e.g., having multiple galactose derivatives). The galactose derivative or galactose derivative cluster can be attached to the 3' or 5' end of the sense or antisense strand of the RNAi agent using methods known in the art. The preparation of targeting groups, such as galactose derivative clusters, is described in, for example, U.S. Patent Application Serial No. 15/452,324 and U.S. Patent Publication No. US 2017/0253875, the contents of both of which are incorporated by reference herein in their entirety.

As used herein, a galactose derivative cluster comprises a molecule having two to four terminal galactose derivatives. A terminal galactose derivative is attached to a molecule through its C-1 carbon. In some embodiments, the galactose derivative cluster is a galactose derivative trimer (also referred to as tri-antennary galactose derivative or tri-valent galactose derivative). In some embodiments, the galactose derivative cluster comprises N-acetyl- galactosamines. In some embodiments, the galactose derivative cluster comprises three N- acetylgalactosamines. In some embodiments, the galactose derivative cluster is a galactose derivative tetramer (also referred to as tetra-antennary galactose derivative or tetra-valent galactose derivative). In some embodiments, the galactose derivative cluster comprises four N-acetyl-galactosamines. As used herein, a galactose derivative trimer contains three galactose derivatives, each linked to a central branch point. As used herein, a galactose derivative tetramer contains four galactose derivatives, each linked to a central branch point. The galactose derivatives can be attached to the central branch point through the C-1 carbons of the saccharides. In some embodiments, the galactose derivatives are linked to the branch point via linkers or spacers. In some embodiments, the linker or spacer is a flexible hydrophilic spacer, such as a PEG group (see, for example, U.S. Patent No. 5,885,968; Biessen et al. J. Med. Chem. 1995 Vol. 39 p. 1538-1546). In some embodiments, the PEG spacer is a PEG3 spacer. The branch point can be any small molecule which permits attachment of three galactose derivatives and further permits attachment of the branch point to the RNAi agent. An example of branch point group is a di-ly sine or di-glutamate. Attachment of the branch point to the RNAi agent can occur through a linker or spacer. In some embodiments, the linker or spacer comprises a flexible hydrophilic spacer, such as, but not limited to, a PEG spacer. In some embodiments, the linker comprises a rigid linker, such as a cyclic group. In some embodiments, a galactose derivative comprises or consists of N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster is comprised of a galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.

Embodiments of the present disclosure include pharmaceutical compositions for delivering an FXII RNAi agent to a liver cell in vivo. Such pharmaceutical compositions can include, for example, an FXII RNAi agent conjugated to a galactose derivative cluster. In some embodiments, the galactose derivative cluster is comprised of a galactose derivative trimer, which can be, for example, an N-acetyl-galactosamine trimer, or galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer. Targeting groups include, but are not limited to, (PAZ), (NAG 13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s as defined in Table 7. Other targeting groups, including galactose cluster targeting ligands, are known in the art. In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent linkage of the agent to a targeting group or delivery polymer or delivery vehicle. The linking group can be linked to the 3' or the 5' end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group is linked to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5' or 3' end of an RNAi agent sense strand. In some embodiments, a linking group is conjugated to the 5' end of an RNAi agent sense strand. Examples of linking groups, can include, but are not limited to: reactive groups such a primary amines and alkynes, alkyl groups, abasic nucleotides, ribitol (abasic ribose), and/or PEG groups. A linker or linking group is a connection between two atoms that links one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting group or delivery polymer) or segment of interest via one or more covalent bonds. A labile linkage contains a labile bond. A linkage may optionally include a spacer that increases the distance between the two joined atoms. A spacer can further add flexibility and/or length to the linkage. Spacers can include, but are not be limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups; each of which can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art and the preceding list is not meant to limit the scope of the description.

Any of the FXII RNAi agent nucleotide sequences listed in Tables 2, 3, 4, or 6, whether modified or unmodified, may contain 3 Or 5' targeting groups or linking groups. Any of the FXII RNAi agent sequences listed in Tables 3 or 4 which contain a 3' or 5' targeting group or linking group, may alternatively contain no 3' or 5' targeting group or linking group, or may contain a different 3' or 5' targeting group or linking group including, but not limited to, those depicted in Table 7. Any of the FXII RNAi agent duplexes listed in Table 2, Table 5, or Table 6, whether modified or unmodified, may further comprise a targeting group or linking group, including, but not limited to, those depicted in Table 7, and the targeting group or linking group may be attached to the 3' or 5' terminus of either the sense strand or the antisense strand of the FXII RNAi agent duplex.

Examples of targeting groups and linking groups are provided in Table 7. Table 4 provides several embodiments of FXII RN Ai agent sense strands having a targeting group or linking group linked to the 5' or 3' end.

Table 7. Structures Representing Various Modified Nucleotides, Targeting Groups, and Linking Groups

When positioned internally on oligonucleotide: linkage towards 5' end of oligonucleotide

linkage towards 3' end of

oligonucleotide

(invAb)

100

In each of the above structures in Table 7, NAG comprises an N-acetyl-galactosamine or another asialoglycoprotein receptor ligand, as would be understood by a person of ordinary skill in the art to be attached in view of the structures above and description provided herein. For example, in some embodiments, NAG in the structures provided in Table 7 is represented by the following structure:

(N-acetyl-galactosamine) Each (NAGx) can be attached to an FXII RNAi agent via a phosphate group (as in (NAG25), (NAG30), and (NAG31)), or a phosphorothioate group, (as is (NAG25)s, (NAG29)s, (NAG30)s, (NAG31)s, or (NAG37)s), or another linking group.

O O

O S

Phosphate group Phosphorothioate group

Other linking groups known in the art may be used. In some embodiments, a delivery vehicle can be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves delivery of the RNAi agent to a cell or tissue. A delivery vehicle can include, or consist of, but is not limited to: a polymer, such as an amphipathic polymer, a membrane active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane active polyamine. In some embodiments, the RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs or other delivery systems available in the art. The RNAi agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, for example WO 2000/053722, WO 2008/0022309, WO 2011/104169, and WO 2012/083185, WO 2013/032829, WO 2013/158141, each of which is incorporated herein by reference), or other delivery systems available in the art.

Pharmaceutical Compositions and Formulations

The FXI I RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations. In some embodiments, pharmaceutical compositions include at least one FXII RNAi agent. These pharmaceutical compositions are particularly useful in the inhibition of the expression of the target mRNA in a target cell, a group of cells, a tissue, or an organism. The pharmaceutical compositions can be used to treat a subject having a disease or disorder that would benefit from reduction in the level of the target mRNA, or inhibition in expression of the target gene. The pharmaceutical compositions can be used to treat a subject at risk of developing a disease, disorder, or condition that would benefit from reduction of the level of the target mRNA or an inhibition in expression the target gene. In one embodiment, the method includes administering an FX 11 RNAi agent linked to a targeting ligand as described herein, to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and or delivery poly mers) are added to the pharmaceutical compositions including an FXII RNAi agent, thereby forming a pharmaceutical formulation suitable for in vivo delivery to a subject, including a human. The pharmaceutical compositions that include an FXI I RNAi agent and methods disclosed herein decrease the level of the target mRNA in a cell, group of cells, group of cells, tissue, or subject, including: administering to the subject a therapeutically effective amount of a herein described FX 11 RNAi agent, thereby inhibiting the expression of FXI I mR A in the subject.

In some embodi ments, the described pharmaceutical compositions including an FXII RNAi agent are used for treating or managing clinical presentations in a subject that would benefit from the inhibition of expression of a FXI I gene, such as include HAE. AAE. ACE inhibitor associated angioedema, allergic angioedema, INAE, idiopathic angioedema, thrombosis, VTE, thrombotic occlusive disease, and peri-operative venous occlusive disease prophylaxis. In some embodiments, a therapeutically or prophylactically effective amount of one or more of pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any of the disclosed FXII RNAi agents can be used to decrease the number, severity, and/or frequency of symptoms of a disease in a subject.

The described pharmaceutical compositions incl uding an FXI I R Ai agent can be used to treat at least one symptom in a subject having a disease or disorder that would benefit from reduction or inhibition in expression of FXI I mRNA. In some embodiments, the subject is administered a therapeutically effective amount of one or more pharmaceutical compositions including an FXI I RNAi agent thereby treating the symptom. In other embodiments, the subj ect is administered a prophylactically effective amount of one or more FXI I RNAi agents, thereby preventing the at least one symptom. The route of administration is the path by which an FXII RNAi agent is brought into contact with the body. In general, methods of administerin drugs and oligonucleotides and nucleic acids for treatment of a mammal are well known in the art and can be applied to administration of the compositions described herein. The FXI I RNAi agents disclosed herein can be administered via any suitable route in a preparation appropriately tailored to the particular route. Thus, herein described pharmaceutical compositions can be administered by injection, for example, intravenously, intramuscularly, intracutaneously. subcutaneously, intraarticularly, or intraperitoneally. In some embodiments, the herein described pharmaceutical compositions are administered via subcutaneous injection.

The pharmaceutical compositions includin an FXI I RNAi agent described herein can be delivered to a cell, group of cells, tissue, or subject using oligonucleotide delivery technologies know n in the art. In general, any suitable method recognized in the art for delivering a nucleic acid molecule ( in vitro or in vivo) can be adapted for use with the compositions described herein. For example, deli ery can be by local administration, (e.g. , direct injection, implantation, or topical administering), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal ), intramuscular, transdermal, airway (aerosol ), nasal, oral, rectal, or topical ( including buccal and sublingual) administration. In certain embodiments, the compositions are administered by subcutaneous or intravenous infusion or injection.

Accordingly, in some embodi ments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. Hie pharmaceutical compositions described herein are formulated for administration to a subject.

As used herein, a pharmaceutical composition or medicament includes a pharmacologically effective amount of at least one of the described FXII RNAi agents and one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients (excipients) are substances other than the Active Pharmaceutical Ingredient (API, therapeutic product, e.g., FXII RNAi agent) that are intentionally included in the drug delivery system. Excipients do not exert or are not intended to exert a therapeutic effect at the intended dosage. Excipients can act to a) aid in processing of the drug delivery system during manufacture, b) protect, support, or enhance stability, bioavailability or patient acceptability of the API, c) assist in product identification, and/or d) enhance any other attribute of the overall safety, effectiveness, of delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.

Excipients include, but are not limited to: absorption enhancers, anti-adherents, anti- foaming agents, anti-oxidants, binders, buffering agents, carriers, coating agents, colors, delivery enhancers, delivery polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavors, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickening agents, tonicity agents, vehicles, water-repelling agents, and wetting agents. Pharmaceutical compositions suitable for inj ectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation include vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

Formulations suitable for intra-articular administration can be in the form of a sterile aqueous preparation of the drug that can be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems can also be used to present the drug for both intra-articular and ophthalmic administration.

The active compounds can be prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,81 1.

The FXII RNAi agents can be formulated in compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the disclosure are dictated by and directly dependent on the unique characteristics of the active compound and the therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals. A pharmaceutical composition can contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to: anti-pruritics, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamine, diphenhydramine, etc.). It is also envisioned that cells, tissues, or isolated organs that express or comprise the herein defined RNAi agents may be used as "pharmaceutical compositions." As used herein, "pharmacologically effective amount," "therapeutically effective amount," or simply "effective amount" refers to that amount of an RNAi agent to produce a pharmacological, therapeutic or preventive result. In some embodiments, the methods disclosed herein further comprise the step of administering a second therapeutic or treatment in addition to administerin an RNAi agent disclosed herein. In some embodiments, the second therapeutic is another FX 11 RNAi agent ( e.g.. an FX 11 RNAi agent which targets a di fferent sequence within the FX 11 target). In other embodiments, the second therapeutic can be a small molecule drug, an antibody, an antibody fragment, an aptamer, and or a vaccine.

Generally, an effective amount of an active compound will be in the range of from about 0.1 to about 100 mg/kg of body weight/day, e.g., from about 1.0 to about 50 mg/kg of body weight/day. In some embodiments, an effective amount of an active compound will be in the range of from about 0.25 to about 5 mg/kg of body weight per dose. In some embodiments, an effective amount of an active ingredient will be in the range of from about 0.5 to about 4 mg/kg of body weight per dose. The amount administered will also likely depend on such variables as the overall health status of the patient, the relative biological efficacy of the compound delivered, the formulation of the drug, the presence and types of excipients in the formulation, and the route of administration. Also, it is to be understood that the initial dosage administered can, in some instances, be increased beyond the above upper level to rapidly achieve the desired blood-level or tissue level, or the initial dosage can, in some instances, be smaller than the optimum. For treatment of disease or for formation of a medicament or composition for treatment of a disease, the pharmaceutical compositions described herein including an FXII RNAi agent can be combined with an excipient or with a second therapeutic agent or treatment including, but not limited to: a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, peptide and/or aptamer.

The described FXI I RNAi agents, when added to pharmaceutically acceptable excipients or adjuvants, can be packaged into kits, containers, packs, or dispensers. The pharmaceutical compositions described herein can be packaged in pre-filled syringes or vials.

Methods of Treatment and Inhibition of Expression

The FXI I RNAi agents disclosed herein can be used to treat a subject (e.g., a human or other mammal) having a disease or disorder that would benefit from administration of the compound. In some embodiments, the R Ai agents disclosed herein can be used to treat a subject (e.g., a human ) that would benefit from a reduction and/or inhibition of FXII gene expression, for example, a subject that has been diagnosed with or is at risk of developing symptoms related to hereditary angioedema (HAE), acquired angioedema (AAE), ACE inhibitor associated angioedema, allergic angioedema, nonhistaminergic angioedema (ΓΝΑΕ), idiopathic angioedema, thrombosis, venous thromboembolism (VTE), thrombotic occlusive disease, and/or peri-operative venous occlusive disease prophylaxis. Treatment of a subject may include therapeutic and/or prophylactic treatment. The subject is administered a therapeutically effective amount of any one or more of the FXII RNAi agents described herein. The subject can be a human, patient, or human patient. The subject may be an adult, adolescent, child, or infant. Administration of a pharmaceutical composition described herein can be to a human being or animal.

In some embodiments, the FXI I RNAi agents described herein are used to treat a subject that would benefit from a reduction and/or inhibition of FXII gene expression. In some embodiments, the described FXII RNAi agents are used to treat (including prophyiactically) at least one symptom or pathological mediated at least in part by FXII expression. The subject is administered a therapeutically effective amount of any one or more of the described RNAi agents. In some embodiments, the subject is administered a prophyiactically effective amount of any one or more of the described RNAi agents, thereby preventing the at least one symptom.

I l l In certain embodiments, the present invention provides methods for treatment of diseases, disorders, conditions, or pathological states mediated at least in part by FXII expression, in a patient in need thereof, wherein the methods include administering to the patient any of the FXII RNAi agents described herein.

In some embodiments, the FXII RNAi agents are used to treat or manage a pathological state (such as a condition or disease) of a subject, for which the pathological state is mediated at least in part by FXI I expression. The subject is administered a therapeutically effective amount of one or more of the FXI I R Ai agents or FXI I RNAi agent-containing compositions described herein. In some embodiments, the method comprises administering a composition comprising an FXII RNAi agent described herein to a subject to be treated.

In some embodiments, the gene expression level and/or mRNA level of an FXII gene in a subject to whom a described FXII RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the FXII RNAi agent or to a subject not receiving the FXII RNAi agent. The gene expression level and/or mRNA level in the subject is reduced in a cell, group of cells, and/or tissue of the subject.

In some embodiments, the protein level of FXII in a subject to whom a described FXII RNAi agent has been administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the FXII RNAi agent or to a subject not receiving the FXII RNAi agent. The protein level in the subject is reduced in a cell, group of cells, tissue, blood, and/or other fluid of the subject.

A reduction in FXII gene expression, FXII mRNA, or FXII protein levels can be assessed and quantified by general methods known in the art. The Examples disclosed herein set forth generally known methods for assessing inhibition of FXII gene expression and reduction in FXII protein levels. The reduction or decrease in FXII mRNA level and/or protein level are collectively referred to herein as a reduction or decrease in FXII or inhibiting or reducing the expression of FXII. Cells, Tissues, and non-Human Organisms

Cells, tissues, and non-human organisms that include at least one of the FXII RNAi agents described herein is contemplated. The cell, tissue, or non-human organism is made by delivering the RNAi agent to the cell, tissue, or non-human organism.

The above provided embodiments and items are now illustrated with the following, non- limiting examples. EXAMPLES

Example 1. Identification of FXII RNAi Agent Sequences and Synthesis of FXII RNAi Agents

A selection process for identifying lead sequences targeting FXII began with in silico methods to identify conserved sequences across variants of the FXII gene (SEQ ID NO: 1). The FXII sequence was initially screened using bioinformatics for 19-nucleotide sequences having a complementary sequence cross-reactive with human and non-human primate. Sequences known to have manufacturing challenges and those predicted to have poor RNAi activity based on known parameters were eliminated. The sequences were also evaluated for specificity to avoid off-target effects against the human and cynomolgus monkey genomes. Seventeen (17) sequence families of 19-mers were initially selected as potential candidates. An additional sequence was identified by changing the nucleotide at antisense strand position 1 (5' - 3') and the corresponding base pair on the sense strand to form a U:A base pair. Modification patterns were selected and modified RNAi agent sense strands and antisense strands were synthesized according to phosphoramidite technology on solid phase using methods known in the art for oligonucleotide synthesis. The duplexes in Table 5 and Table 6 herein, for example, were synthesized in accordance with the following:

Synthesis

The sense and antisense strands of the FXII RNAi agents were synthesized according to phosphoramidite technology on solid phase used in oligonucleotide synthesis. Depending on the scale, a MerMade96E® (Bioautomation), a MerMadel2® (Bioautomation), or a comparable commercially-available synthesizer was used. Syntheses were performed on a solid support made of controlled pore glass (CPG, 500 A or 600 A, obtained from Prime Synthesis, Aston, PA, USA). All RNA and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the following 2'-0-methyl phosphoramidites were used: (5'-0-dimethoxytrityl-N6-(benzoyl)- 2'-0-methyl-adenosine-3'-0-(2-cyanoethyl-N,N-diisopropylamin o) phosphoramidite, (5'- 0-dimethoxytrityl-N4-(acetyl)-2'-0-methyl-cytidine-3'-0-(2-c yanoethyl-N,N- diisopropylamino) phosphoramidite, (5'-0-dimethoxytrityl-N2-(isobut ryl)-2'-0-methyl- guanosine-3'-0-(2-cyanoethyl-N,N-diisopropylandno)phosphoram idite, and (5'-0- dimethoxytrityl-2'-0-methyl-uridine-3'-0-(2-cyanoethyl-N,N- diisopropylamino)phosphoramidite. The 2'-deoxy-2'-fluoro-phosphoramidites carried the same protecting groups as the 2'-0-methyl RNA amidites. The following UNA phosphoramidites were used: 5'-(4,4'-Dimethoxytrityl)-N6-(benzoyl)-2',3'-seco-adenosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphorami dite,

5'-(4,4'-Dimethoxytrityl)-N-acetyl-2',3'-seco-cytosine, 2'-benzoyl-3'-[(2-cyanoethyl)- (N,N-diiso-propyl)]-phosphoramidite, 5'-(4,4'-Dimethoxytrityl)-N-isobutyryl-2',3'-seco- guanosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(K,N-diisopropyl)]-phosphorami dite, and 5'- (4,4'-Dimethoxy-trityl)-2',3'-seco-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N- diiso- propyl)] -phosphoramidite.

Targeting ligand-containing phosphoramidites were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidites were dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3A) were added. 5-Benzylthio- lH-tetrazole (BTT, 250 mM in acetonitrile) or 5-Ethylthio-lH-tetrazole (ETT, 250 mM in acetonitrile) was used as activator solution. Coupling times were 10 min (RNA), 15 min (targeting ligand), 90 sec (2'OMe), and 60 sec (2'F). In order to introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl l,2,4-dithiazoline-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was employed.

Cleavage and Deprotection of Support Bound Oligomers.

After finalization of the solid phase synthesis, the dried solid support was treated with a 1 : 1 volume solution of 40 wt. % methylamine in water and 28% to 31% ammonium hydroxide solution (Aldrich) for 1.5 hours at 30°C. The solution was evaporated and the solid residue was reconstituted in water (see below). Purification

Crude oligomers were purified by anionic exchange HPLC using a TKSgel SuperQ-5PW 13u column and Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0 and contained 20% Acetonitrile and buffer B was the same as buffer A with the addition of 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled then run on size exclusion HPLC using a GE Healthcare XK 16/40 column packed with Sephadex G-25 medium with a running buffer of lOOmM ammonium bicarbonate, pH 6.7 and 20% Acetonitrile or filtered water. Annealing

Complementary strands were mixed by combining equimolar RNA solutions (sense and antisense) in l x PBS (Phosphate-Buffered Saline, l x, Corning, Cellgro) to form the RNAi agents. Some RNAi agents were lyophilized and stored at -15 to -25°C. Duplex concentration was determined by measuring the solution absorbance on a UV-Vis spectrometer in l x PBS. The solution absorbance at 260 nm was then multiplied by a conversion factor and the dilution factor to determine the duplex concentration. Unless otherwise stated, all conversion factor was 0.037 mg/(mL-cm). For some experiments, a conversion factor was calculated from an experimentally determined extinction coefficient. Example 2. In vitro Testing of RNAi Agent Candidates

To test modified FXII RNAi agent constructs in vitro, the human FXII cDNA sequence (accession # NM_000505.3 (SEQ ID NO: 1)) was synthesized and cloned into a commercially-available reporter-based screening plasmid, psiCHECK2 (Promega, Madison, WI), which generated a Renilla luciferase/FXII fusion mRNA. For siRNA efficacy in the human background, Huh7 cells, a human hepatocyte-derived carcinoma cell line, were plated at -7,500 cells per well in 96-well format. Each of the FXII siRNAs selected for in vitro study was co-transfected at three concentrations, 10 nM, 1 nM, and 0.1 nM, with 25 ng FXII-psiCHECK2 plasmid DNA per well and 0.2 μΐ. LipoFectamine 2000 per well. Gene knockdown was determined by measuring Renilla luciferase levels normalized to the levels of constitutively-expressed firefly luciferase, also present on the psiCHECK2 plasmid, using the Dual Luciferase Reporter Assay (Promega, Madison, WI). Candidate sequence duplexes set forth in Table 6 were tested in vitro. Data are reported in the following Table 8. Table 8: Results of FXII RNAi Agents in Human Background, as Determined by Dual-Luciferase Reporter Assay.

Average Relative Rluc-FXII Expression

Duplex ID No: 10 nM St. Dev. (+/-) 1 nM St. Dev. (+/-) 0.1 nM St. Dev. (+/-)

91 2 0.078 0.000 0.113 0.010 0.595 0.036

91 3 0.079 0.004 0.132 0.005 0.655 0.003

91 4 0.074 0.003 0.157 0.006 0.675 0.043

91 5 0.069 0.003 0.135 0.017 0.593 0.023

91 6 0.068 0.002 0.136 0.004 0.660 0.023

91 7 0.109 0.004 0.179 0.012 0.756 0.058

91 8 0.081 0.009 0.166 0.009 0.805 0.039

91 9 0.082 0.003 0.184 0.010 0.748 0.031

91 10 0.090 0.005 0.124 0.010 0.706 0.016

125 2 0.155 0.005 0.515 0.050 1.044 0.025

125 3 0.154 0.010 0.378 0.020 0.897 0.069

125 4 0.153 0.018 0.298 0.007 0.844 0.047

125 5 0.212 0.007 0.616 0.050 1.074 0.076

126 2 0.123 0.010 0.192 0.005 0.940 0.089

126 3 0.114 0.017 0.194 0.049 0.853 0.018

126 4 0.124 0.016 0.167 0.011 0.819 0.049

126 5 0.128 0.013 0.213 0.027 0.868 0.050

126 6 0.133 0.008 0.177 0.011 0.858 0.028

126 7 0.202 0.012 0.286 0.020 0.869 0.054

127 2 0.110 0.003 0.167 0.008 0.828 0.045

127 3 0.120 0.001 0.161 0.004 0.687 0.042

127 4 0.102 0.008 0.136 0.005 0.804 0.062

127 5 0.146 0.019 0.182 0.018 0.900 0.160

127 6 0.135 0.024 0.128 0.007 0.824 0.045

132 2 0.322 0.025 0.397 0.003 0.977 0.167

132 3 0.156 0.015 0.211 0.017 1.001 0.148

223 2 0.232 0.008 0.374 0.061 1.013 0.115

849 2 0.561 0.046 0.697 0.030 1.151 0.049

849 3 0.583 0.032 0.632 0.120 1.133 0.252

1 139 2 0.290 0.043 0.377 0.007 1.11 1 0.247

1 139 3 0.339 0.007 0.397 0.073 1.159 0.204

1 139 4 0.270 0.031 0.370 0.029 1.086 0.108

1 139 5 0.259 0.015 0.365 0.041 1.122 0.077

1476 2 0.433 0.028 0.716 0.030 1.186 0.032

1476 3 0.430 0.001 0.732 0.092 1.004 0.020

1476 4 0.672 0.022 0.841 0.061 1.128 0.171

1476 5 0.636 0.102 0.794 0.041 1.119 0.110

1476 6 0.661 0.081 0.801 0.050 1.312 0.237

Example 3. FXII Knockdown In Wild Type Mice Following FXII RNAi Agent Delivery NAG-conjugated FXII RNAi agents were made and combined in a pharmaceutically acceptable buffer as described above for subcutaneous (SQ) injection. On day 1, three mice in each group (n=3) were injected with either saline or 3 mg/kg AD03632 {see Tables 3-5 and 7 for the modified FXII RNAi agent and NAG ligand structure). Blood samples were drawn and analyzed for FXII protein levels at days 8, 15, 22, 29 and 36. FXII protein levels were measured using an internally developed mF12 alphaLISA® (Perkin Elmer) that utilized antibodies commercially acquired (Molecular Innovations), which allowed for increased throughput; alternatively, commercially available mF12 ELISA kits may be used. For normalization, FXII levels for each animal at a respective time point was divided by the pre-treatment level of expression in that animal (in this case at day 1) to determine the ratio of expression "normalized" to day 1. Knockdown of FXII is reported in FIG. 1.

Example 4. Factor 12 (FXII) In Wild Type Mice Following FXII RNAi Agent Delivery NAG-conjugated FXII RNAi agents were made and combined in a pharmaceutically acceptable buffer as described above for subcutaneous (SQ) injection. On day 1, four mice in each group were injected with either (i) 0.6 mg/kg AD03632; (ii) 2 mg/kg AD03632; or (iii) saline, {see Tables 3-5 and 7 for the modified FXII RNAi agents and NAG ligand structures). Blood samples were drawn and analyzed for FXII protein levels at days 7, 14, 21, 28, 35, 42, 49, 56, and 63. FXII protein levels were measured using an internally developed mF12 alphaLISA® (Perkin Elmer) that utilized antibodies commercially acquired (Molecular Innovations), which allowed for increased throughput; alternatively, commercially available mF12 ELISA kits may be used. For normalization, FXII levels for each animal at a respective time point was divided by the pre-treatment level of expression in that animal (in this case at day 1) to determine the ratio of expression "normalized" to day 1. Knockdown of FXII is reported in FIG. 2.

Example 5. Factor 12 (FXII) Dose Response In Mice Following FXII RNAi Agent Delivery

NAG-conjugated FXII RNAi agents were made and combined in a pharmaceutically acceptable buffer as described above for subcutaneous (SQ) injection. On day 1, six mice in each group were injected with either (i) 0.6 mg/kg AD03632; (ii) 2 mg/kg AD03632; or (iii) saline, {see Tables 3-5 and 7 for the modified FXII RNAi agent and NAG ligand structure). The mice were again injected once each week over the next six weeks with the same dose of either AD03632 or saline that was administered on day 1. Blood samples were drawn and analyzed for FXII protein levels the day prior to the next injection (i.e., blood samples drawn on days 7, 14, 21, 28, 35, 42, 49, 56, and 63). FXII protein levels were measured using an internally developed mF12 alphaLISA® (Perkin Elmer) that utilized antibodies commercially acquired (Molecular Innovations), which allowed for incrased throughput; alternatively, commercially available mF12 ELISA kits may be used. For normalization, FXII levels for each animal at a respective time point was divided by the pre-treatment level of expression in that animal (in this case at day 1) to determine the ratio of expression "normalized" to day 1. Knockdown of FXII is reported in FIG. 3.

Example 6. Factor 12 (FXII) Serum Protein levels and Clot Weigh In Arterio-Venus Shunt Model In Rat Following FXII RNAi Agent Delivery

NAG-conjugated FXII RNAi agents were made and combined in a pharmaceutically acceptable buffer as described above for subcutaneous (SQ) injection. On day 1, five rats in each group were injected with either (i) saline; (ii) saline on day 1, followed by 1000 U/kg heparin at cannulation on day 7, 8, or 9; (iii) 1 mg/kg FXII RNAi agent AD03224; or (iv) 3 mg/kg FXII RNAi agent AD03224. {see Tables 3-5 and 7 for the modified FXII RNAi agent and NAG ligand structure). Blood samples were drawn on the day of procedure (i.e., day 7, 8, or 9). For normalization, FXII levels for each animal at a respective time point was divided by the pre-treatment serum level in that animal (in this case at day 1) to determine the ratio of expression "normalized" to day 1. FXII serum protein levels are reported in FIG. 4. FXII protein levels were measured using an internally developed mF12 alphaLISA® (Perkin Elmer) that utilized antibodies commercially acquired (Molecular Innovations), which allowed for increased throughput; alternatively, commercially available mF12 ELISA kits may be used.

Additionally, an arterio-venous shunt model was conducted on these mice to measure. On day the day of the shunt experiment (i.e., day 7, 8, or 9), a polyurethane tubing (with silk thread) was implanted to connect the carotid artery to the jugular vein (cannulated). After 15 minutes, the shunt was removed and net thrombus weight was measured. Clot weight (in mg) is reported in FIG. 5. Example 7. Administration of N AG-conjugated FXII RNAi Agents In Cynomolgus Monkeys

NAG-conjugated FXII RNAi agents were made and combined in a pharmaceutically acceptable saline buffer as known in the art for subcutaneous (SC) injection. On day 1, cynomolgus macaque (Macaca fascicularis) primates (referred to herein as "cynos" or "monkeys") were injected subcutaneously with 3 mg/kg of AD03635, AD04131, AD04157, AD04162, AD04254, or AD04443. {see Tables 3-5 and 7 for the modified FXII RNAi agents and NAG ligand structures). Three monkeys in each group were tested (n=3) for groups AD03635, AD04131, AD04157, AD04162, AD04254. Only two monkeys were tested (n=2) for group AD04443. On day 29, two (2) of the monkeys in each respective group were administered a subsequent dose of 1.5 mg/kg of the same respective FXII RNAi agent that was administered on day 1.

Serum samples from treated cynomolgus monkeys were collected on day -29, day -7, and day 1 (pre-treatment), and on days 8, 15, 22, 29, 36, 43, 50, 57, 64, and 78. At the indicated time points, blood samples were drawn and serum was analyzed for FXII protein levels. FXII protein levels were determined using a commercially purchased ELISA for human F12 (Molecular Innovations) according to the manufacturer's recommendations. Standard clinical chemistry, including blood urea nitrogen (BUN), alanine transaminase (ALT), aspartate aminotransferase (AST), and creatinine were also assessed on an automated chemistry analyzer according to the manufacturer's recommendations. Activated Partial Thromboplastin Time (aPTT) was also determined using STA Compact MAX® (Stago). Functional readout of F12 knockdown can be observed through elongation of the activated partial thromboplastin time (aPTT) compared to pre-treatment. The samples were also assessed for FXII activity by using an FXII activity assay. The FXII activity assay was performed using the aPTT method (standard techniques known in the art) and a factor deficient substrate. Subject plasma was combined and incubated with a FXII deficient substrate (normal plasma depleted of FXII by immunoadsorption) and an aPTT reagent. After a specified incubation time, calcium was added to trigger the coagulation process and clot formation was measured. Results are then compared to normal human results (100%) and a percent activity is calculated.

FXII protein levels for each animal at a respective time point was divided by the pre- treatment level (average of day -29, day -7 and day 1 (pre-treatment)) of expression in that animal to determine the ratio of expression "normalized to pre-treatment." Additionally, mean knockdown levels at the respective nadir (i.e., the mean lowest expression level of the days in which serum was collected) for both FXII protein and FXII activity were calculated.

Table 9. Normalized FXII Protein from ELISA (Normalized to Pre-Treatment) in Example 7.

Table 10. Mean FXII Protein Knockdown Percentages at Nadir from Example 7.

Group 3 (AD04157) 82% 88%

Group 4 (AD04162) 90% 93.5%

Group 5 (AD04254) 87% 90%

Group 6 (AD04443) 88% 93.5%

Table 11. Mean FXII Activity Percentages (Normalized to Pre-Treatment) from Example 7.

Group ID Mean FXII Activity Mean FXII Activity knockdown at nadir (lowest knockdown at nadir measured timepoint) after (lowest measured first dose timepoint) after second dose

Group 1 (AD03635) 67.6% 80.5%

Group 2, (AD04131) 65.7% 76%

Group 3 (AD04157) 73.3% 83%

Group 4 (AD04162) 85% 89%

Group 5 (AD04254) 76.3% 84%

Group 6 (AD04443) 80% 88%

Table 12. Normalized aPTT (seconds) (Normalized to Pre-Treatment) from Example 7.

Group ID Mean aPTT at apex (highest Mean aPTT at apex measured timepoint) after (highest measured first dose timepoint) after second dose

Group 1 (AD03635) 1.27 1.76

Group 2, (AD04131) 1.27 1.52

Group 3 (AD04157) 1.39 1.73

Group 4 (AD04162) 1.44 1.73

Group 5 (AD04254) 1.34 1.56

Group 6 (AD04443) 1.59 1.92

Each of the FXII RNAi agents tested in Example 7 showed substantial knockdown of FXII in cynos. Additionally, administration of a second dose of FXII RNAi agents showed further improvement in knockdown of FXII protein and FXII activity, as well as elongation of aPTT in cynos. For example, AD04162, which includes an antisense strand having a sequence at least partially complementary to positions 127-145 of the FXII gene (SEQ ID NO: 1) exhibited 93.5% inhibition of FXII protein expression at nadir after a second dose.

Example 8. Administration of NAG-conjugated FXII RNAi agents in Cynomolgus Monkeys

NAG-conjugated FXII RNAi agents were made and combined in a pharmaceutically acceptable saline buffer as known in the art for subcutaneous (SC) injection. On day 1, cynomolgus macaque (Macaca fascicularis) primates (referred to herein as "cynos" or "monkeys") were injected subcutaneously with 3 mg/kg of AD04623, AD04624, AD04625, AD04626, AD04627, or AD04628. {see Tables 3-5 and 7 for the modified FXII RNAi agents and NAG ligand structures). Two monkeys in each group were tested (n=2), one male and one female in each group. On day 24, a single 3 mg/kg SC injection of the same respective FXII RNAi agent that was administered to the respective animal on day 1 was administered to each cyno (i.e., a second dose).

Serum samples from treated cynomolgus monkeys were collected on day -6, and day 1 (pre- treatment), and on days 8, 15, 24, 29, 36 and 43. At the indicated time points, blood samples were drawn and serum was analyzed for FXII protein levels. FXII protein levels were determined using a commercially purchased ELIS A for human F 12 (Molecular Innovations) according to the manufacturer's recommendations. Standard clinical chemistry, including blood urea nitrogen (BUN), alanine transaminase (ALT), aspartate aminotransferase (AST), and creatinine were also assessed on an automated chemistry analyzer according to the manufacturer's recommendations. The samples were also assessed for FXII activity by using an FXII activity assay. The FXII activity assay was performed using the aPTT method (standard techniques known in the art) and a factor deficient substrate. Subject plasma was combined and incubated with a FXII deficient substrate (normal plasma depleted of FXII by immunoadsorption) and an aPTT reagent. After a specified incubation time, calcium was added to trigger the coagulation process and clot formation was measured. Results are then compared to normal human results (100%) and a percent activity is calculated.

FXII protein levels for each animal at a respective time point was divided by the pre- treatment level (average of day -6 and day 1 (pre-treatment)) of expression in that animal to determine the ratio of expression "normalized to pre-treatment." Additionally, mean knockdown levels at the respective nadir (i.e., the mean lowest expression level of the days in which serum was collected) for both FXII protein and FXII activity were calculated.

Table 13. Normalized FXII Protein from ELISA (Normalized to Pre-Treatment) in Example 8.

Table 14. Average Normalized FXII Protein (Normalized to Pre-Treatment) from Example 8.

Day 8 Day 15 Day 24 Day 29 Day 36

Group ID Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev

FXII (+/-) FXII (+/-) FXII (+/-) FXII (+/-) FXII (+/-)

Group 1 (3.0 mg/kg AD04623) 0.378 0.004 0.210 0.025 0.166 0.043 0.133 0.049 0.090 0.029

Group 2 (3.0 mg/kg AD04624) 0.626 0.033 0.489 0.052 0.513 0.162 0.411 0.124 0.330 0.073

Group 3 (3.0 mg/kg AD04625) 0.348 0.024 0.165 0.014 0.125 0.004 0.090 0.007 0.070 0.003

Group 4 (3.0 mg/kg AD04626) 0.726 0.068 0.606 0.052 0.752 0.031 0.584 0.040 0.579 0.060

Group 5 (3.0 mg/kg AD04627) 0.492 0.077 0.389 0.011 0.320 0.037 0.285 0.054 0.188 0.036

Group 6 (3.0 mg/kg AD04628) 0.757 0.070 0.785 0.040 0.797 0.069 0.770 0.021 0.676 0.025

Table 15. Normalized FXII Activity (Normalized to Pre-Treatment) from Example 8.

Each of the FXII RNAi agents administered in Example 8 showed substantial inhibition of FXII expression in cynos. For example, AD04625, which includes an antisense strand designed to target positions 127-145 of the FXII gene (SEQ ID NO: 1), showed mean normalized knockdown of 91.0% of FXII protein on Day 29 (0.090 +/- 0.007) (See Table 14, group 3).

Example 9. Administration of NAG-conjugated FXII RNAi agents in Cynomolgus Monkeys

NAG-conjugated FXII RNAi agents were mad and combined in a pharmaceutically acceptable saline buffer as known in the art for subcutaneous (SC) injection. On day 1, cynomolgus macaque (Macaca fascicularis) primates (referred to herein as "cynos" or "monkeys") were injected subcutaneously with 4.0 mg/kg of AD04623, AD04625, AD04753, or AD04757. (see Tables 3-5 and 7 for the modified FXII RNAi agents and NAG ligand structures). A second subcutaneous injection of 4.0 mg/kg of the same FXII RNAi agent was administered on day 29. Two female monkeys in each group were tested (n=2).

Serum samples from treated cynomolgus monkeys were collected on day -14, day -7, and day 1 (pre-treatment), and on days 8, 15, 22, 29, 30, 36 and 43. At the indicated time points, blood samples were drawn and serum was analyzed for FXII protein levels. FXII protein levels were determined using a commercially purchased ELISA for human F12 (Molecular Innovations) according to the manufacturer's recommendations. Standard clinical chemistry, including blood urea nitrogen (BUN), alanine transaminase (ALT), aspartate aminotransferase (AST), and creatinine were also assessed on an automated chemistry analyzer according to the manufacturer's recommendations. Activated Partial Thromboplastin Time (aPTT) was also determined using STA®-PTT Automate 5 (Stago). Functional readout of F12 knockdown can be observed through elongation of the activated partial thromboplastin time (aPTT) compared to pre-treatment. The samples were also assessed for FXII activity by using an FXII activity assay. The FXII activity assay was performed using the aPTT method (standard techniques known in the art) and a factor deficient substrate. Subject plasma was combined and incubated with a FXII deficient substrate (normal plasma depleted of FXII by immunoadsorption) and an aPTT reagent. After a specified incubation time, calcium was added to trigger the coagulation process and clot formation was measured. Results are then compared to normal human results (100%) and a percent activity is calculated.

FXII protein levels for each animal at a respective time point was divided by the pre- treatment level (average of day -6 and day 1 (pre-treatment)) of expression in that animal to determine the ratio of expression "normalized to pre-treatment." Additionally, mean knockdown levels at the respective nadir (i.e., the mean lowest expression level of the days in which serum was collected) for both FXII protein and FXII activity were calculated.

Table 16. Normalized FXII Protein from ELISA (Normalized to Pre-Treatment) in Example 9.

Table 17. Average Normalized FXII Protein (Normalized to Pre-Treatment) from Example 9

Group 1 (4.0 mg/kg AD04625) 0.086 0.023 0.070 0.010 0.054 0.006 0.054 0.007

Group 2 (4.0 mg/kg AD04623) 0.184 0.040 0.153 0.074 0.121 0.053 0.124 0.051

Group 3 (4.0 mg/kg AD04753) 0.132 0.033 0.126 0.025 0.106 0.009 0.092 0.005

Group 4 (4.0 mg/kg AD04757) 0.164 0.029 0.146 0.001 0.121 0.019 0.094 0.007

Table 18. Mean Normalized FXII Activity from Example 9 at Nadir.

Table 19. Normalized aPTT (seconds) (Normalized to Pre-Treatment) from Example 7.

In Example 9, each of the FXII RNAi agents showed substantial knockdown of the FXII gene. For example, AD04625 showed the greatest knockdown of the RNAi agents administered both after the first dose and after the second dose in FXII protein (91% knockdown after the first dose; 94.5% knockdown after the second dose). AD04625 also showed the greatest knockdown in FXII activity, and showed the most elongation of aPTT over baseline (2.02 over baseline after first dose; 2.435 over baseline at apex after second dose).

Example 10. Factor 12 (FXII)-SEAP Mouse Model

Six to eight week old female C57BL/6 albino mice were transiently transfected in vivo with plasmid by hydrodynamic tail vein injection, administered at least 15 days prior to administration of an FXII RNAi agent or control. The plasmid contains the human FXII cDNA sequence (GenBank GenBank NM_000505.3 (SEQ ID NO: l)) inserted into the 3' UTR of the SEAP (secreted human placental alkaline phosphatase) reporter gene. 50 μg of the plasmid containing the FXII cDNA sequence in Ringer's Solution in a total volume of 10% of the animal's body weight was injected into mice via the tail vein to create FXII- SEAP model mice. The solution was injected through a 27-gauge needle in 5-7 seconds as previously described (Zhang G et al, "High levels of foreign gene expression in hepatocytes after tail vein injection of naked plasmid DNA." Human Gene Therapy 1999 Vol. 10, pl735-1737.). Inhibition of expression of FXII by an FXII RNAi agent results in concomitant inhibition of SEAP expression, which is measured by the Phospha-Light™ SEAP Reporter Gene Assay System (Invitrogen). Prior to treatment, SEAP expression levels in serum were measured and the mice were grouped according to average SEAP levels.

Analyses: SEAP levels may be measured at various times, both before and after administration of FXII RNAi agents. i) Serum collection: Mice were anesthetized with 2-3% isoflurane and blood samples were collected from the submandibular area into serum separation tubes (Sarstedt AG & Co., Niimbrecht, Germany). Blood was allowed to coagulate at ambient temperature for 20 min. The tubes were centrifuged at 8,000 xg for 3 min to separate the serum and stored at 4°C. ii) Serum SEAP levels: Serum was collected and measured by the Phospha-Light™ SEAP Reporter Gene Assay System (Invitrogen) according to the manufacturer's instructions. Serum SEAP levels for each animal was normalized to the control group of mice injected with saline in order to account for the non-treatment related decline in FXII expression with this model. First, the SEAP level for each animal at a time point was divided by the pre-treatment level of expression in that animal ("pre-treatment") in order to determine the ratio of expression "normalized to pre-treatment". Expression at a specific time point was then normalized to the control group by dividing the "normalized to pre- treatment" ratio for an individual animal by the average "normalized to pre-treatment" ratio of all mice in the normal saline control group. Example 11. FXII RNAi Agents in the FXII-SEAP Mouse Model

The FXII-SEAP mouse model described in Example 10, above, was used. At day 1, each mouse was given a single subcutaneous injection of 200 μΐ of saline without an FXII RNAi agent to be used as a control, or 200 μΐ containing the amount FXII RNAi agent according to the following Table 20.

Table 20. Dosing groups of FXII-SEAP mice of Example 11.

1 1 1.0 mg/kg AD04745 Single injection on day 1

Each of the FXII RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5'-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on day -3, day 8, day 15, day 22, and day 29, and SEAP expression levels were determined pursuant to the procedure set forth in Example 10, above. Data from the experiment are shown in the following Table 21 , with Average SEAP reflecting the normalized average value of SEAP:

Table 21. Average SEAP normalized to pre-treatment and saline control in FXII-SEAP mice from Example 11.

Day 8 Day 15 Day 22 Day 29

Group ID Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev

SEAP (+/-) SEAP (+/-) SEAP (+/-) SEAP (+/-)

Group 1 (Saline) 1.000 0.361 1.000 0.469 1.000 0.146 1.000 0.158

Group 2 (0.5 mg/kg AD04623) 0.440 0.147 0.584 0.289 0.680 0.423 0.681 0.487

Group 3 (1.0 mg/kg AD04623) 0.333 0.186 0.315 0.096 0.432 0.152 0.700 0.496

Group 4 (0.5 mg/kg AD04625) 0.312 0.070 0.249 0.112 0.408 0.317 0.648 0.533

Group 5 (1.0 mg/kg AD04625) 0.138 0.074 0.080 0.049 0.089 0.040 0.118 0.065

Group 6 (1.0 mg/kg AD04748) 0.255 0.107 0.337 0.239 0.378 0.337 0.461 0.390

Group 7 (1.0 mg/kg AD04749) 0.106 0.039 0.038 0.013 0.055 0.024 0.087 0.041

Group 8 (1.0 mg/kg AD04750) 0.310 0.050 0.290 0.104 0.577 0.293 0.648 0.310

Group 9 (1.0 mg/kg AD04754) 0.271 0.038 0.230 0.101 0.395 0.125 0.402 0.023

Group 10 (1.0 mg/kg AD04744) 0.345 0.214 0.303 0.200 0.492 0.421 0.674 0.502

Group 11 (1.0 mg/kg AD04745) 0.328 0.244 0.268 0.078 0.480 0.149 0.598 0.180

Each of the FXII RNAi agents tested in Example 11 showed substantial inhibition of expression of FXII in the SEAP mouse model compared to control. Example 12. FXII RNAi Agents in the FXII-SEAP Mouse Model

The FXII-SEAP mouse model described in Example 10, above, was used. At day 1, each mouse was given a single subcutaneous injection of 200 μΐ of saline without an FXII RNAi agent to be used as a control, or 200 μΐ containing 1.0 mg/kg of the FXII RNAi agent according to the following Table 22.

Table 22. Dosing groups of FXII-SEAP mice of Example 12.

Each of the FXII RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5'-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on day -2, day 8, day 15, day 22, day 29, and day 36, and SEAP expression levels were determined pursuant to the procedure set forth in Example 10, above. Data from the experiment are shown in the following Table 23, with Average reflecting the normalized (to pre-treatment only) average value of SEAP:

Table 23. Average SEAP normalized to pre-treatment in FXII-SEAP mice from Example

As shown in Table 23, nearly all of the FXII RNAi agents tested showed a substantial inhibition of expression of FXII in the SEAP mouse model compared to control. For example, on Day 15, AD04625, AD05330, and AD05331 each showed knockdown of approximately 95% compared to pre-treatment expression levels.

Example 13. FXII RNAi Agents in the FXII-SEAP Mouse Model)

The FXII-SEAP mouse model described in Example 10, above, was used. At day 1, each mouse was given a single subcutaneous injection of 200 μΐ of saline without an FXII RNAi agent to be used as a control, or 200 μΐ containing an amount of the FXII RNAi agent according to the following Table 24.

Table 24. Dosing groups of FXII-SEAP mice of Example 13.

Each of the FXII RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5 ^' -terminal end of the sense strand, as shown in Tables 3 and 4. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on day -3, day 8, day 15, day 22, and day 29, and SEAP expression levels were determined pursuant to the procedure set forth in Example 10, above. Data from the experiment are shown in the following Table 25, with Average reflecting the normalized (to pre-treatment only) average value of SEAP:

Table 25. Average SEAP normalized to pre-treatment in FXII-SEAP mice from Example

Day 8 Day 15 Day 22 Day 29

Group ID Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev

SEAP (+/-) SEAP (+/-) SEAP (+/-) SEAP (+/-)

Group 1 (Saline) 0.860 0.024 0.816 0.121 0.661 0.188 0.873 0.156

Group 2 (0.25 mg/kg AD04625) 0.373 0.031 0.369 0.093 0.226 0.035 0.425 0.048

Group 3 (0.5 mg/kg AD04625) 0.413 0.079 0.263 0.029 0.184 0.008 0.254 0.089

Group 4 (1.0 mg/kg AD04625)

0.149 0.07 0.077 0.058 0.013 0.019 0.062 0.046

Group 5 (0.5 mg/kg AD05331) 0.53 0.329 0.361 0.269 0.232 0.207 0.531 0.510

Group 6 (1.0 mg/kg AD05331)

0.153 0.090 0.078 0.073 0.047 0.038 0.095 0.069

Group 7 (0.25 mg/kg AD05333) 0.348 0.127 0.342 0.177 0.230 0.120 0.279 0.108

Group 8 (0.5 mg/kg AD05333)

0.186 0.033 0.128 0.078 0.117 0.065 0.158 0.035

Group 9 (1.0 mg/kg AD05333) 0.166 0.087 0.061 0.052 0.049 0.054 0.097 0.101

Group 10 (1.0 mg/kg AD05336) 0.198 0.042 0.134 0.032 0.082 0.044 0.194 0.171

Group 11 (0.5 mg/kg AD05339)

0.502 0.068 0.517 0.103 0.274 0.141 0.604 0.448

Group 12 (1.0 mg/kg AD05339) 0.221 0.042 0.164 0.101 0.139 0.069 0.182 0.082

OTHER EMBODIMENTS

It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.