BACKGROUND The Hepadnaviridae is a family of enveloped DNA viruses that produce persistent infection of hepatocytes, often resulting in the development of chronic hepatitis, liver failure and hepatocellular carcinoma. Human HBV (HBV) is the prototypic member of the hepadnavirus family. A characteristic feature of HBV and other hepadnaviral infections is strong species-specificity, and HBV can infect humans and chimpanzees but not baboons, lower primates or other mammals. This narrow host range, which has impeded in vitro studies of HBV, is thought to be governed at the level of virus entry into cells, as transfection studies using HBV DNA have been able to circumvent this barrier and allow HBV replication in otherwise non- permissive cells or cell lines.

The HBV genome contains four overlapping open reading frames (ORF), viz., ORF- S which encodes the envelope proteins, ORF-P encodes the DNA polymerase/reverse transcriptase. ORF-C which encodes the nucleocapsid proteins and ORF-X encodes a product which is thought to play a role in transactivation of

the HBV genome. ORF-S contains the S, preS2 and preS1 regions that encode the three related envelope glycoproteins (S-HBsAg, M-HBsAg and L-HBsAg) respectively. The virus envelope proteins can be expected to interact with a cellular receptor and all three envelope proteins have been shown to interact with a range of cellular proteins. The preS1 domain binds to HepG2 cells and liver cell membranes, the preS2 domain binds to HepG2 cells, T lymphocytes and liver cell membranes, and the S domain binds to hepatocytes, fibroblasts, mononuciear cells and Vero cells.

Many potential cellular receptors have been proposed but it is still unclear if the authentic receptor has been identified. HBV particles devoid of M-HBsAg are infectious and the only direct evidence for the contribution of the various domains comes from a study of duck HBV (DHBV) in which recombinant L-DHBsAg particles but not S-DHBsAg particles were able to inhibit DHBV repiication in primary duck hepatocytes. (DHBsAg has no equivalent of the M-HBsAg domain).

DESCRIPTION OF THE INVENTION The present invention provides an isolated HBV binding polypeptide comprising the amino acid sequence presented herein as SEQ I D No: 1 or a functional variant thereof.

Throughout the specification, unless the context requires otherwise, the word "comprise"or variations such as"comprises"or"comprising", will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.

For the purposes of the present invention"functional variant"includes portions or fragments of SEQ ID No: 1 with HBV binding activity, such as peptides, and larger polypeptides including SEQ ID No: 1 with HBV binding activity. Other"functional variants"include analogues and variants of SEQ ID No: 1 which maintain their HBV binding activity and include insertions, deletions, substitutions, or other

selected modifications of particular regions or specific amino acids residues.

These modifications can also provide for some additional property, such as to remove or add amino acids capable of disulfide bonding, to increase bio-stability. <BR> <BR> <BR> <BR> <BR> <BR> <P>The functional variants can be synthesized directly or obtained by chemical or mechanical disruption of larger molecules, fractioned and then tested for HBV binding activity. Functional variants with useful properties may also be obtained by mutagenesis of a specific region of the nucleotide encoding the polypeptide, followed by expression and testing of the expression product, such as by subjecting the expression product to a HBV binding assay. Functional variants may also be produced by Northern blot analysis of total cellular RNA followed by cloning and sequencing of identified bands derived from different tissues/cells, such as human organs, or by PCR analysis of such RNA also followed by cloning and sequencing. Thus, synthesis or purification of an extremely large number of functional variants is possible.

For the purposes of the present invention HBV binding activity includes (i) in vivo and in vitro binding of HBV and HBV antigens to the HBV binding polypeptide and (ii) binding of antibodies against the HBV binding polypeptide to prevent the HBV binding polypeptide binding HBV.

For the purposes of the present invention an"analog"include polypeptides with an amino acid sequence that has at least 50% identity with SEQ ID No: 1, more preferably at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% identity with SEQ ID No: 1.

One analogue according to the present invention, with 80% identity to SEQ ID No 1, is: GSNFRHKVSI WSGEMALTQA IGESTEAFRL LTAGSFTLGP QTGFPIEESV AWTEQKZERV PSDASASPGA VGQWLGNGID CEKVITIYTP CMANL.

The HBV binding polypeptide of SEQ ID No: 1 represents part of a larger polypeptide. The nucleic acid and amino acid sequences of the complete protein may be determined using the nucleic acid sequence data and the methods disclosed herein.

The HBV binding polypeptide may be a HBV receptor polypeptide or a HBV accessory molecule polypeptide. Preferably, the HBV binding polypeptide binds HBV but not hepatitis B surface antigen. In another form, the HBV binding polypeptide may be a cellular protein adapted to retain the HBVpreS1 domain inside the cell.

In one particular form, the HBV binding polypeptide is a polypeptide with the amino acid sequence presented herein as SEQ ID No: 1.

The polypeptides of the present invention may be synthesized in vitro or may be obtained using a cell-free translation system or a linked transcription-translation system. Alternatively, the polypeptides may be directly synthesized or obtained in a polypeptide extract from a cell that does not normally express the polypeptide, but has been transfected or transformed to do so, or is from a transgenic animal, as described below.

The polypeptides may be isolated by any one or more of a number of routine methods such as electrophoresis, blotting, precipitation, immunoprecipitation, dialysis, chromatography or combinations of these and other methods.

When the polypeptide is a HBV receptor it can be utilized in a system to regulate the binding activity of endogenous HBV receptors, in methods for assaying the regulation of HBV binding polypeptides, or in a model to investigate the regulation of ligand binding proteins.

The polypeptides of the present invention can be attached to sequences designed to provide for some additional property, such as solubility or to provide a means for attaching the sequence to a substrate via for example antibody-antigen

interaction. The polypeptides may also be bound to and thus immobilised on a solid support. Examples of suitable substrates or supports include polymers, beads (e. g., agarose, polystyrene, sepharose, etc.), latex plates, glass or plastic petri or culture dishes, albumin, and the like.

Uses for a HBV binding polypeptide comprising an immobilized polypeptide include, but are not limited to, affinity chromatography techniques such as those used to concentrate specific molecules which bind to the polypeptide. In particular, the immobilized HBV binding polypeptide or portion thereof can be used to identify natural or artificial ligands.

The HBV binding polypeptide of the present invention bound to a solid support can also be designed and used for virus neutralization testing and/or capture immunoassays in the methods described herein for removal/purification of HBV.

A method of detecting the presence of HBV in a sample, the method comprising the steps of: (i) contacting a HBV binding polypeptide comprising the amino acid sequence presented herein as SEQ ID No: 1, or a functional variant thereof, with a sample to form a HBV binding polypeptide-HBV complex; and (ii) detecting said complex. The polypeptide set forth as SEQ ID NO: 1 is one particular polypeptide of the present invention that can be utilized to detect HBV in a sample.

One example of a method of detecting HBV in a sample is performed by contacting a fluid or tissue sample from a subject with an amount of the HBV binding polypeptide of the present invention and detecting the binding of the HBV binding polypeptide with the virus.

The fluid sample can comprise any body fluid which would contain the virus or a cell containing the virus, such as, but not limited to, blood, plasma, serum, saliva, semen, faeces, or urine. Other possible examples of body fluids include sputum, mucus, gastric juice, and the like.

The tissue sample can comprise any tissue obtained from a subject or patient, such as, but not limited to, brain tissue, liver tissue, kidney tissue, heart tissue, lung tissue, placenta tissue, skin tissue, muscle tissue, pancreatic tissue, and so forth. Such tissue samples can be prepared for analysis by disruption and separation into fractions based on size or density, or lysed for analysis of the cellular extracts. Other methods for tissue preparation are common and obvious to a skilled practitioner in the relevant art.

In one embodiment of the HBV detection method of the present invention, the presence of binding is determined by an immunoassay. Immunoassays such as immunofluorescence assays (IFA), ELISAs, and immunoblotting assays can be readily adapted to accomplis the detection of the HBV bound to the HBV binding polypeptide.

An ELISA method effective for the detection of the virus can, for example, be as follows: (1) bind the HBV binding polypeptide to a substrate; (2) contact the bound HBV binding polypeptide with a fluid or tissue sample containing the virus; (3) contact the above with a specific antibody, which recognises HBV, bound to a detectable moiety (e. g., horseradish peroxidase enzyme or alkaline phosphatase enzyme); (4) contact the above with the substrate for the enzyme; (5) contact the above with a colour reagent; and (6) observe colour change.

Another immunological technique that can be useful in the detection of HBV is a competitive inhibition assay wherein HBV can be detected by competitive inhibition of HBV binding polypeptide, utilizing monoclonal antibodies (MABs) specifically reactive with the HBV binding polypeptide. Briefly, sera or other body fluids from the subject is reacted with the HBV binding polypeptide bound to a substrate (e. g. an ELISA 96-well plate). Excess sera is thoroughly washed away. A labelled (enzyme-linked, fluorescent, radioactive, etc.) monoclonal antibody is then reacted with the previously reacted HBV-HBV binding polypeptide complex. The amount of inhibition of monoclonal antibody binding is measured relative to a control. MABs can also be used for detection directly in

samples by IFA for MABs specifically reactive for the HBV binding polypeptide- virus complex.

Thus, the present invention also provides a competitive inhibition assay comprising the steps of: (i) contacting a HBV binding polypeptide comprising the amino acid sequence presented herein as SEQ ID No: 1, or a functional variant thereof, with a sample to form a HBV binding polypeptide-HBV complex; (ii) removing uncompiexed material; (iii) contacting the above with a labelled monoclonal antibody (MAB) specific for the HBV binding protein; and (iv) comparing the amount of MAB bound in step (iii) with a control to determine the level of inhibition.

HBV may also be detected according to the present invention by micro- agglutination. In this regard, a solid substrate such as latex beads are coated with the HBV binding polypeptide and mixed with a test sample, such as tissue or body fluid, such that HBV in the tissue or body fluids that are specifically reactive with the HBV binding polypeptide become crosslinked with the HBV binding polypeptide, causing agglutination. The agglutinated HBV binding polypeptide- virus complexes form a precipitate, visible with the naked eye or detectable by a spectrophotometer.

Thus, the present invention also provides an agglutination assay for detecting the presence of HBV in a sample, the assay comprising the steps of: (i) contacting a HBV binding polypeptide comprising the amino acid sequence presented herein as SEQ ID No: 1, or a functional variant thereof bound to a substrate capable of agglutination such as latex beads, with a sample to form a HBV binding polypeptide-HBV complex; and (ii) detecting the precipitated said complex.

In the methods described above, the sample can be taken directly from a patient or subject or be partially purified prior to being subjected to the methods. The HBV binding polypeptide reacts by binding HBV and more particularly viral amino acid sequences that are preferably associated with virus receptor interaction (the

primary reaction). Thereafter, a secondary reaction with an anti-HBV binding polypeptide antibody or anti-HBV antibody bound to, or labelled with, a detectable moiety can be added to enhance the detection of the primary reaction.

Generally, in the secondary reaction, an antibody or other ligand which is reactive, either specifically or non-specifically with a different binding site of the HBV binding polypeptide or the virus will be selected for its ability to react with multiple sites on the complex of HBV binding polypeptide and virus. Thus, for example, several molecules of the antibody in the secondary reaction can react with each complex formed by the primary reaction, making the primary reaction more detectable. The detectable moiety can allow visual detection of a precipitate or a colour change, visual detection by microscopy, or automated detection by spectrometry, radiometric measurement or the like.

Examples of detectable moieties include fluorescein and rhodamine (for fluorescence microscopy), horseradish peroxidase (for either light or electron microscopy and biochemical detection), biotin-streptavidin (for light or electron microscopy) and alkaline phosphatase (for biochemical detection by colour change). The detection methods and moieties used can be selected, for example, from the list above or other suitable examples by the standard criteria applied to such selections.

The HBV binding polypeptide of the present invention and its use thereof for detecting HBV may be incorporated into a HBV diagnostic kit. Thus, the present invention also provides a diagnostic kit comprising a HBV binding polypeptide comprising the amino acid sequence presented herein as SEQ ID No: 1 or a functional variant thereof.

The HBV binding polypeptide of the present invention may be used as a therapeutic agent or a vaccine. Thus, the present invention also provides a vaccine or therapeutic comprising an isolated HBV binding polypeptide

comprising the amino acid sequence presented herein as SEQ ID No: 1 or a functional variant thereof and a pharmaceutically acceptable carrier.

Treatment or prevention of HBV infection can be facilitated by competitive <BR> <BR> <BR> inhibition of HBV binding to a cell by administration of the HBV binding polypeptide of the present invention in a pharmaceutically acceptable carrier.

The amount of the HBV binding polypeptide sufficient to treat a HBV infection in a human depends at least partially on the amount of the HBV binding polypeptide, such as a HBV receptor or accessory molecule or the binding domain thereof, on the cells of the human subject. The dose can be determined by optimization procedures apparent to one skilled in the art. The amount of the HBV binding polypeptide will also vary depending upon the weight, size, and health of the human subject, and with the severity of HBV infection.

Patients can also be treated orally with compositions of a HBV binding polypeptide to block infection with HBV or to block transmission of HBV. For oral administration, fine powders or granules may contain diluting, dispersing, and/or surface active agents, and may be presented in water or in a syrup, in capsules or sachets in the dry state, or in a non-aqueous solution or suspension wherein suspending agents may be included, in tablets wherein binders and lubricants may be included, or in a suspension in water or a syrup. Where desirable or necessary, flavouring, preserving, suspending, thickening, or emulsifying agents may be included. Tablets and granules are preferred oral administration forms, and these may be coated.

Thus, the present invention also provides a method of treating a subject infected with HBV, the method comprising administering to the subject a therapeutically effective amount of an isolated HBV binding polypeptide comprising the amino acid sequence presented herein as SEQ ID No: 1 or a functional variant thereof and a pharmaceutically acceptable carrier.

The present invention also provides a method of preventing HBV infection in a subject, the method comprising administering to the subject a prophylactically effective amount of an isolated HBV binding polypeptide comprising the amino acid sequence presented herein as SEQ ID No: 1 or a functional variant thereof and a pharmaceutically acceptable carrier.

With regard to vaccines of the present invention, the candidate HBV binding polypeptides can be tested to determine their immunogenicity and specificity for use as a vaccine. Briefly, various concentrations of a putative immunogen are prepared and administered to an animal and the immunological response (e. g., the production of antibodies or cell mediated immunity) of an animal to each concentration is determined. Thereafter an animal so inoculated with the immunogen can be exposed to the virus to test the potential vaccine effect of the specific immunogenic fragment. The specificity of an immunogen can be ascertained by testing sera, other fluids or lymphocytes from the inoculated animal for cross reactivity with other closely related viruses.

Immunogenic amounts of the vaccine antigen can be determined using standard procedures. Briefly, various concentrations of a putative specific immunoreactive epitope are prepared, administered to a subject and the immunological response (e. g., the production of antibodies or cell mediated immunity) of the subject to each concentration is determined. The amounts of antigen administered depend on the subject, e. g. a human or a guinea pig, the condition of the subject and the size of the subject.

Accordingly, therefore, the present invention provides a vaccine comprising the HBV binding polypeptide of the present invention and a pharmaceutically acceptable carrier. Examples of such polypeptides include those derived from the polypeptide sequence set forth herein as SEQ ID No: 1 and those encoded by the nucleotide sequences set forth herein as SEQ ID No: 2 and No: 3. Such a vaccine would naturally include immunogenic amounts of the HBV binding polypeptide.

The carrier will depend upon the method of administration and choice of adjuvant, if one is used. An adjuvant can also be a part of the carrier of the vaccine, in which case it can be selected by standard criteria based on the antigen used, the mode of administration and the. Methods of administration can be by oral or sublingual means, or by injection, depending on the particular vaccine used and the subject to whom it is administered.

The present invention also provides antagonists which specifically bind to the HBV binding polypeptide of the present invention. The antagonist can be an antibody or a chemical which binds the HBV binding polypeptide or portion thereof or otherwise alters the protein or interferes with the interaction of virus and protein. For example, when the HBV binding polypeptide is a HBV receptor one can select antagonists which reacts with the binding site of the HBV receptor or a binding domain of a HBV receptor and affects the binding of HBV.

Dane particles or empty HBV virions can be utilized as the antagonist. Alternatively, anti-idiotype and anti-anti-idiotype antibodies to both the HBV binding polypeptide and the HBV can be utilized for prophylaxis or therapy. Naturally, the treatment modality can be selected to minimize any adverse side effects such as immune system recognition and deletion of the desirable HBV receptor expressing cells. Thus, the invention also provides a method of screening for compounds which antagonize the binding of HBV using the HBV binding polypeptide of the present invention.

The present invention also provides a method of screening compounds for anti- HBV binding activity, comprising contacting the HBV binding polypeptide with a candidate compound and HBV and determining the relative amount of HBV bound to the polypeptide, the relative amount of virus bound to the polypeptide being an indication of the anti-HBV binding activity of the candidate compound. In this form of the invention, the HBV binding polypeptide may be on a cell which expresses the HBV binding protein.

Depending on whether the compound selected by the screening method is administered orally, parenterally, or otherwise, the compounds of the present invention can be in pharmaceutical compositions in the form of soiid, semi-solid, or liquid dosage forms, such as, for example, tablets, pills, capsuies, powders, liquids, and suspensions, or the like, preferably in unit dosage form suitable for delivery of a precise dosage. The compositions will include, as noted above, an effective amount of the selected compound in combination with a pharmaceutically acceptable carrier and, in addition, may include other medicinal agents, pharmaceutical agents, carriers, adjuvants and diluent.

A purified antibody that specifically binds the HBV binding polypeptide is also provided. The antibodies can be polyclonal or monoclonal and can specifically bind a unique epitope of the receptor."Specifically bind"as used herein describes an antibody or other ligand that does not cross-react substantially with any antigen other than the one specified, in this case, the HBV binding polypeptide of the present invention.

Antibodies can be made by many well-known methods. Briefly, viral antigen can be injected into an animal in an amount and in intervals sufficient to elicit an immune response. Antibodies can either be purified directly, or spleen cells can be obtained from the animal. The cells are then fused with an immortal cell line and screened for antibody secretion. The antibodies can be used to screen nucleic acid clone libraries for cells secreting the antigen. Those positive clones can then be sequenced.

The antibody can be bound to a substrate or labelled with a detectable moiety or both bound and labelled. The detectable moieties contemplated with the composition of the present invention can be those listed above in the description of the detection methods, including fluorescent, enzymatic and radioactive markers.

HBV infection can also be prevented or treated by administering to a subject an antibody or other ligand reactive with a HBV binding polypeptide, such as a receptor or accessory molecule or binding domain thereof, which blocks the HBV binding domain. The amount of antibody administered will also be dependent upon the amount of natural HBV binding polypeptide on the cells of the subject and can be determined by optimization procedures apparent to one skilled in the art.

The present invention also provides a method for detecting a HBV and/or antibodies to the virus utilizing a capture assay. Briefly, to detect antibodies to HBV in a patient sample, antibodies to the patient's immunoglobulin, e. g., anti-IgG (or IgM) are bound to a solid phase substrate and used to capture the patient's immunoglobulin from serum.

Also provided is a method of introducing a therapeutic into a cell, comprising a therapeutic linked to or packaged within a HBV capable of binding to the HBV binding polypeptide, such as a HBV receptor or accessory molecule or binding domain thereof, of the present invention.

Such therapeutics include antibodies directed toward the HBV binding polypeptide, drugs, compounds, or substances which may alter the binding of HBV to its receptor or accessory molecule or a binding domain thereof, fragments of a HBV which bind to a HBV receptor or accessory molecule or a binding domain of a HBV receptor, other natural or synthetic ligands which bind to a HBV receptor or a binding domain of a HBV receptor linked to a drug, compound, or other substance, or antibodies to a HBV receptor or binding domain of a HBV receptor linked to a drug, compound, or other substance.

The present invention also provides a cell line which are adapted to express the HBV binding polypeptide of the present invention, preferably on the cell surface, to a level that is elevated relative to normal or endogenous cells. Such cells can be manipulated to contain increased levels of HBV binding polypeptide. These

cells can be manipulated in many ways including direct addition of HBV binding polypeptide to cells with subsequent incorporation by mass action into the lipid bilayer of the cell. The manipulated cells of the present invention can include cells originally non-permissive for HBV infection as well as permissive cells made more permissive.

The present invention also provides a method of delivering a desired gene or nucleic acid into a cell expressing the HBV binding polypeptide, such as a receptor or accessory molecule or binding domain thereof, comprising infecting the cell with a non-virulent (modified) HBV having the desired nucleic acid molecule inserted into the HBV genome.

The present invention also provides a method of augmenting the above method, comprising the step of increasing the amount of HBV binding polypeptide expressed on the cell surface and infecting the cell with a HBV having the desired nucleic acid molecule inserted into the HBV genome. The identification of HBV binding polypeptide, as taught by the present invention, enables methods of gene therapy with HBV as the vector system. The desired human DNA fragment can be inserted into a host cell, e. g., one with sufficient levels of HBV binding polypeptide on the cell surface.

The present invention also provides a method of isolating HBV from a sample, comprising contacting the sample with an isolated HBV binding polypeptide and separating the bound HBV from the unbound impurities in the sample, thereby separating the HBV from impurities in the sample. Based on the teaching herein, the purification of HBV can be accomplished by the use of immobilized HBV binding polypeptide that specifically bind the target HBV. Once a complex of the HBV binding polypeptide and virus is formed, the impurities in a sample can be separated using known techniques, such as column purification and centrifugation.

The present invention provides a method for removing HBV from a blood sample comprising binding the HBV in the blood with an isolated HBV binding polypeptide and separating the bound virus from the blood, thereby removing the HBV from the blood sample.

Donated blood contaminated with HBV presents a health hazard. The method of the present invention utilizes the HBV binding polypeptide, e. g., the polypeptide of SEQ ID NO: 1 or a functional variant thereof, to bind to the virus. The bound complex can be removed from the blood sample by preparing a column with the immobilized HBV binding polypeptide. The sample is then passed through the column, thereby removing HBV from the sample utilizing the binding affinity of HBV for the HBV binding polypeptide. Alternatively, the immobilized HBV binding polypeptide can be mixed with the sample and the bound virus-binding protein complex removed by centrifugation, or by having the binding protein attached to a magnetic bead, followed by removal of the complex and bead by magnet.

The present invention also provides isolated nucleic acid molecules encoding a HBV binding polypeptide comprising the amino acid sequence presented herein as SEQ ID No: 1 or a functional variant thereof.

For the purposes of the present invention, it will be appreciated that the nucleic acids of the present invention include variants such as allelic variants and nucleic acids that have been derived from the nucleic acid sequences of the present invention including altered sequences that have been manipulated to encode functional variants of the HBV binding polypeptide of the present invention.

The nucleic acids presented herein as SEQ ID No: 2 and 3 encode HBV binding polypeptides which are a portion of a larger protein. The complete nucleic acid sequence may be obtained using the information contained herein and techniques apparent to one skilled in the art including chromosome walking and RACE.

Briefly, chromosome walking involves the use of the nucleic acid sequences herein to generate probes which are then used to screen a genomic library under high stringency conditions. Isolated clones are sequenced and then a portion of that clone, not present in the nucleotide fragments already known, is used to reprobe the genomic library. This procedure can be repeated until the entire sequence is determined.

Preferably, the nucleic acid molecule of the present invention includes at least a portion of the nucleic acid sequence presented herein as SEQ ID No: 2.

Alternatively, the nucleic acid molecule includes at least a portion of the nucleic acid sequence presented herein as SEQ ID No: 3.

The nucleic acids of the invention can be double-stranded or can be in denatured (single-stranded) form. The invention includes DNA having a sequence including or comprising that set forth in SEQ ID No: 2 or No: 3 and their complement, and RNAs which correspond to the DNA.

Also provided is a nucleic acid that encodes a HBV binding polypeptide comprising a HBV receptor binding domain or accessory molecule or a HBV receptor regulatory domain. Such regulatory domains can be manipulated through recombinant techniques to alter their activity and or effect on other regions of the HBV binding polypeptide.

The nucleic acids of the present invention include positive and negative strand RNA as well as DNA and includes genomic and sub-genomic nucleic acids present in an organism. The nucleic acids contemplated by the present invention include cDNA encoding the HBV binding polypeptide, the genomic DNA fragments containing the relevant introns and exons, as well as any upstream or downstream regulatory regions, the mRNA encoded by either the cDNA or the genomic DNA, and any nucleic acid which can selectively hybridize to or encode the HBV binding polypeptides of the present invention.

The present invention also provides isolated nucleic acid molecules encoding the HBV binding polypeptide that selectively hybridize with at least a portion of the <BR> <BR> <BR> <BR> nucleic acids set forth herein as SEQ ID No: 2 or No: 3 or their complement.<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <P>As used herein to describe nucleic acids. the term"selectively hybridize"excludes the occasional randomly hybridizing nucleic acids under at least moderate stringency conditions. The selectively hybridizing nucleic acids can be used, for example, as probes or primers for detecting the presence of the HBV binding polypeptide coding gene or messenger RNA, or a homologue thereof, that has the nucleic acid to which the primer or probe hybridizes.

A nucleic acid molecule is"hybridizable"to another nucleic acid molecule, such as <BR> <BR> <BR> <BR> a cDNA, genomic DNA, or RNA, when a single-stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength. The conditions of temperature and ionic strength determine the"stringency"of the hybridization. For preliminary screening for homologous nucleic acids, low stringency hybridization <BR> <BR> <BR> <BR> conditions, corresponding to a Tm of 55°C, can be used, e. g., 5x SSC, 0.1% SDS,<BR> <BR> <BR> <BR> <BR> <BR> 0.25% milk, and no formamide: or 30% formamide, 5x SSC, 0.5% SDS). Moderate stringency hybridization conditions correspond to a higher Tm, e. g., 40% formamide, with 5x or 6x SCC. High stringency hybridization conditions correspond to the highest Tm, e. g., 50% formamide, 5x or 6x SCC.

Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible. The appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of Tm for hybrids of nucleic acids having those sequences. The relative stability (corresponding to higher Tm) of nucleic acid hybridizations decreases in the following order: RNA: RNA, DNA: RNA, DNA: DNA. For hybrids of greater than 100

nucleotides in length, equations for calculating Tm have been derived and are known to those skilled in the art. For hybridization with shorter nucleic acids, i. e., oligonucleotides, the position of mismatches becomes more important, and the length of the oligonucleotide determines its specificity. Preferably a minimum length for a hybridizable nucleic acid is at least about 10 nucleotides; more preferably at least about 15 nucleotides; most preferably the length is at least about 20 nucleotides.

The selectively hybridizing nucleic acids of the invention may have at least 60%, 70%, 80%, 85%, 90%, 95%, 97%, 98% and 99% complementarity with the segment of the sequence to which it hybridizes. Furthermore, the nucleic acids can be a coding sequence for the polypeptide of SEQ ID No: 1 or a functional variant thereof, or can be used as probes or primers for detecting the presence of the HBV binding polypeptide.

By utilizing the nucleic acid sequences taught herein and relying on cross- hybridization, one skilled in the art can identify nucleic acids in other species that encode HBV binding polypeptides which can be utilized to prevent or treat HBV infections in other species. For example, the purified HBV receptor for chimpanzee HBV can be isolated and utilized in a composition to prevent or treat infection or to block transmission of the virus in a chimpanzee utilizing methods for preparing the composition and optimization procedures for therapy described herein.

The selectively hybridizable nucleic acids of the present invention may be used for gene therapy comprising the step of administering to a subject a selectively hybridizabie nucleic acid whereby the selectively hybridizable nucleic acid hybridizes to a nucleic acid, such as mRNA, encoding the HBV binding polypeptide of the present invention, thus preventing its expression.

If used as primers, the invention provides compositions including at least two nucleic acids which selectively hybridize with different regions of the target nucleic

acid so as to amplify a desired region. Depending on the length of the probe or primer, the target region can range between 70% complementary bases and full complementarity.

Modifications to the nucleic acids of the invention are also contemplated, provided the essential structure and function of the polypeptide encoded by the nucleic acids is maintained. Likewise, portions used as primers or probes can have substitutions provided enough complementary bases exist for selective hybridization.

The nucleic acids described herein or more particularly portions thereof can be used to detect the nucleic acid of the present invention in samples by methods such as the polymerase chain reaction, ligase chain reaction, hybridization, and the like. Alternatively, these sequences can be utilized to produce an antigenic protein or protein portion, or an active protein or protein portion.

In addition, portions of the nucleic acids described herein can be selected to selectively hybridize with homologous nucleic acids present in other animals or humans. Such a nucleotide sequence shared with other organisms can be used, for example, to simultaneously detect related sequences for cloning of homologues of the nucleic acid of the present invention encoding a HBV binding polypeptide of the present invention.

Vectors comprising the nucleic acids of the present invention are also provided. The vectors of the invention can be in a host capable of expressing the HBV polypeptide of the present invention. The present invention provides a vector comprising a nucleic acid encoding the HBV binding polypeptide of the present invention or the nucleic acids set forth herein as SEQ ID No: 2 or No: 3. Additionally, the present invention provides a vector comprising a nucleic acid molecule complementary to or capable of selectively hybridizing with the nucleic acid comprising the nucleotide sequences set forth herein as SEQ ID No: 2 or No:

3 or a portion thereof. An alternative coding sequence for the HBV binding polypeptide can also be expressed.

There are numerous E. coli expression vectors known to one of ordinary skill in the art useful for the expression of the HBV binding polypeptide or portion thereof of the present invention. Other microbial hosts suitable for use include bailli, such as Bacillus subtilis, and other enterobacteriaceae, such as Salmonella, Serratia, and various Pseudomonas species. In these prokaryotic hosts one can also make expression vectors, which will typically contain expression control sequences compatible with the host cell (e. g., an origin of replication). In addition, any number of a variety of well-known promoters will be present, such as the lactose promoter system, a tryptophan (Trp) promoter system, a beta- lactamase promoter system, or a promoter system from phage lambda. The promoters will typically control expression, optionally with an operator sequence, and have ribosome binding site sequences for example, for initiating and compieting transcription and translation. If necessary an amino terminal methionine can be provided by insertion of a Met codon 5'and in-frame with the antigen. Also, the carboxy-terminal extension of the HBV binding polypeptide can be removed using standard oligonucleotide mutagenesis procedures.

Additionally, yeast expression can be used. There are several advantages to yeast expression systems. First, evidence exists that proteins produced in a yeast secretion system exhibit correct disulfide pairing. Second, post- translational glycosylation is efficiently carried out by yeast secretory systems.

Efficient post translational glycosylation and expression of recombinant proteins can also be achieved in Baculovirus systems.

Mammalian cells permit the expression of proteins in an environment that favours important post-translational modifications such as folding and cysteine pairing, addition of complex carbohydrate structures, and secretion of active protein. Vectors useful for the expression of active proteins in mammalian cells are characterized by insertion of the protein coding sequence between a strong

viral promoter and a polyadenylation signal. The vectors can contain genes conferring hygromycin resistance, gentamicin resistance, or methotrexate resistance, or other genes or phenotypes suitable for use as selectable markers.

The HBV binding polypeptide coding sequence can be introduced into a Chinese Hamster Ovary cell line using a methotrexate resistance-encoding vector, or other cell lines using suitable selection markers. Presence of the vector RNA in transformed cells can be confirmed by Northern blot analysis and production of a cDNA or opposite strand RNA corresponding to the antigen coding sequence can be confirmed by Southern and Northern blot analysis, respectively. A number of other suitable host cell lines capable of secreting intact human proteins have been developed in the art, and include the CHO cell lines, HeLa cells, myeloma cell lines, Jurkat cells.

Expression vectors for these cells can include expression control sequences, such as an origin of replication, a promoter, an enhancer, and necessary information processing sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcriptional terminator sequences. Preferred expression control sequences are promoters derived from immunoglobulin genes, SV40, Adenovirus, Bovine Papilloma Virus. The vectors containing the nucleic acid segments of interest can be transferred into the host cell by well-known methods, which vary depending on the type of cellular host. For example, calcium chloride transformation is commonly utilized for prokaryotic cells, whereas calcium phosphate mediated transfection or electroporation may be used for other cellular hosts.

Alternative vectors for the expression of the HBV binding polypeptide in mammalian cells, include those similar to those developed for the expression of human gamma-interferon, tissue plasminogen activator, clotting Factor VIII, HBV surface antigen, protease Nexinl, and eosinophil major basic protein, can be employed. Further, the vector can include CMV promoter sequences and a

polyadenylation signal available for expression of inserted nucleic acid in mammalian cells (such as COS-7).

The nucleic acid sequences can be expressed in hosts after the sequences have been operably linked to, i. e., positioned, to ensure the functioning of an expression control sequence. These expression vectors are typically repliable in the host organisms either as episomes or as an integral part of the host chromosomal DNA. Commonly, expression vectors can contain selection markers, e. g., tetracycline resistance or hygromycin resistance, to permit detection and/or selection of those cells transformed with the desired nucleic acid sequences.

Polynucleotides encoding a variant polypeptide may include sequences that facilitate transcription (expression sequences) and translation of the coding sequences such that the encoded polypeptide product is produced. For example, such polynucleotides can include a promoter, a transcription termination site (polyadenylation site in eukaryotic expression hosts), a ribosome binding site, and, optionally, an enhancer for use in eukaryotic expression hosts, and, optionally, sequences necessary for replication of a vector.

Also provided by the present invention are host cells expressing a foreign gene or nucleic acid encoding a HBV binding polypeptide, such as a receptor or accessory molecule or a binding domain thereof. Such cells include prokaryotic cells such as E. coli, or eukaryotic cells, such as COS-1 cells.

Foreign genes and nucleic acids can be introduced into these cells by a number of techniques, including, but not limited to, transfection, transformation, electroporation, injection, microinjection, and the like. Specifically, transfection includes techniques such as calcium phosphate co-precipitation, DEAE-Dextran mediated transfection, and lipofection. Viral vectors may also be utilized to introduce foreign genes into host cells. Cells expressing the foreign gene may therefore express the polypeptide encoded by the foreign gene on the cell

surface. Such cells may therefore be infectable by HBV and utilized either as models for studying infection of cells by HBV, or as cells producing HBV post- infection.

Transgenic animals expressing the HBV binding poiypeptide of the present invention are also provided. Specifically, a non-human transgenic animal expressing a nucleic acid encoding a HBV binding polypeptide having the polypeptide sequence set forth herein as SEQ ID No: 1 or a functional variant thereof, but not expressing an endogenous active HBV binding polypeptide is provided. In this embodiment, the foreign nucleic acid expressed in the animal is preferably a nucleic acid sequence encoding the polypeptide of SEQ ID No: 1 or a functional variant thereof or the sequence set forth herein as SEQ ID No: 2 or No: 3.

Another embodiment of the present invention is a transgenic animal expressing the sequence encoding the HBV binding polypeptide encoded by a nucleic acid that selectively hybridizes with the sequences set forth herein as SEQ ID No: 2 or No: 3.

Uses contemplated for the transgenic animals of the present invention can be, but are not limited to, methods to screen drugs, vaccines, or other compounds or substances for their anti-HBV binding activity, methods to screen drugs, vaccines, or other compounds or substances for their anti-HBV infection activity, methods to screen drugs, vaccines, or other compounds or substances for their HBV therapeutic activity, or as a model animal which can be used to produce HBV after being previously infected with HBV.

The nucleic acid used for generating a transgenic animal of the invention includes, but is not limited to, a cDNA fragment encoding a HBV binding polypeptide or a genomic sequence encoding a HBV binding polypeptide. Such a genomic sequence may contain introns as well as exons, upstream and/or

downstream regulatory sequences, and other functional and/or structural regions.

Nucleic acids used for generating such a transgenic animal may be circular or linear molecules, and may be introduced into the animal with or without additional nucleic acids. Such additional nucleic acids include, but are not limited to, plasmid, phage, cosmid, viral, or mammalian cloning vectors, and the like.

The nucleic acid may be introduced into a zygote or fertilized egg of a female animal containing two pronuclei, or embryonic stem cells prior to introducing the nucleic acid into an embryo, zygote, or fertilized egg of a female animal containing two pronuclei. The nucleic acid may be introduced into embryonic stem cells by transfection, retroviral infection, electroporation, injection, microinjection, and the like. After introduction of the foreign nucleic acid into the embryo, the embryo is transferred to the oviduct of a foster, pseudopregnant mother, and upon subsequent implantation into the uterus, the embryo may develop to term.

The transgenic animal of the invention can be used in a method of testing the efficacy of a HBV vaccine. This method comprises administering the potential vaccine to a transgenic animal which expresses the introduced nucleic acid encoding a HBV binding polypeptide of the present invention, such as a receptor or accessory molecule or a binding domain thereof, and determining whether the transgenic animal is protected from infection with HBV.

Protection of the transgenic animal from infection by HBV may be determined in a number of ways, including, but not limited to, detecting the presence of virus in the serum, spinal fluid, plasma, blood, mucus, gastric fluids, faeces, urine, and other fluids, brain tissue, liver tissue, kidney tissue, heart tissue, lung tissue, placenta tissue, skin tissue, muscle tissue, pancreatic tissue, and other tissues.

Detection of virus is contemplated to distinguish between detection of virus inoculum introduced into the animal and detection of replicating virus produced as a result of a failure of a potential vaccine to prevent infection. Methods of detection for the presence of replicating virus include, but are not limited to, PCR, ELISA, IFA, Southern blotting, Western blotting, Northern blotting, plaque assay, immunocytochemical techniques and serological profiling, such as assaying for anti-HBc antibodies or HBsAg.

A transgenic animal of the invention can be used in a method of producing HBV, comprising generating a transgenic animal expressing a foreign nucleic acid encoding a HBV binding polypeptide followed by productive infection of the animal with introduced HBV.

HBV replicated by cells that express the introduced foreign nucleic acid and become infected with HBV can be harvested by any of a number of methods known to a skilled practitioner in the art. Harvesting the replicating HBV from a transgenic animal expressing the HBV binding polypeptide may therefore provide a source of newly synthesized HBV for other clinical (e. g., diagnostic) or research procedures, or for vaccines.

The present invention will now be described by reference to the following examples. The description of the examples is in no way to limit the generality of the preceding paragraphs.

BRIEF DESCRIPTION OF THE FIGURES <BR> <BR> <BR> <BR> <BR> <BR> Figure 1: SDS-PAGE analysis of the ten 35S methionine-labelled, in vitro translated, cellular proteins used in the in vitro binding assay. The radiolabelled proteins ranged in size from 23kDa to 35kDa. The molecular weight markers were generated from a commercial standard (BioRad). <BR> <BR> <BR> <BR> <BR> <BR> <P>Figure 2: SDS-PAGE analysis of the 35S-methionine-labelled in vitro translated proteins bound to baculovirus-expressed recombinant GST-preS1 coated

Sepharose beads. Lanes 1-10 represent the proteins derived from clones 1-10.

Lane M represents a binding reaction using a control in vitro translation mixture in which RNA was omitted.

Figure 3: Comparison of the relative level of binding of radiolabelled cellular proteins 1-10 to GST-preS1 coated beads. The results from the in vitro binding assay described in Figure 2 were quantitated using ImageQuant; (+ to ++++) represents the level of intensity of the interaction of each clone observed using the yeast two hybrid system.

Figures 4a and 4b: The predicted hydrophilicity plots and secondary structure of proteins #1 (4a) and #6 (4b). The plots were generated using the Kyte-Doolittle scale and a hydrophilicity window size of 7. The secondary structures (alpha helices, beta sheets etc) were examined using the Robson-Garnier and Chou- Fasman methods, with the MacVector 3.5 protein analysis toolbox.

Figure 5: SDS-PAGE analysis of the polypeptide profile of the purified HBsAg (lane 1) and purified HBV (lane 2) preparations. After gel electrophoresis, the separated polypeptides were stained with silver. The molecular weight markers (lane 3) were pre-stained low range standards (BioRad).

Figure 6: Analysis of the in vitro HBV competition assay. 35S methionine- labelled in vitro translated proteins #1 and #6 were incubated respectively with HBV or HBsAg prior to incubation with the GST-preS1 coated Sepharose beads.

Radiolabelled protein bound to the beads was analysed by SDS-PAGE and examined by phosphorimaging.

Figure 7: Analysis of the binding reaction between GST-protein 6 and HBV by PCR and gel electrophoresis. GST- (lanes 1 and 2) or GST-protein 6- (lanes 3 and 4) coated bead were incubated with partially purified HBV virions. HBV virions bound to the beads after washing (lanes 1 and 3) and in the supernatant fluids prior to washing the beads (lanes 2 and 4) was then determined by PCR; a

negative (no DNA) and positive control (pKSHBV DNA) were examined by PCR in parallel and the results are shown in lanes 5 and 6 respectively.

EXAMPLE 1 Materials and Methods Plasmid constructions.

The preS1 region of the L-HBsAg gene was amplified by PCR using the forward and reverse primers, preS1 F and preS1 R, which contain an EcoRl and Pstl site respectively for ease of cloning. The sequence of the primers with the restriction <BR> <BR> <BR> <BR> enzyme site underlined is preS1 F: 5'CGCGAATTCATGGGGACGAATCITTCT3' ; preS1 R 5'CGGCTGCAGCTAGGCCTGAGGATGACTGTC3'. These bind to nucleotide positions 2850 and 3173 on the HBV genome (4). The 309 bp product was cloned into the respective restriction enzyme sites of plasmid pGBT9 (Clontech) to ensure that this region was in frame with the GAL4 DNA-binding domain and this plasmid was subsequently named pGBT9/preS1. The human liver cDNA library, which is fused with the GAL4 activation domain of the pGAD10 vector, was also obtained from Clontech.

The region representing the cellular gene insert in a number of reactive clones was amplified by PCR using primers, pGAD10UP and pGAD10DOWN, which anneal to the GAL4 activation domain. The forward primer, pGAD10UP, contained a T7 RNA polymerase promoter region which was subsequently removed from the PCR product by digestion with the restriction enzyme Smal. The sequence of the pGADIOUP and pGAD1 ODOWN primers is <BR> <BR> <BR> <BR> 5'GCGCTTAATACGACTCACTATACCCGGGAAGCATACAATCAACTC3'and 5'AAAGCGGCCGCACAGTTGAAGTGAACT3'respectively. These contain Smal and Notl enzyme sites respectively (underlined). Eight reactive clones were amplified and the products subsequently inserted into the Notl and Smal sites of pBluescript KS+ (Stratagene). Two additional reactive clones were excised directly

from the pGAD10 vector using the restriction enzyme Hindlll and inserted into the same enzyme site of the pcDNA3 vector (Invitrogen).

The plasmid, bacMP, which was used to construct the GST-preS1 recombinant baculovirus (bacMPV) for the expression of the GST-preS1 fusion protein-in Spodoptera frugiperda (Sf9) cells, was constructed by inserting a PCR cDNA fragment, encoding the preS1 domain into the EcoRl site of pAcSG2T-tag (13), generated with the primers preS1 BacF <BR> <BR> <BR> <BR> (5'AAAGGATCCATGGGGGAGAATCTLTCCACC3') and preS1 BacR<BR> <BR> <BR> <BR> <BR> (5'AAAGAATTCCTAGGCCTGAGGATGAGTGTTTCT3'). As the forward primer contains a BamH ! restriction enzyme site which is also present within the preS1 region itself, the amplicon was inserted into the EcoRl site of pAcSG2T-tag by blunt-end ligation.

Screenina of the liver cell cDNA library by the yeast two-hybrid system.

The screening procedure used was a modification of the method described (2); Saccharomyces cerevisiae HF7C or SFY526 (Clontech) was grown in YPD medium (1% yeast extract, 2% peptone, 2% dextrose) or synthetic minimal medium (0.67% yeast nitrogen base, 2% dextrose and appropriate auxotrophic supplements). Both yeast host strains carry a lacZ reporter gene under the control of GAL4-binding sites, while the HF7C strain contains a second reporter gene (HIS3) under the control of GAL4-responsive elements. The yeast strain HF7C was used to screen the liver cDNA library. Yeast cells were transformed with pGBT9/preS1 and the pGADtO/cDNA library using a modified version of the lithium-acetate method previously published by Gietz et al (5) and Ito et al (6), and selected for histidine, leucine and tryptophan prototrophy. After 6-8 days at 30°C, the colonies were assayed for ß-Galactosidase (ß-Gal) activity by replica plating the yeast transformants onto filter paper. The filters were snap frozen in liquid nitrogen for 20 sec and incubated for 1-12 h at 30°C in a buffer containing 4mM 5-bromo-4-chloro- 3-indolyl-ß-D-galactopyranoside (X-Gal). Positive interactions were detected by the appearance of blue colonies and were verified by isolation of these colonies,

replating and retesting for ß-Gal activity. The pGAD10 plasmids were isolated from positive yeast transformants by culture in leucine-deficient medium that resulted in spontaneous loss of the pGBT9-derived plasmids.

Sequence analysis of pGAD1 0/cDNA.

The pGAD10/cDNA plasmid DNA was purified by CsCI gradient centrifugation to permit sequence analysis using the Matchmaker sequencing primer 2 (Clontech) that anneals to the GAL4 activation domain. Sequencing was performed using the dideoxynucleotide chain termination sequencing method (ABI PRISM, Perkin Elmer) and the resulting sequences were compared against the databases of EMBLJGenBank by the BLAST program via the Australian National Genome Information Service.

In vitro transcription/translation of positive clones.

The DNA sequences of clones from the cDNA library that were reactive in the yeast two-hybrid system were cloned into pBluescript KS+ and pcDNA3 as described above for use as a template for transcription of RNA. The pBluescript KS and pcDNA3 constructs were linearised with Sacil and Notl respectively, purified by phenol/chloroform extraction followed by ethanol precipitation then added to the transcription reaction (10). 1-10 jJ of the transcribed RNA was denatured at 67°C for 7 min then added to the rabbit reticulocyte lysate system (Promega). The translation mixture (as described by the manufacturer) was incubated at 30°C for 90 min. vitrotranslated[35S]-labelledproteinsin were dialysed against PBS for 5h at 4°C using a microdialysis system (GIBCO, BRL) to remove any unincorporated radiolabel.

Preparation of recombinant baculovirus and GST-preS1 expression.

A highly efficient system for obtaining recombinant baculovirus was used (7). The system is based on the co-transfection of digested baculovirus DNA, BacPak6, with

a baculovirus transfer vector carrying the gene of interest; digestion of BacPak6 with Aocl inactivates the essential gene downstream of the polyhedrin expression locus resuiting in the inability of the DNA to direct the synthesis of infectious virus after transfection. However, subsequent recombination with the baculovirus. transfer vector restores the essential gene sequence and results in the production of recombinant virus. Replacement of the polyhedrin gene in the BacPak6 DNA with ß-galactosidase allowed blue-white selection of the recombinant virus at the same time.

In these experiments, 1-2ug of bacMP was mixed with 100-200ng of Aoci-digested BacPak6 DNA in 30ul of HBS buffer (20mM Hepes pH7.3,150mM NaCI) and added to 30µl of HBS buffer containing 10µlDOTAP (Boehringer). The transfection mixture was then added to a 35mm petri dish containing a monolayer of 1.2 x 106 Sf9 cells. After 5-12h incubation at 28°C the transfection mix was replace with 2ml of tissue culture medium, TC100, supplemented with 5% foetal bovine serum (FBS, GIBCO) and the cells were incubated for a further 2 days at 28°C. The tissue culture fluid (TCF) was used to infect fresh monoiayers of Sf9 cells in 60mm dishes that were then overlaid with TC100/5% FBS media containing 1.5% SeaPlaque agarose (FMS Bioproducts) and subsequently incubated for 4 days at 28°C.

Recombinant plaques (white) were identified by the addition of 1 ml of phosphate- buffered saline (PBS) containing 0.5mg of X-gal (Promega) and incubated overnight at 28°C. The X-gal solution was replaced with 1 ml of PBS containing 0.2% neutral red (GIBCO) for 1 h at 28°C, the neutral red removed and the dishes were inverted and stored at room temperature for 12-48h until the plaques became visible. White plaques were picked, resuspended in 100A1 of sterile water, vortexed to disperse the agarose through the solution and the virus amplified by infecting monolayers of Sf9 cells in 25cm2 tissue culture flasks.

The TCF and cell lysates were harvested and GST-preS1 protein purified using glutathione Sepharose 4B beads (Pharmacia) then analysed by SDS-PAGE.

Recombinant baculovirus stocks for the expression of GST-preS1 protein were prepared and a high titre recombinant virus stock of bacMPV was used to infect Sf9 insect cells. Cell culture supernatants were harvested 4-5 days post infection and the secreted GST-preS1 protein absorbe with 0.3-0.5 mi of glutathione Sepharose 4B beads for 2-4 h at 4°C.

Purification of hepatitis B virions and HBsAg.

Hepatitis B virions were purified from HBV-infected patients with a high serum level of HBV DNA (1 x 10-1 x 10 vge/ml) as described by Qiao et al (9). HBsAg was purified from HH1 cells, a Mycoplasma-free cell line derived from PLC/PRF/5, which stably expresses HBsAg. Briefly, the particles in the TCF were concentrated by pelleting through a 2 mi cushion of 20% sucrose [in 1 OmM Tris-HCI pH 7.4,100mM <BR> <BR> <BR> NaCI, 1mM EDTA (TNE)] in a SW41Ti rotor (Beckman) at 230 000 g for 5 h at 4°C.

Each HBsAg pellet was resuspended overnight in 50 ul of TNE at 4°C. The HBsAg preparations were then pooled and diluted to 2 ml with a CsCl solution to yield a final density of 1.2 g/cm3.

The sample was overlaid on a discontinuous gradient containing 3 ml of 1.4 g/cm3 and 2 ml of 1.25 g/cm3CsCl in TNE. The tube was then filled with 1.1 g/cm3 of <BR> <BR> <BR> <BR> CsCI in TNE, and centrifuged in a SW4lTi rotor (Beckman) at 270 000 g for 40 h at 10°C. 300, ul fractions were collected from the bottom of the tube and examined for HBsAg levels by enzyme linked immunosorbent assay (ELISA). Fractions containing HBsAg were pooled and recentrifuged through a sucrose cushion as described above. The pellet was resuspended in 200 ul of PBS. Both the HBV and HBsAg preparations were examined by SDS-PAGE and silver stain to confirm the sample purity and levels of HBsAg in each.

GST-preS1 protein in vitro binding assav.

GST-preS1 protein was expressed and purified as described above. A recombinant baculovirus which expressed only GST (a gift from Dr. Alexander Khromykh, Sir Albert Sakzewski Virus Research Centre, Royal Children's Hospital) was treated in the same manner for use as a negative control 105x cpm of dialysed [35S]-labelled proteins were incubated with 1-2 µg of either GST or GST- preS1 protein overnight at 4°C in binding buffer (20mM Tris-HCI pH 8.0,300mM NaCI, 0.05% Nonidet-P40,10% BSA, 2, ug/ml Leupeptin, 1mM Pefabloc, 1U/5ml Aprotinin). The beads were then pelleted at low speed (1000g), washed four times in RIPA buffer [50mM Tris-HCI pH 7.5,300mM NaCI, 0.5% NP40,0.5% sodium deoxycholate, 0.1% sodium dodecyl sulphate (SDS)] supplemented with protease inhibitors. The pellets were solubilised in sample buffer (10% glycerol, zip mercaptoethanol, 2% SDS, 50mM Tris pH6.8,0.05% bromophenol blue), the samples separated by SDS-PAGE and analysed by phosphorimaging (Molecular Dynamics).

Additional assays were performed to examine the specificity of the interaction of clones #1 and #6 with HBV. Purified HBV and HBsAg, each containing 7.5 ug of p24 and gp 27, were incubated with 2 x 10 cpm of radiolabelled protein overnight at 4°C prior to the addition of the GST-preS1 protein immobilised on beads.

Dose response curve To determine if HBV could compete with the interaction between protein #6 and the GST-preS1 protein in a dose-dependent manner, the HBV competition assay described above was employed using various dilutions of purified HBV, i. e., 1/2.5, 1/5,1/10,1/20,1/50,1/100. The dilutions were prepared relative to the original concentration of HBV used in the competition assay and were preincubated with [35S]-labelled protein #6 prior to incubation of the protein with the GST-preS1

coated beads. The samples were then separated by SDS-PAGE and examined by phosphorimaging (results not shown).

Northern blot hvbridization.

A confluent monolayer (in 80 cm2 tissue cuiture flasks) of a number of different cell lines, i. e., HepG2, HeLa, A549,293, U937, and HEp2, was harvested and the total cellular RNA was extracted using a guanidinium-isothiocyanate technique. The mRNA was purified from the HepG2 and HeLa cell RNA using the PolyATract mRNA isolation system IV (Promega) according to the manufacturers protocol.

RNA was also isolated from normal human liver tissue by grinding 0.2g into a fine powder in liquid nitrogen, with a mortar and pestle, and the RNA extracted as described above. Twenty ug samples of total RNA were analysed by northern blot hybridization as described (1), except that the hybridization was carried out at 50°C and the high stringency washes were performed at 68°C. The 32P-labelled RNA used for hybridization was transcribed using T3 RNA polymerase from plasmid pBluescript KS+, containing the corresponding cDNA, linearized with Sacil.

Results Identification of cellular proteins which interact with the HBV preS1 protein in the yeast two hybrid system.

In an attempt to identify cellular proteins which interact with the preS1 domain of L- HBsAg we used the yeast two hybrid system. The HBV preS1 region, encoding (aa 1-108), was fused to the GAL4 DNA-binding domain of pGBT9 and used to screen a cDNA library derived from human adult liver. This cDNA library was fused to the GAL4 activation domain in the pGAD10 vector. These two plasmids were cotransformed into the yeast strain HF7C. Of the 1.9 x 106 transformants screened, 80 demonstrated ß-Gal activity and grew in the absence of tryptophan, leucine and histidine. Fifty-six false positives were eliminated by culturing

+ +- Leu/Trp transformants in Leu SD medium. Under these conditions, pGAD10/cDNA (which carries the Leu2 gene) is maintained while the pGBT9/S1 + plasmid is randomly lost. Of the remaining 24 Leu yeast transformants, only ten clones still expressed (3-Gai activity when cotransformed with pGBT9/S1. Thus these ten clones were considered to express proteins which showed a genuine interaction with the preS1 protein of HBV.

DNA sequence analysis of these ten clones revealed high homology (80-99%) with a number of different genes in the Genebank database (Table 1), one of which was identified as Apolipoprotein H, previously described as a candidate for the HBV cell surface receptor.

TABLE 1 : i 1 Human mitochondrial genome mRNA ++ 2 Human apolipoprotein H mRNA for 0-2-glycoprotein I 3 Human fibrinogen P-chain precursor 4 Human S-protein gene + Human vitronectin precursor I 5 Human thymosin beta-4 gene 6 H. sapiens partial cDNA sequence 84586 5'++ 7 Human hypoxanthine phosphoribosyl-transferase (HPRT) gene + 8 Human X-box binding protein-1 mRNA ++ H. sapiens cDNA for TREB protein 11 9 Human galactocerebrosidase mRNA + 10 Human pigment epithelium-differentiation factor (PEDF) gene + I H. sapiens partial cDNA sequence, clone c-3ego7

This suggested that the yeast two-hybrid system has the potential to detect previously acknowledged L-HBsAg-cell protein interactions. A comparison of the ten cDNA fragments isolated using the yeast two-hybrid system and the corresponding gene listed in the Genebank database is shown in Table 2.

TABLE 2 CDNA Gfone Fragment : Genabank 5equenc : : ib 1 550 15447 2 450 1153 3 1200 8878 4 1100 5296 5 600 556 6 550 385 7 300 56737 8 600 1818 9 2300 3761 10 1150 1490

By macroscopic analysis, four of the ten clones displayed very intense ß-gal activity which is indicative of a strong interaction between the cellular protein and preS1 protein, while the remaining six clones only demonstrated a moderate to weak interaction with the preS1 protein.

Confirmation of cellular protein-preS1 interactions.

Although the yeast two-hybrid system can identify genuine protein-protein interactions, the system can also generate artefacts which appear to be positive.

Thus, to confirm the above results in a more rigorous system, the specificity of the interaction of the preS1 region with the proteins expressed from the ten cDNA clones was examined in an in vitro binding assay using a GST-preS1 fusion protein.

In vitro transcription/translation of the 10 cDNA partial sequences.

The ten cDNA clones were excised from pGAD10 and recloned into plasmids suitable for the in vitro transcription of RNA (as described in materials and methods). This was then used for the in vitro translation of radiolabelled protein and the products were examined by SDS-PAGE. The in vitro translated proteins ranged in size from 23kDa to 60kDa (Figure 1).

Interaction of proteinscellular with GST-preS1 protein.

The [35S]-labelledproteins were then examined for their ability to bind a baculovirus-derived GST-preS1 fusion protein attached to a Sepharose bead. All ten proteins synthesised by in vitro translation were incubated respectively with the immobilised GST-preSl. Bound proteins were detected by SDS-PAGE (Figure 2) and the relative intensities of the binding interaction was then quantitated by phoshorimager analysis of the gel (Figure 3). Two proteins (&num 1 and #6) which showed strong binding in the yeast system, also demonstrated strong binding to the GST-preS1 protein, while the remaining eight proteins displayed moderate to weak interactions. These included proteins #2 and #8 which demonstrated high ß- galactosidase activity (indicative of strong binding) in the yeast system. None of the radiolabelled proteins were able to bind to the GST protein (data not shown).

Hydrophilicity plots.

Hydrophilicity plots of the two proteins dominant in the in vitro binding assay, that also demonstrated intense ß-galactosidase activity in the yeast two-hybrid system, were generated to determine if either displayed a characteristic trans-membrane profile that might provide additional evidence for a putative cell surface receptor (Figure 4). These plots were generated using the Kyte-Doolittle scale. All four proteins displayed some degree of hydrophobicity and surface probability, but no definitive conclusions could be made from these studies. Thus, further steps were taken to examine the receptor potential of these two proteins.

Tissue distribution of the two cellularproteins.

To examine whether the two genes of interest, #1 and #6, showed specific expression in the liver or was expressed in a number of different organs, RNA was extracted from cell lines derived from a variety of human tissues. Both total RNA and poly (A) + mRNA was examined by Northern blot hybridization analysis. The results showed that transcripts which hybridized with clone #1 were present in all cell types including cet lines derived from liver, kidney, macrophage, lung, epithelial, and larynx; whereas transcripts which hybridized with clone #6 were found specifically within liver-derived cells and in RNA derived from liver tissue.

HBV competition assay. : The above results showed that two cellular proteins which bound to GST-preS1 displayed distinctly different cellular distribution patterns. As one might predict the cellular receptor to be expressed specifically in the liver, we then examined if the binding demonstrated by protein #1 and #6 was physiologically relevant.

Consequently, we examined the ability of purified HBV or HBsAg to compete with the binding between the cellular proteins and the GST-preS1 protein. The radiolabelled protein was preincubated with purified HBV or HBsAg preparations that were adjusted to contain similar levels of gp27/p24 (Figure 5). After incubation,

the mixture was then added to the GST-preS1 beads. The results of this experiment showed, in a striking manner, that HBV was able to compete with GST- preS1 for binding to protein #6 (Figure 6. lane 3) whereas HBsAg was unable to do so (lane 2). However, neither HBsAg or HBV appeared to have any significant. effect on the interaction between protein #1 and preS1 protein (lane 5 and 6 respectively). The possibility that the results obtained were due to any direct effect by proteases which may be present in the HBV preparation was ruled out by mixing radiolabelled protein with HBV alone; no degradation of either protein was observed.

Dose Response Curve The results (not shown) demonstrated an increase in binding between protein #6 and the GST-preS1 protein concomitant with decreased levels of HBV. The SDS- PAGE results were then quantitated using ImageQuant, and the data were used to generate a dose response curve (not shown). The results indicate that HBV competes for the interaction between protein #6 and the GST-preS1 coated beads in a dose dependent manner.

Example 2 Additional studies, using a reciprocal approach, were carried out to further analyse the ability of protein #6 to interact with HBV virions by expressing the cellular protein as a fusion protein with GST using the baculovirus expression system.

Materials and Methods 5 x 107 vge/ml of concentrated HBV virions were incubated with 1 pu ouf either GST or GST-protein6 immobilised on Sepharose 4B beads for 2 h at 4°C.

Following incubation, to allow interaction between virus and the immobilised proteins and washing, viral DNA was isolated from the virions bound to the beads

and in the supernatant. This was achieved by digestion of the samples with 1 mg/mi proteinase K, 2 % SDS overnight at 55 °C, foilowed by phenol/chloroform extraction and ethanol precipitation.

The HBV DNA present in each sample was detected (Figure 7) by PCR using primers DAW1 and DAW2 (a gift from Dr. Ming Qiao, institut of Medical and Veterinary Science, Adelaide) which are designed to amplify a 384-bp region from the core gene (9). The plasmid, pKSHBVA (14) was used as a positive control.

Results A HBV DNA product of 384 bp was detected in DNA purified from the GST- protein6, but not in the sample from the GST protein alone (lanes 3 and 1 respectively). A PCR product of similar size was apparent in the positive control (lane 6), and in the supernatants of each reaction, suggesting that an excess of HBV virions was present.

NUCLEOTIDE AND AMINO ACID SEQUENCES Listed herein as Sequence ID No: 1 is the amino acid sequence of the protein #6.

Listed herein as Sequence ID No: 2 is the nucleotide sequence (5'-3') of the clone encoding protein #6.

Listed herein as sequence ID No: 3 is the nucleotide sequence (5'-3') of a 3'RACE product obtained from the nucleotide sequence listed herein as Sequence ID No: 2.

3'RACE was carried out according to the instructions supplied with the Boehringer Mannheim 5'/3'RACE kit. First-strand cDNA was synthesized using 1 mg of normal human iiver RNA in a reaction mixture containing reverse transcriptase, dNTPs and the clone #6 specific primer 3-R-46-1 (ATTGTGAGAAAGTGCTCACCATCTA) in buffer (50mM Tris-HCI, 8mM Mec12, 30mM KCI, 1 mM DTT, pH 8.5).

The reaction was incubated for 60 minutes at 55°C, followed by heat inactivation of the reverse transcriptase at 65°C for 10 minutes. cDNA was then directly amplified by PCR using primers 3-R-46-1 and oligo-dT (GACTCGAGTCGACATCGA) designed to anneal to the. natural poly (A) tail of mRNAs. PCR was carried out for a total of 30 cycles under the following conditions-annealing at 55°C 30 seconds, elongation at 72°C for 40 seconds, and denaturation at 94°C for 15 seconds, with a final elongation step of 10 minutes. PCR products were visualise by agarose gel electrophoresis prior to subsequent characterisation.

Further modifications and adaptations apparent to one skilled in the art are to be encompassed by the present invention.

REFERENCES 1. Beard, M. R., Macnaughton, T. B., and Gowans, E. J. (1996) Identification and characterization of a hepatitis delta virus RNA transcriptional promoter. J. Virol.

70, 4986-4995 2. Chien, C. T., Bartel, P. L., Sternglanz, R., and Fields, S. (1991). The two-hybrid system: A method to identify and clone genes for proteins that interact with a protein of interest. Proc. Nat. l. Acad. Sci. USA 88,9578-9582 3. Fields, S. and Song, O. (1989). A novel genetic system to detect protein-protein interactions. Nature 340,245-247 4. Galibert, F., Mandart, E., Fitoussi, F., Tillais, P., and Charnay, P. (1979) Nucleotide sequence of the hepatitis B virus genome (subtype ayw) cloned in E. coli Nature 281,646-650 5. Gietz, D., St. Jean, A., Woods, R. A., and Schiestl, R. H. (1992). Improved method for high efficiency transformation of intact yeast cells. Nuc. Acid. Res. 20, 1425-1425 <BR> <BR> 6. Ito, H., Fukada, Y., Murata, K., and Kimura, A. (1983). Transformation of intact yeast cells treated with alkali cations. J. Bacteriol. 153,163-168 7. Kitts, P. A. and Possee, R. D. (1993). A method for producing recombinant baculovirus expression vectors at high frequency. Biotechniques 14,810-817 8. Kuroki, K., Eng, F., Ishikawa, T., Turck, C., Harada, F., and Ganem, D. (1995). gp180, a host cell glycoprotein that binds duck hepatitis B virus particles, is encoded by a member of the carboxypeptidase gene family. J. Biol. Chem. 270, 15022-15028.

9. Qiao, M., Macnaughton, T. B., and Gowans, E. J. (1994). Adsorption and penetration of hepatitis B virus in a nonpermissive cell line. Virology 201,356-363 1 O. Rice, C. M., Grakoui, A., Galler, R., and Chambers, T. J. (1989). Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation. The New Biologist 1,285-296 11. Sureau, C., Guerra, B., and Lanford, R. E. (1993) Role of the large hepatitis B virus envelope protein in infectivity of the hepatitis delta virion. J. Virol. 67,366- 372 12. Tong, S., Li, J., and Wands, J. R. (1995). Interaction between duck hepatitis B virus and a 170-kilodalton cellular protein is mediated through a neutralizing epitope of the pre-S region and occurs during viral infection. J. Virol. 69,7106- 7112 <BR> <BR> 13. Wang, Y.-H., Davies, A. H., and Jones, 1. M. (1995). Expression and purification of glutathione S-transferase-tagged HIV-1 gp120: No evidence of an interaction with CD26. Virology 208,142-146.

14. Harvey, T. J., Macnaughton, T. B. and Gowans, E. J. (1997). The development and characterisation of a SV40 T-antigen positive cell line of human hepatic origin. Journal of Virological Methods 65,67-74.

SEQUENCE INFORMATION SEQUENCE ID No: 1 10 20 30 40 50 ***** DPNSGTKASL YSGEMALPQP PGEGWEAFRL RWAGSLTLGP QTGLPLEESV 60 70 80 90 * * * * AWTEGGNERV PSDTSRSPGA AGQWPGNGVD CEKVLTIYTP CMSSF* SEQUENCE ID No: 2 10 20 30 40 50 ***** GGATCCGAAT TCCGGCACAA AGGCTTCACT GTACTCAGGG GAGATGGCCC 60 70 80 90 100 ***** TACCACAGCC ACCTGGAGAG GGTTGGGAAG CCTTCCGTCT GCGGTGGGCA 110 120 130 140 150 * * * * * GGCAGCCTCA CCCTGGGCCC ACAGACCGGC CTTCCTTTGG AGGAAAGTGT 160 170 180 190 200 ***** GGCCTGGACT GAGGGAGGAA ATGAGCGAGT TCCCTCTGAC ACCAGCAGAT 210 220 230 240 250 ***** CCCCAGGGGC TGCTGGGCAG TGGCCTGGGA ATGGGGTGGA TTGTGAGAAA 260 270 280 290 300 ***** GTGCTCACCA TCTATACACC CTGTATGTCC AGCTTTTGAA CACAAGGGAA 310 320 330 340 350 ***** CCATGCTTCT CTTAGAGGTT AAGCAGGGTC ATTAACATCC TCCCCCAGTC 360 370 380 390 400 ***** CCTAACATCA CATTGTCCTG CGTGGCTCCT CTGGCCCTGA GTGGCACCTG 410 420 430 440 450 ***** TCCCTCTGGT CTCCCAGCAC CTGGCCCAGG TAACAGCCTT CTGAAAGCAG

460 470 480 490 500 ***** AGCCAAGGAG CTGCTTCTCT CTTCTCCCAG TTCTACCTCC CCAGAAGCCT 510 520 530 540 550 ***** TCCTCCCCAG GTGGGGCTGA TGGAGCAAGG GTCCAGACTA GGAGCCTTCC 560 570 580 590 600 ***** ACCCCAGCTG TGTCTGGCGC CCCTAGATCT CTGCAAGGGA GGTGTTACAG 610 620 630 640 650 ***** CTGGTTCTGA GCCGCTTGCC GGAATTCCGG CCGGAATTCC AGATCTATGA 660 670 680 690 700 * * * * * ATCGTAGATA CTGAAAAACC CCGCAAGTTC ACTTCAACTG TGCATCGTGC 710 720 730 740 * * * * ACCATCTCAA TTTCTTTCAT TTATACATCG TTTTGCCTTC TTTTATGTA SEQUENCE ID No: 3 10 20 30 40 50 ***** TTCACTAGTG ATTATTGTGA GAAAGTGCTC ACCATCTATA CACCCTGTAT AAGTGATCAC TAATAACACT CTTTCACGAG TGGTAGATAT GTGGGACATA 60 70 80 90 100 ***** GTCCAGCTTT TGAACACAAG GGAACCATGC TTCTCTTAGA GGTTAAGCAG CAGGTCGAAA ACTTGTGTTC CCTTGGTACG AAGAGAATCT CCAATTCGTC 110 120 130 140 150 ***** GGTCATTAAC ATCCTCCCCC AGTCCCTAAC ATCACATTGT CCTGCGTGGC CCAGTAATTG TAGGAGGGGG TCAGGGATTG TAGTGTAACA GGACGCACCG 160 170 180 190 200 ***** TCCTCTGGCC CTGAGTGGCA CCTGTCCCTC TGGTCTCCCA GCACCTGGCC AGGAGACCGG GACTCACCGT GGACAGGGAG ACCAGAGGGT CGTGGACCGG 210 220 230 240 250 ***** CAGGTAACAG CCTTCTGAAA GCAGAGCCAA GGAGCTGCTT CTCTCTTCTC GTCCATTGTC GGAAGACTTT CGTCTCGGTT CCTCGACGAA GAGAGAAGAG 260 270 280 290 300 ***** CCAGTTCTAC CTCCCCAGAA GCCTTCCTCC CCAGGTGGGG CTGATGGAGC GGTCAAGATG GAGGGGTCTT CGGAAGGAGG GGTCCACCCC GACTACCTCG

310 320 330 340 350 * * * * * AAGGGTCCAG ACTAGGAGCC TTCCACCCCA GCTGTGTCTG GCGCCCCTAG TTCCCAGGTC TGATCCTCGG AAGGTGGGGT CGACACAGAC CGCGGGGATC 360 370 380 390 400 ***** ATCTCTGCAA GGGAGGTGTT ACAGCTGGTT CTGAGCCGCT TGCCTTGTGA TAGAGACGTT CCCTCCACAA TGTCGACCAA GACTCGGCGA ACGGAACACT 410 420 430 440 450 ***** TGGTAAGACA CCAACCTTTA CATTCTTCCC TGANGTTGTG GCTGACANAA ACCATTCTGT GGTTGGAAAT GTAAGAAGGG ACTNCAACAC CGACTGTNTT 460 470 480 490 500 ***** CCTGCTTGGC CCACTGTTAN TCCAGCGAGC TCCTATATCA AAATGCCGTA GGACGAACCG GGTGACAATN AGGTCGCTCG AGGATATAGT TTTACGGCAT 510 520 530 540 550 ***** TGCCGGGTGG GTTACAAACA ACAGAAACGT ATTGCTCACA GTCCTGGGGG ACGGCCCACC CAATGTTTGT TGTCTTTGCA TAACGAGTGT CAGGACCCCC 560 570 580 590 600 ***** GCTGGGACGT CCAAGATCAA GAGGCANCAN ATTCGGGACT CCGCTGANGG CGACCCTGCA GGTTCTAGTT CTCCGTNGTN TAAGCCCTGA GGCGACTNCC 610 620 630 640 * * * * TGTTTCCCGA TCAANANATG GTGAGCACTT TTCTCACAAT AATCCGAA ACAAAGGGCT AGTTNTNTAC CACTCGTGAA AAGAGTGTTA TTAGGCTT