Background of the Invention Epidermal growth factor is a single-chain polypeptide having a molecular weight of 6 Kd (53 amino acid residues). The EGF peptide is already known to be a powerful nitogenic agent for a variety of cells in culture. In particular, EGF has been shown to stimulate the growth of epithelial cell tissue in a variety of preparations. However, biological activity of previously reported EGF peptide fragments is sometimes very low, and therefore a need remains for the synthesis of more bioactive forms. Peptide analogs already tested in the art have been found to be of varying potencies, some having greater bioactivity than others. A peptide having sufficient bioactivity so as to be a therapeutically effective clinical pharmaceutical agent has yet to be synthesized. Therefore, despite the promises that hEGF would become an important wound healing therapeutic, there has been few successful formulations thereof, partly due to the fact that hEGF as a protein is very unstable, particularly in aqueous solutions and at temperatures 20 or near normal body temperature. For example, Journal of Surgery Research 43,333 (1987) discloses that at room temperature, hEGF has less than 1 hour in half life which is far shorter than the time required to induce DNA synthesis of cells in the wound site. Furthermore, it is known that hEGF quickly losses its biological activity from attack by proteolytic enzymes which causes denaturation and decomposition in the wound site.

In order to overcome this short coming of hEGF, US Patent No.

4,944, 948 discloses a liposome gel formulation for the delivery of hEGF to the

wound site. EP0312208 further discloses pharmaceutical carriers for slow release formulations for hEGF. PCT Application No. W099/44631 is another patent application that attempts to extend the wound healing life of hEGF in order to effect useful treatment for cutaneous injury.

Despite the above-described attempts to improve the usefulness of hEGF, the stability of the enzyme remains a problem as long as it stays in an aqueous environment above 0 ° C.

Objects of the Invention Therefore, it is an object of this invention to resolve at least one or more of the problems as set forth in the prior art. As a minimum, it is an object of this invention to provide the public with a useful choice.

Summary of the Invention Accordingly, this invention provides a modified epidermal growth factor having an N-terminal cap covalently bonded to an amino terminus of an epidermal growth factor having an N-terminal ío delay inactivation of said modified epidermal growth factor comparing to said epidermal growth factor.

Preferably, said epidermal growth factor is human epidermal growth factor. Further, said N-terminal cap has at least three amino acids. More preferably, said N-terminal cap is selected from the group consisting of Ala- Arg-Ile, Cys-Xaa-Xaa, Xaa-Cys-Xaa, Xaa-Xaa-Cys. Additionally, said N- terminal cap is covalently linked to the N-terminal of EGF according to the following manner: Ala-Arg-Ile (-N-terminal), Cys-Xaa-Xaa (-N-terminal), Xaa- Cys-Xaa (-N-terminal), or Xaa-Xaa-Cys (-N-terminal). Moreover, said N- terminal cap is preferred to be Ala-Arg-Ile.

The N-terminal of EGF is preferred to be Asn.

This invention also provides a composition including the above modified epidermal growth factor.

It is another aspect of this invention to provide a nucleic acid molecule of SEQ ID NO : 1.

It is yet another aspect of this invention to provide a method of manufacturing the above modified EGF including the steps of : generating a vector including the nucleic acid molecule of SEQ ID NO: 1; transferring said vector to an expression cell; incubating said expression cell to express said modified EGF.

Brief description of the drawings Preferred embodiments of the present invention will now be explained by way of example and with reference to the accompany drawings in which : Figure 1 shows an example of a vector used in manufacturing the modified EGF of this invention.

Detailed Description of the Preferred Embodiment Objects, features, and aspects of the present invention are disclosed in or are obvious from the following description. It is to be understood by one of ordinary skill in the art that the present discussion is a description of exemplary embodiments only, and is not intended as limiting the broader aspects of the present invention, which broader aspects are embodied in the exemplary constructions.

As used herein, the term"having substantially the biologically activity of EGF"refers to a factor that has the mitogenic activity and wound healing ability of the naturally occurring EGF and an amino acid sequence of at least 90% homolog.

It was found in this invention that the stability of EGF can be enhanced if a small peptide fragment is attached to the N-terminal of EGF. The N-terminal refers to the Asn end of the EGF peptide, although this amino acid may be replaced. The small peptide fragment, which may be called the N-cap, is a peptide fragment having at least three amino acids. In one preferred embodiment, the N-cap is selected from the group consisting of Ala-Arg-Ile, Cys-Xaa-Xaa, Xaa-Cys-Xaa, Xaa-Xaa-Cys. The N-cap may be covalently linked to the N-terminal of EGF according to the following manner : Ala-Arg- Ile (-N-terminal), Cys-Xaa-Xaa (-N-terminal), Xaa-Cys-Xaa (-N-terminal), Xaa- Xaa-Cys (-N-terminal), even though the N-cap may be connected to the N- terminal of the EGF reversely. The most preferred N-cap may be Ala-Arg-Ile.

The modified EGF may be manufactured using the recombinant vector as shown in Figure 1. The vector can then be transferred into E. coli to express the modified EGF of this invention. In one example, the modified EGF was found to be expressed in a maximum amount after induced four hours with IPTG. The cells are then harvested by centrifuge after eight hours of incubation, and the cell walls are then broken down using known methods. The modified EGF can then be purified by chromatography technique. A person skilled in the art would be familiar with the above incubation techniques and would appreciate that modification to the above procedures will be required under different circumstances (purity of reagents, for example).

The EGF sequence in the vector may have the following sequence SEQ ID NO : 1: GCTAGAATTAATTCCGACTCTGAATGCCCGCTGTCTCACGACGGTTA CTGCCTACACGAT GGTGTTTGCATGTATATCGAAGCTCTGGACAAATACGCGTGCAACTG TGTTGTTGGTTAC ATCGGTGAACGTTGGCAGTACCGTGACCTGAAATGGTGGGAACTGC GTTAA Other sequences of the vector in Fig. 1 are readily available to a person skilled in the art, for example, the ampicillin resistance gene. The various sequences can then be linked by convention techniques.

Examples The bioactivity of three batches, named 990701,990702, and 990703, of a composition containing 2000IU/ml of the modified EGF of this invention having the N-cap Ala-Arg-Ile (-N-terminal) is tested. Each sample in test has a volume of 15. 0ml of 20mM phosphate buffer containing 10% glycerol and 1 % mannitol. 100 samples from each batch were used for each of the tests. The samples were stored under 2-8°C and 25°C and the bioactivity in terms of IU/ml was tested when the test began, 6 months later, 12 months later, then every three months until 24 months later, and then every 6 months until 36 months later.

Balb/c3T3 cells were used as the testing medium, and MTT chromatography was used to determine the bioactivity. The results are shown in the following table: Table 1 Bioactivity (IU/ml) of composition storing at 2-8°C over time Sample 990701 990702 990703 Test Start I 5657 4724 3249 I 3681 3531 3482 II 5897 4993 2828 6 months III 6063 4469 3034 x 5213 4331 3114 5213~1085.87 4331~604.78 3114~273.02 x~SD I 5134 3891 2949 II 4993 4000 3031 12 months III 5063 3945 3074 x 5063 3945 3018 x~SD 5063~57.56 3945~44.50 3018~51. 85 1 4287 3945 3531 II 4790 3249 3074 15 months III 3945 3531 3531 x 4340 3575 3378 x~SD 4340~347.05 3575~285.84 3378~215. 43 I 4532 3630 2868 II 4595 4169 3117 18 months III 3837 3594 3117 4521 3798 3034 x~SD 4521~343.44 3798~263.98 3034~117.38 I 2789 2602 2056 II 3031 2084 2050 21 months III 2676 2056 2114 2832 2247 2073 xSD 2832181. 36 2247307. 46 207335. 35 1 2210 2123 2207 II 2011 2072 2136 24 months III 2034 2106 2021 2085 2092 2102 x+SD 208588. 88 209265. 07 210270. 45 1 1375 1515 1519 II 1679 1621 1558 30 months III 1536 1493 1602 x 1530 1543 1560 x~SD 1530~124.80 1543~55.88 1560~33.90 I 1102 1076 1421 II 1061 1215 995 36 months III 1121 1084 1076 1095 1125 1164 x~SD 1095~25. 04 1125~63. 72 1164~184.71 Table 2 Bioactivity (IU/ml) of composition storing at 25°C over time Sample 990701 990702 990703 Test Start I 5657 4724 3249 I 3294 3074 3031 II 4993 3891 3204 6 months III 6774 4169 3204 x 5020 3711 31446 x~SD 5020~1420.84 3711~464.73 3146~81.55 I 4169 3531 2868 II 4595 3580 2567 12 months in428738372751 x 4350 3649 2728 x~SD 4350~179.59 3649~134.20 2728~123. 90 I 3387 3160 3031 II 3160 2751 2428 15 months III 3692 3387 2908 x 3692 3099 2789 xSD 3692599. 99 3099263. 17 27892 0. 16 I 2748 2567 2362 II 3294 3074 2781 18 months III 2868 2297 2173 2970 2646 2438 xSD 2970234. 28 2646322. 09 2438254. 07 1 1558 1433 1395 II 1495 1537 1454 21 months III 1474 1516 1474 1509 1495 1441 x~SD 1509~43.71 1495~54.99 1441~41.07 I 1320 1375 1283 II 1414 1338 1356 24 months III 1266 1231 1338 133 1315 1326 x~SD 1333~61.15 1315~61.06 1326~31. 05 I 1028 1149 1087 II 1014 1004 1042 30 months III 1007 1045 1037 1016 1041 1055 x~SD 1016~8.73 1041~50.17 1055~22.48 872 963 883 II 866 732 749 36 months III 876 815 762 x 871 837 798 xiSD 871~4.11 837~95.54 798~60.34

The above results show that the modified EGF of this invention can maintain 80-92% bioactivity after 18 months if stored at 2-8°C. If the modified EGF is stored at room temperature, this period may be reduced to 12 months.

While the preferred embodiment of the present invention has been described in detail by the examples, it is apparent that modifications and adaptations of the present invention will occur to those skilled in the art.

Furthermore, the embodiments of the present invention shall not be interpreted to be restricted by the examples or figures only. It is to be expressly understood, however, that such modifications and adaptations are within the scope of the present invention, as set forth in the following claims. For instance, features illustrated or described as part of one embodiment can be used on another embodiment to yield a still further embodiment. Thus, it is intended that the present invention cover such modifications and variations as come within the scope of the claims and their equivalents.